US09366144B2
An airfoil includes a leading edge, a trailing edge, a suction surface, a pressure surface, a cooling passageway, and a plurality of oblong pedestals. The suction surface and the pressure surface both extend axially between the leading edge and the trailing edge, as well as radially from a root section to a tip section of the airfoil. The cooling passageway is located between the suction surface and the pressure surface. The oblong pedestals connect the suction surface to the pressure surface at the trailing edge of the airfoil.
US09366140B2
A method for modifying a ceramic matrix component is disclosed including identifying a non-conforming region of a composite component capable of operating in a gas turbine engine; removing at least a portion of the non-conforming region to create an exposed surface of the composite component; preparing a preform in response to the removing at least a portion of the non-conforming region; applying a reactive constituent surface region to at least one of the exposed surface of the composite component and the preform, the reactive constituent surface region being capable of producing a non-equilibrium condition; positioning the preform to provide a contact region between the exposed surface of the composite component and the preform proximate the reactive constituent surface region; and reacting the reactive constituent surface region in an equilibrium reaction at the contact region to form a bond structure between the exposed surface of the composite component and the preform.
US09366127B1
An oil well gas separator that includes a seating nipple for a downhole pump. An inner and outer barrel define a fluid passage and a separation annulus with the well casing. A separated well liquid passage is directly connected to the pump inlet to reduce dissolution of gas from the separated liquid. An isolation means is provided to isolate the separation annulus from the well casing fluids.
US09366123B2
A tubing string assembly is disclosed for fluid treatment of a wellbore. The tubing string can be used for staged wellbore fluid treatment where a selected segment of the wellbore is treated, while other segments are sealed off. The tubing string can also be used where a ported tubing string is required to be run in in a pressure tight condition and later is needed to be in an open-port condition.
US09366122B2
A method for estimating a property of an earth formation penetrated by a borehole includes: performing a borehole integrity test at a pressure less than a fracture gradient pressure of the formation to provide leakage data; injecting a fluid into the formation at a first pressure greater than the fracture gradient pressure during a first injection time interval using a fluid injector; measuring pressure versus time using a pressure sensor and a timer during a first test time interval to provide first pressure data; injecting a fluid into the formation at a second flow rate greater than the first flow rate during a second injection time interval using the fluid injector; measuring pressure versus time using the pressure sensor and the timer during a second test time interval to provide second pressure data; and estimating the property using the first pressure data, the second pressure data, and the leakage data.
US09366121B2
The present disclosure relates to modeling the flow of fracturing fluid in a subterranean formation. Fluid flow within the reservoir media in a subterranean formation is modeled by a reservoir block flow model. Fluid flow within a fracture network in the reservoir is modeled by a fracture network flow model. Fluid flow between the fracture network and the reservoir media is modeled by an interface flow model. Output data are generated based on coupling the fracture network flow model, the reservoir block flow model, and the interface flow model. The output data represent characteristics of fracturing fluid leak-off from the fracture network into the reservoir media.
US09366119B2
A drive head for a wellhead, the drive head comprising: a rod drive; a pressure chamber; and a rod receiving part connected to the rod drive and enclosed within the pressure chamber. A method comprising: pressurizing a chamber mounted to a wellhead, in which the chamber encloses an upper end of a rod extending from the wellhead; and driving the rod using a rod receiving part enclosed within the chamber.
US09366108B2
The invention generally relates to a flow control device and a flow control methods. One embodiment provides a flow control device comprising: a first flow path to allow fluid to flow from an inlet port provided on an inlet side of the device to an outlet port provided on an outlet side of the device; a closure element arranged to prevent fluid flow along the first fluid path in a direction from the outlet port to the inlet port; and an arrangement adapted to open a second fluid path, different along at least part of its length from the first fluid path, in dependence upon the pressure of fluid at the outlet side, the second fluid path allowing fluid to flow from a first relief port provided on the outlet side to a second relief port provided on the inlet side, wherein the flow control device comprises an inner body part and an outer body part, the inner body part being sealingly arranged and moveable within the outer body part (4b; 40b) between a first position and a second position under the influence of the pressure of fluid at the outlet side, wherein a first part of the second fluid path is formed within the inner body part and a second part of the second fluid path is formed within the outer body part, the first and second parts of the second fluid path being in communication with one another when the inner body part is in the second position but not when the inner body part is in the first position, thereby opening the second fluid path when the inner body part moves from the first position to the second position.
US09366102B2
A wellhead vault for preventing alteration of the wellhead of a water supply. The vault is a heavy bell-shaped structure, formed of concrete, and having a downwardly facing concavity, and the vault placed over, with the concavity around the wellhead. The vaults too heavy to be removed by human lifting. Lifting elements are provided to allow the vault to be installed and removed by heavy construction equipment. The vault has a vent that communicates between the concavity and the outside, allowing air, but not liquid, liquid or solid contaminants, or animals, to pass through.
