Invention Grant
- Patent Title: MicroRNAs 206 and 21 cooperate to promote RAS-extracellular signal-regulated kinase signaling by suppressing the translation of RASA1 and SPRED1
-
Application No.: US15252865Application Date: 2016-08-31
-
Publication No.: US10221415B2Publication Date: 2019-03-05
- Inventor: Sriganesh B. Sharma , Chen-Chung Lin , Mark K. Farrugia , J. Michael Ruppert
- Applicant: West Virginia University
- Applicant Address: US WV Morgantown
- Assignee: West Virginia University
- Current Assignee: West Virginia University
- Current Assignee Address: US WV Morgantown
- Agency: Buchanan Ingersoll & Rooney PC
- Agent Craig G. Cochenour, Esq.
- Main IPC: A61K31/713
- IPC: A61K31/713 ; C12N15/113 ; A61K9/00 ; A61K35/13
Abstract:
The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
Public/Granted literature
Information query
