Nucleic acid molecule
Abstract:
The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet β-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet β-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2: (SEQ ID NO: 1) UAAAGUGCUGACAGUGCAGAU (SEQ ID NO: 2) AGCUACAUCUGGCUACUGGGUCUC.
Public/Granted literature
Information query
Patent Agency Ranking
0/0