US09366098B2
A method for reducing lost circulation in drilling wells employs composite materials containing an engineering thermoplastic polymer and mineral fibers. Optionally the composites may also include other components such as calcium carbonate and blending agents.
US09366096B2
Embodiments of the present disclosure include a system having a clamping mechanism configured to apply a force on a first tool joint and a second tool joint, wherein the clamping mechanism is configured to transfer a torque from the first tool joint to the second tool joint, and the clamping mechanism is configured to rotate about an axis of the first and second tool joints.
US09366094B2
An adapter for a wired drill pipe joint includes an annular adapter having a first end and a second end, an annular recess extending partially into the first end of the adapter and an element of a communication coupler disposed at least partially within the annular recess, wherein the second end of the adapter is configured to be coupled to an end portion of the wired drill pipe joint.
US09366092B2
A system for use in a drilling operation that includes uphole electronic equipment and a drill string suspended in an earth borehole, a section of wired drill pipe that is part of a communication link between a downhole tool and the uphole electronic equipment, an interface for communicating between the section of wired drill pipe and a communication source/destination. The system includes a housing having a generally cylindrical outer shape which has a passage there through. The housing has a WDP end connectable to the section of wired drill pipe and a further end connectable to the communication source/destination. The system also includes a WDP circuit module disposed within the housing. The WDP circuit module electrically coupleable with the wired drill pipe section. The system includes a further circuit module, disposed within the housing, which is electrically coupled with the WDP circuit module and electrically coupleable with the communication source/destination.
US09366088B2
In an embodiment, a cutter assembly for use on a tunnel boring machine may include a cutter ring extending circumferentially about a central axis. The cutter ring may include a radially inner surface and a radially outer surface. The cutter assembly may also include superabrasive cutting elements distributed circumferentially about the axis. Each of the superabrasive cutting elements may be attached to the cutter ring and may include a polycrystalline diamond (“PCD”) body having a working surface. At least a number of the cutting elements may extend beyond the outer surface of the cutter ring.
US09366087B2
A rotary steerable drilling system may include a substantially non-rotating tool body, a rotatable shaft including at least one pivotable feature, where the rotatable shaft is at least partially disposed within the tool body, and a bias unit that alters the position of the rotatable shaft within the tool body. The rotary steerable drilling system may also include at least one force application member that alters the position of the tool body in the borehole. A downhole steering motor may include a rotor shaft with at least one pivotable joint, a steering motor housing, a bias unit that alters the position of the rotor shaft inside the steering motor housing, and at least one force application member that alters the position of the steering motor housing in a borehole.
US09366086B2
A method of forming a supported subterranean well bore in which, in one disclosed embodiment, a first drill bit is mounted on a first string of casing tubulars via a steerable tool, and the drill bit is used to form a first bore. Upon reaching the required depth the casing string is cemented in place to support the formed bore and a second drill bit is mounted on a second casing string and is inserted into the first casing string. The second drill bit is used to drill through the wall of the first casing string and proceed to form a second, deeper bore. Once the second drill bit has reached the required depth, the second casing string is cemented in place to support the second bore.
US09366084B2
A helical displacement well with preassembled segments includes a preassembled shaft-forming penetrator tube including helical plates mounted to its exterior that may be rotated to propel the casing into the ground. A hydraulic drill motor rotates the penetrator tube and as it moves deeper into the ground. Extension tubes may be added to and coupled to the penetrator tube. A hydraulic drill motor is attached to the upper end of the extension tubes in order to continue the rotation of the assembled helical displacement well. The filter screen and the piping are installed concurrently with the addition of the extension tubes at the surface of the ground.
US09366068B2
A counterbalance mechanism includes a first attachment strap that is fixedly attached to a body structure. An intermediate link is rotatably attached to the first attachment strap and rotatable about a winding axis relative to the first attachment strap. A first end of a second attachment strap is rotatably attached to a moveable panel. A second end of the second attachment strap is rotatably attached to the intermediate link, with the second attachment strap and the intermediate link rotatable relative to each other about a link axis. A spiral spring interconnects the first attachment strap and the intermediate link. The spiral spring biases the intermediate link about the winding axis to rotate the intermediate link and the second attachment strap relative to each other about the link axis, in a scissor-like motion, to rotate the panel relative to the body structure.
