Invention Grant
- Patent Title: Targeting technology to selectively express mRNAs in cardiomyocytes while avoiding stimulation of cardiac fibroblasts
-
Application No.: US17711125Application Date: 2022-04-01
-
Publication No.: US11744902B2Publication Date: 2023-09-05
- Inventor: Stephen Navran
- Applicant: Animatus Biosciences, Inc.
- Applicant Address: US TX Houston
- Assignee: Animatus Biosciences, Inc.
- Current Assignee: Animatus Biosciences, Inc.
- Current Assignee Address: US TX Houston
- Agent Eric P. Mirabel, JD, LLM
- Main IPC: A61K47/69
- IPC: A61K47/69 ; C12N15/115 ; A61P9/00
Abstract:
Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
Public/Granted literature
Information query