US09366054B2
A foldable tent includes a frame coupled to a canopy such that the frame and canopy are collectively collapsible from an open configuration to a folded configuration. The frame includes a plurality of spaced apart hubs positioned at an upper portion of the frame, at least one upper roof pole pivotally coupled with two adjacent hubs, a plurality of lower roof poles pivotally coupled to a corresponding hub and extending radially outward from each respective hub and away from the upper roof pole, and a plurality of collapsible side poles coupled to a corresponding lower roof pole. An eave pole pivotally coupled to a hub extends the canopy to form an eave or an extended roof.
US09366052B1
An apparatus includes a first strap including an upper end and a lower end. A second strap is disposed adjacent to the first strap and includes an upper end and a lower end. The upper and lower ends of the second strap correspond in position with respect to the upper and lower ends of the first strap. A base portion connects the first and second straps between the respective lower ends of the first and second straps. A height adjustment system includes at least one bar disposed adjacent to at least one of the first and second straps, and a lift assist component that engages with the bar. In an orientation where the first and second straps extend vertically with respect to a horizontal plane, a distance between the horizontal plane and the respective upper ends of the first and second straps is adjustable via engagement between the lift assist component and the bar.
US09366029B2
A method for forming a variably sized wall panel by supplying a face panel of a first material, the face panel having a front face and a back face, the back face having a plurality of crosspieces extending therefrom. The face panel is placed in a mold such that the front face of the face panel abuts a bottom of the mold and the back face of the face panel faces away from the bottom of the mold. A flowable second material is layered on top of the face panel and the flowable second material is allowed to harden such that the back face of the face panel and the crosspieces are frictionally bound to the hardened second material.
US09366018B1
An L-shaped module for construction of tiered stadium seating is provided. The module is formed from a plurality of hollow extrusions that are longitudinally welded to form a riser portion and a runner portion. The riser portion rises vertically from a connection to the runner portion. The interior of the extrusions may be used as concealment spaces for hardware or to aid in fluid drainage. Connections to a support structure may be spaced at distances of 20 feet or greater.
US09366016B2
Toilet basket (1) for receiving solid or gelled preparations having at least one container (3a, 3b, 3c, 3d) for receiving at least one preparation (4a, 4b, 4c, 4d), the container (3a, 3b, 3c, 3d) positionable below the toilet rim so that flushing water can flow over it when the toilet is flushed, and at least one inlet opening (5a, 5b, 5c, 5d) and one outlet opening (6a, 6b, 6c, 6d) shaped in the container wall (7) for the flushing water; a holder (2) for mounting the toilet basket (1) on the bowl rim; a flushing water distributing element (8) arranged and configured on the toilet basket (1) so that the flushing water distributing element (8) is impinged upon by flushing water upon flushing, and an equalized delivery of flushing water into the inlet opening (5a, 5b, 5c, 5d) of the container (3a, 3b, 3c, 3d) is produced.
US09366010B2
In a working machine having an upper slewing body rotated by a slewing electric motor, a controller outputs a command for switching a communication valve, and a command for specifying a torque of the slewing electric motor. The controller includes an abnormal-switching detection section which detects occurrence of abnormal switching in the communication valve, wherein the controller (i) determines, as a target value, a pressure which would be generated in the hydraulic motor if the communication valve was absent, or a torque determined based on the pressure, based on an operation state of a slewing operation device and a slewing state of the upper slewing body; (ii) determines, as an actual value, a pressure actually generated in the hydraulic motor or a torque determined based on the pressure; and (iii) outputs the torque command on the basis of a value obtained by subtracting the actual value from the target value.
US09366008B2
A heat exchanging device has a frame member mounted on a revolving frame, and this frame member supports an oil-cooler and a radiator. A support member is to support a canopy and the like. The support member is composed of a housing support base provided by extending in the left-right direction on an upper side of the engine and a left front leg part and a left rear leg part each having an upper end mounted on a left-side position in the left-right direction of the housing support base and a lower end mounted on the revolving frame by straddling an engine. The housing support base of this support member has a right side in the left-right direction formed as a free end. Further, the free end of the housing support base is configured to be mounted on the frame member of the heat exchanging device.
US09366006B2
A bucket for a work vehicle includes a bucket main body portion, left and right boom attachment portions, and a spill plate. The left and right boom attachment portions are adhered to the rear surface of a basal plate, to the left and right sides of the center of the basal plate in the lateral direction, respectively. The spill plate includes a first spill plate portion and a second spill plate portion. In a top view, the second spill plate portion includes a forward edge line extending in the left and right directions from a center of the bucket main body portion in the lateral direction, and first left and right edge lines extending to first and second connection points rearward and leftward and rightward from first and second front ends, which are the left and right ends of the forward edge line, respectively. In a top view, the first spill plate portion includes a second left edge line, a second right edge line, a third left edge line, and a third right edge line.
US09365989B2
A three-stage snow thrower having a housing, a power supply operatively connected to said housing, a longitudinal drive shaft extending from the power supply into the housing, and a lateral drive shaft extending rotatably attached to opposing side walls of the housing and being meshingly engaged with the longitudinal drive shaft within a gear assembly. The power supply drives the longitudinal drive shaft, thereby causing the longitudinal drive shaft to rotate, and at least a portion of such rotation is transferred to the lateral drive via a gear assembly. The first stage assembly includes a plurality of augers attached to the lateral drive shaft, wherein the first stage assembly pushes loosened snow axially toward the gear assembly. The second stage assembly includes at least one auger attached to the longitudinal drive shaft, wherein the second stage assembly pushes the snow from the first stage assembly axially rearward in a transverse manner relative to the first stage assembly. The third stage assembly includes an impeller that rotates to throw the snow from the second stage assembly through a chute attached to the housing to expel the snow from the housing.
US09365983B2
The invention discloses an on-line laser processing vehicle for a rail, including a chassis, a vehicle body, a steer-control chamber and a container; the steer-control chamber includes a console, a CCD monitoring system and a drive-switching operating system; a dual driving system and switching mechanism, which with a process-operation driving system, a conventional operation driving system and a switching mechanism, is disposed in the container; the process-operation driving system operates to provide driving power for the laser processing vehicle during laser processing, and precisely controls moving speed and distance of the laser processing vehicle; the switching mechanism operates to implement switching between the conventional operation driving system and the process-operation driving system. The invention ensures accurate processing trajectories of the laser processing vehicle during laser processing; facilitates on-line laser processing of a variety of rails, such as the rails of main line, curved rails, guard rails, switch rails and so on, so that wear resistance of the processed rail is greatly improved, and meets requirements of high-speed and heavy haul trains for wear resistance of the rail.
US09365982B2
It has now been discovered that the ratio of the wet tensile strength to the dry tensile strength of a tissue web, and more particularly a creped tissue web, can meet or exceed satisfactory levels without the excess use of a wet strength resin. For example, by treating the tissue making furnish with less than about 3 kilograms of wet strength resin per ton of furnish, forming the tissue web, and then creping the tissue web with a creping composition comprising a non-fibrous olefin polymer and a dispersing agent, a tissue web having a CD Wet/Dry ratio greater than about 0.30 may be produced. This discovery provides the flexibility to produce a tissue product with increased wet strength while reducing the add-on of wet strength agent.
US09365977B2
According to the disclosure, a wet form cellulosic product forming process and a wet formed cellulosic product are disclosed. The process includes providing a slurry, forming the slurry into a cellulosic product, dewatering the cellulosic product, and drying the cellulosic product. Further dewatering of the cellulosic product occurs through a non-mechanical mechanism.
US09365972B2
A process for producing a water-absorbent high-porosity fibrous matrix from lignocellulosic raw materials, comprising wet mechanical processing of the raw material, drying, and then dry mechanical processing the fibers to provide a fibrous matrix is provided. The high-porosity fibrous matrix and absorbent articles prepared therefrom are also provided.
US09365971B2
During the transverse-folding operation of items of laundry, a number of layers are positioned one above the other so as to overlap one another. In order to achieve optimum folding quality, the aim is for layers of equal length to overlap, which is only rarely possible in practice. It is usually the case that the layers are of unequal length, and this gives rise to a difference in overlap. The invention makes provision for the difference in overlap to be eliminated, or at least to be minimized, in that it is determined whether a difference in overlap is present and the difference in overlap which may be established is corrected for the transverse-folding operation of the next-following item of laundry, which allows established differences in overlap to be compensated for automatically at least for the most part.
US09365969B2
The present application relates to a steam generator iron. The steam generator iron has a steam passageway along which steam flows, the steam passageway having a first section (13) and a second section (16) extending from the first section (13). A flow stabilizing element (24, 35, 38) is disposed at the transition of the steam passageway from the first section (13) to the second section (16). Therefore, the generation of noise at the transition and the flow resistance in the steam passageway is minimized as steam flows along the steam passageway. The present application also relates to an insert for a steam generator iron.
US09365964B2
Disclosed is an apparatus for whipping a button sewing thread, capable of ensuring the operational convenience, reliability and durability by simplifying main elements of the apparatus. The apparatus includes a body including a holder for holding a sewed button; a tension control unit provided with a plurality of tensioners and a thread hook on a passage of the thread; a thread guide unit adjacent to the tension control unit to guide the thread toward the holder; a winding unit including a rotational arm for winding the thread around a sliding support linearly moving toward the holder; and a knotting unit including a separating arm linearly moving toward the holder in order to form a thread knot.
US09365963B2
A curable formaldehyde-free binding composition for use with fiberglass is provided. Such curable composition comprises an addition product of an amine and a reactant to form an amino-amide intermediate. To the amino-amide is added an aldehyde or ketone to form the curable binder composition. The composition when applied to fiberglass is cured to form a water-insoluble binder which exhibits good adhesion to glass. In a preferred embodiment the fiberglass is in the form of building insulation. In other embodiments the product is a microglass-based substrate for use in a printed circuit board, battery separator, filter stock, or reinforcement scrim.
US09365960B2
A sock with zones of varying numbers of layers is formed as a single tube on a circular knitting machine. At least one end of the tube is doubled back over a portion of the remainder of the tube to form a double layer first zone. The sock further includes a single layer zone adjacent to the double layer first zone, where no such folding occurs. Optionally, a second end of the tube may also be folded to create a third zone having two layers of material.
US09365951B2
A centrifugal spinning system and method for forming a fibrous web containing nanofibers, microfibers, or a combination thereof from a molten polymer composition or an aqueous spinning solution is provided. Through careful control over the arrangement of the system, a fibrous web can be formed that is relatively defect free. To help accomplish this feature, at least two centrifugal spinning chambers, each containing a charged forming plate, are utilized. To minimize the present of defects in the fibrous web, the charge applied to the first spinning chamber has a polarity that is opposite the polarity of the charge applied to the second spinning chamber.
US09365947B2
A mask is formed over a first conductive portion of a conductive layer to expose a second conductive portion of the conductive layer. An electrolytic process is performed to remove conductive material from a first region and a second region of the second conductive portion. The second region is aligned with the mask relative to an electric field applied by the electrolytic process. The second region separates the first region of the second conductive portion from the first conductive portion. The electrolytic process is concentrated relative to the second region such that removal occurs at a relatively higher rate in the second region than in the first region.
US09365945B2
A process for forming coatings on metallic web, the process including: immersing at least three metallic webs in an electrolytic solution contained in a reaction chamber; passing wave multiphase alternating current across said metallic webs by using back-to-back thyristors connected in parallel; moving the metallic webs through the electrolytic solution; and removing the coated webs from the reaction chamber.
US09365944B2
In a method for making hydraulic tubing a low carbon steel tube suitable for use as hydraulic tubing is coated on its inside surface with zinc phosphate and the outside surface is electroplated. The resulting hydraulic tubing will resist rust on the inside and on the outside during storage.
US09365941B2
The invention relates to a process for fabricating a monolayer or multilayer metal structure in LIGA technology, in which a photoresist layer is deposited on a flat metal substrate, a photoresist mold is created by irradiation or electron or ion bombardment, a metal or alloy is electroplated in this mold, the electroformed metal structure is detached from the substrate and the photoresist is separated from this metal structure, wherein the metal substrate is used as an agent involved in the forming of at least one surface of the metal structure other than that formed by the plane surface of the substrate.
US09365933B2
A method of forming a fine pattern includes providing a first metal layer on a base substrate, providing a first passivation layer on the first metal layer, providing a mask pattern on the first passivation layer, providing a partitioning wall pattern having a reverse taper shape by etching the first passivation layer, coating a composition having a block copolymer between the partitioning wall patterns adjacent each other, providing a self-aligned pattern by heating the composition, and providing a metal pattern by etching the first metal layer using the self-aligned pattern as a mask.
US09365910B2
A process for recovering hard material particles which are present in a residue quantity, which is in a free-flowing or pourable form, of a hard metal which has a matrix consisting of a steel, nickel or a nickel alloy, in which the hard material particles are embedded, comprising the following production steps: pouring the residue quantity into an acid bath which contains a strong acid having a pKa value measured at room temperature of <4, adding an oxidant to the acid bath, wherein by adding the oxidant or the acid a redox potential of the acid bath is set which is within a desired range of 300-800 mV, dissolving the matrix of the residue quantity, and depositing of the hard material particles contained in the acid bath after dissolving the matrix.
US09365902B2
The invention is to improved compositions and methods for the detection of target bisulfite converted methylated nucleotide sequences.
US09365886B2
A device for microbiological analyzes is provided. More specifically, a device is provided for standardizing the crossing and allowing a perfect angle of 90° between two graduated paper strips impregnated with a predefined concentration gradient of an antimicrobial agent, for evaluating their synergistic effect on the minimum inhibitory concentration (MIC) on a bacterial culture medium.
US09365885B2
The disclosure provides methods and kits for performing automated high-throughput assays to measure bactericidal activity in samples, such as plasma or sera from vaccinated subjects to evaluate the efficacy of vaccines against bacterial pathogens. The method combines obligatory linear-range data analysis, plate sealing and liquid volume handling for all assay steps to provide an automated, high-throughput measurement of bactericidal activity with favorable inter-assay and inter-operator variability.
US09365871B2
A fungal α-amylase is provided from Aspergillus clavatus (AcAmy1). AcAmy1 has an optimal pH of 4.5 and is operable at 30-75° C., allowing the enzyme to be used in combination with a glucoamylase in a saccharification reaction. This obviates the necessity of running a saccharification reaction as a batch process, where the pH and temperature must be readjusted for optimal use of the α-amylase or glucoamylase. AcAmy1 also catalyzes the saccharification of starch substrates to an oligosaccharide composition significantly enriched in DP2 and (DP1+DP2) compared to the products of saccharification catalyzed by an α-amylase from Aspergillus kawachii. This facilitates the utilization of the oligosaccharide composition by a fermenting organism in a simultaneous saccharification and fermentation process, for example.
US09365868B2
The invention provides, inter alia, methods for the production of acetone, isopropanol and/or precursors of acetone and/or isopropanol by microbial fermentation of substrates comprising CO, genetically modified microorganisms of use in such methods, nucleic acids suitable for preparation of genetically modified microorganisms, a novel alcohol dehydrogenase and nucleic acids encoding same.
US09365867B2
Complex viruses are assembled from simple protein subunits by sequential and irreversible assembly. During genome packaging in bacteriophages, a powerful molecular motor assembles at the special portal vertex of an empty prohead to initiate packaging. An aspect of the invention relates to the phage T4 packaging machine being highly promiscuous, translocating DNA into finished phage heads as well as into proheads. Single motors can force exogenous DNA into phage heads at the same rate as into proheads and phage heads undergo repeated initiations, packaging multiple DNA molecules into the same head. This shows that the phage DNA packaging machine has unusual conformational plasticity, powering DNA into an apparently passive capsid receptacle, including the highly stable virus shell, until it is full. These features allow for the design of a novel class of nanocapsid delivery vehicles.
US09365866B2
A reprogramming gene-loaded Sendai viral vector comprising Sendai virus genes and reprogramming genes, wherein the Sendai virus genes include an NP gene, P/C gene, M gene, F gene, HN gene and L gene, wherein each of the M gene, the F gene and the FIN gene is from a Sendai virus strain Cl.151-derived gene and wherein at least one of the M gene, the F gene and the HN gene is functionally deleted and the L gene encodes the amino-acid sequence of the L protein in which the amino-acid residue at position 1618 is valine and a method of producing the same.
US09365856B2
The present invention encompasses methods of administering SRFΔ3. Administering SRFΔ3 may reduce proliferation of cancer cells, and modulate activity of promoters regulated by serum response factor.
US09365855B2
The present disclosure relates generally to the field of nucleic acids and, more particularly, to aptamers capable of binding to 4-1BB; pharmaceutical compositions comprising such 4-1BB aptamers; and methods of making and using the same.
US09365854B2
The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: —the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or —a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein.
US09365853B2
The present invention provides matriptase inhibitors and compositions for treating and preventing orthomyxovirus infections such as flu infections. The present invention also provides novel compounds, compositions, methods of use, uses and kits thereof for inhibiting matriptase. Such compounds are useful for treating and preventing orthomyxovirus infections, such as flu infections, and for inhibiting tumor growth, progression and/or metastasis.
US09365852B2
The present invention concerns methods and compositions for diagnosing and/or treating vascular diseases including cancer, cardiac diseases, vascular diseases of the eye, and inflammatory diseases. The methods involve measuring the levels of one or multiple miRNAs in patient samples and using the test results to diagnose and/or predict an optimal treatment regimen for the patient. Compositions described in the invention include nucleic acids that function as miRNAs or miRNA inhibitors that can be introduced to a patient to reduce or increase vascularization as needed.
US09365846B2
The present invention provides, in part, an antibody display system that simultaneously uses a secretion and a display mode. A bait complexed with a monovalent antibody fragment can be expressed on the surface of the host cell wherein the fragment may be assayed for antigen binding while full antibody is simultaneously secreted from the host cell. Methods of using the system for identifying antibodies that bind specifically to an antigen of interest are also provided. Polypeptides, polynucleotides and host cells useful for making the antibody display system are also provided along with methods of use thereof.
US09365839B2
Disclosed herein are modified polymerase compositions exhibiting altered polymerase activity, which can be useful in a variety of biological applications. Also disclosed herein are methods of making and using such compositions. In some embodiments, the compositions exhibit altered properties that can enhance their utility in a variety of biological applications. Such altered properties, can include, for example, altered nucleotide binding affinities, altered nucleotide incorporation kinetics, altered photostability and/or altered nanoparticle tolerance, as well as a range of other properties as disclosed herein.
US09365832B2
The present disclosure provides a method to prepare purified enveloped viral particle preparations employing ion exchange chromatography and tangential flow filtration.
US09365831B2
The present invention relates to a system and method for controlling peptide display valency on virus-like particles (VLPs), especially including MS2 VLPs. In this method, large amounts of wild-type and low quantities of single-chain dimer coat proteins may be produced from a single RNA. Valency is controlled in immunogen (vaccine) production by providing a system that allows the production of large amounts of wild-type and low quantities of single-chain dimer coating proteins from a single RNA, allowing facile adjustment of display valency levels on VLPs, especially MS2 VLPS over a wide range, from few than one—on average—to as many as ninety per particle. This facilitates the production of immunogens and vaccines, including VLPs exhibiting low valency. Nucleic acid constructs useful in the expression of virus-like particles are disclosed, comprised of a coat polypeptide of MS2 modified by insertion of a heterologous peptide, wherein the heterologous peptide is displayed on the virus-like particle and encapsidates MS2 niRNA. Nucleic acid constructs are also disclosed which are useful in the expression of virus-like particles comprised of a coat polypeptide of PP7 modified by insertion of a heterologous peptide, wherein the heterologous peptide is displayed on the virus-like particle and encapsidates PP7 mRNA.
US09365830B2
The present invention relates to compositions and methods for inhibiting or suppressing undifferentiated or pluripotent stem cell growth and proliferation in a differentiated or differentiating cell population or culture.
US09365826B2
Methods and composition for maintenance of cardiomyocytes are provided. For example, in certain aspects methods including culturing the cardiomyocytes in a medium essentially free of serum or containing dialyzed serum to maintain long-term purity. In further aspects, methods for modulation of cardiomyocytes may be provided.
US09365817B2
Disclosed are dried and/or microencapsulated Saccharomyces cerevisiae cells with a high content of (S)-(+)-S-adenosyl-L-methionine, in the form of a free base obtainable from selected high-productivity strains of (S)-(+)-SAMe.
US09365816B2
Apparatus and methods for mechanical cell lysis with single cell resolution which requires very low applied pressure. The device can be handheld, simple to operate, requires no external power except for hand-applied pressure via a syringe, and is applicable to all cell types including yeast and bacterial cells. The device is also capable of mechanically lysing a single cell. A single cell is selected from a biological sample of interest. The single cell is lysed by application of mechanical stress in a single cell lysing apparatus having a trap structure for deterministically capturing the cell and a stress raiser that cooperates with a source of mechanical stress so as to apply sufficient force to rupture a cell. The stress raiser can be a properly designed edge of the trap or it can be a lithographically produced structure such as a nanoblade or a nanopillar.
US09365815B2
Provided are a particle separation device and a method of separating particles, each of which can easily separate particles for a short time without a great stress to the particles and easily collect the particles thus separated. The particle separation device includes at least: a separation flow path (i) to which a separation fluid and a particle group including two types of particles being different in density are supplied, and (ii) through which the separation fluid flows in a certain direction; a divergence section connected to at least an end of the separation flow path in the certain direction in which the separation fluid flows, a first flow path formed from the divergence section in a rising direction; and a second flow path formed from the divergence section in a falling direction, the separation flow path being formed in a horizontal direction.
US09365814B2
A system and method for detecting a pathogen in a sample is provided, the system capable of measuring the volume of a sample in a container through the use of various measurement technologies, thereby ensuring that a user is aware of volumes not meeting specification and/or allowing correction of results to account for the out-of-specification sample.
US09365808B2
Embodiments of the present disclosure generally relate to a composition, system, and method of unclogging and maintaining a drain or conduits that deliver fluids such as water. The system includes delivering a predetermined amount of drain cleaning composition to an obstruction wherein the predetermined amount may be delivered by a single-use packet. The composition for clearing a clogged drain may include sodium bisulfate, moisture, sodium sulfate, potassium, calcium, or iron.
US09365801B2
A system and method for the conversion of high free fatty acid (HFFA) containing oils defined as oils containing 20-100% free fatty acids (FFA) and low free fatty acid (LFFA) containing oils defined as oils containing 1-20% free fatty acids (FFA) into oil with less than 0.5% FFA (defined as NFFA oil) includes a combination of partial glycerolysis of HFFA oils to produce LFFA oils and subsequent stripping of LFFA oils to produce NFFA oils via steam distillation.
US09365800B2
The present invention provides a composition having a high content of highly unsaturated fatty acid alkyl ester. A method for producing a composition comprising a highly unsaturated fatty acid alkyl ester, the method comprising contacting a raw material comprising a highly unsaturated fatty acid alkyl ester with an aqueous solution comprising a silver salt and subsequently recovering an aqueous phase; adding an organic solvent to the aqueous phase, and subsequently recovering an organic solvent phase; and rectifying the organic solvent phase at a temperature of 170 to 190° C. and a column top vacuum degree of 1 Pa or less to recover the highly unsaturated fatty acid alkyl ester from the organic solvent phase.
US09365796B2
Estolide compounds and compositions, including two-cycle lubricating compositions comprising at least one estolide compound. Exemplary two-cycle lubricating compositions comprise an estolide base oil and an additive package.
US09365791B2
Briefly described, embodiments of this disclosure include articles and methods of making articles.
US09365789B2
The invention provides a dialkyl ether represented by the following formula (1): (wherein each of R1 and R2 represents a C1 to C20 alkyl group, and n is an integer of 1 to 20), and a lubricating base oil and a lubricating oil composition containing the dialkyl ether. The lubricating base oil and the lubricating oil composition exhibit low viscosity, excellent viscosity-temperature characteristics, and high fluidity at low temperature.
US09365787B2
A diesel fuel composition comprising a quaternary ammonium salt additive which additive is formed by the reaction of (1) a quaternising agent and (2) a compound formed by the reaction of a hydrocarbyl-substituted acylating agent and at least 1.4 molar equivalents of an amine of formula (B1) or (B2), wherein R2 and R3 are the same or different alkyl, alkenyl or aryl groups having from 1 to 22 carbon atoms; X is a bond or alkylene group having from 1 to 20 carbon atoms; n is from 0 to 20; m is from 1 to 5; and R4 is hydrogen or a C1 to C22 alkyl group.
US09365780B2
A method and process to remove sulfur compounds from a real fuel product of straight-run diesel (SRD) by the action of ozone bubbling and tert-butyl hydroperoxide (t-BUOOH) under normal laboratory conditions is disclosed. Slight desulfurization is taken place after ozone bubbling process which may be assigned to a removal of sulfur compounds in a gaseous form (SOx). Most of the organically bound sulfur and/or elemental sulfur and hydrogen sulfide still exist in the ozonized samples. Sulfur removal from SRD samples was achieved by combining ozone bubbling with extraction by using different solvents to remove the oxidized sulfur compound (polar) from ozonized samples. This method provides a considerable level of total sulfur reduction where the reduction of sulfur reaches 93%.
US09365772B2
A liquid crystal composition is described, which has a nematic phase and contains a compound having a high maximum temperature and a large dielectric anisotropy as a first component, and a specific compound having a large dielectric anisotropy as a second component, and may also contain a specific compound having a large dielectric anisotropy as a third component, and a compound having a small viscosity as a fourth component. An AM liquid crystal display device including the composition is also described.
US09365758B2
The present invention relates to a completely biodegradable organic product designed for producing a road snow melting/ground thawing agent or a biological agricultural fertilizer, comprising at least one salt, for example in the form of grit, brine or slurry, characterized in that it further comprises a material of plant origin consisting of at least one waste product from an oil pressing/extracting, winemaking or crushing process.
US09365755B2
An organic polymer, having a number-average molecular weight of 800 to 15,000, and comprising 0.5 or more but less than 1.2 reactive silicon groups in each molecule of the polymer on average, in which the reactive silicon groups are introduced into one-side out of terminals thereof, and heightening, in particular, the proportion of molecules (of the polymer) into each of which the silicon group is introduced.
US09365752B2
Provided are a pressure sensitive adhesive composition, a protective film, an optical film and a display device. The pressure sensitive adhesive composition shows appropriate low-speed and high-speed peel strengths after formation of a cross-linked structure, and has a superior balance between the two. Accordingly, when the pressure sensitive adhesive composition is applied to a protective film, for example, a superior protection effect as well as easy peel-off upon high-speed peeling, which is advantageous for a high-speed process, are shown, and in addition, a superior antistatic property may be obtained during the process.
US09365751B2
The present invention relates to silane reactive hot melt adhesive compositions having improved green strength, the production of such adhesives and the use of such adhesives.
US09365744B2
The invention relates to a copolyamide comprising at least two different units corresponding to the following general formulation: A/X.T A is chosen from a unit obtained from an amino acid, a unit obtained from a lactam and a unit corresponding to the formula (Ca diamine).(Cb diacid), with a representing the number of carbon atoms of the diamine and b representing the number of carbon atoms of the diacid, a and b each being between 4 and 36, advantageously between 9 and 18,X.T denotes a unit obtained from the polycondensation of a Cx diamine and of terephthalic acid, with x representing the number of carbon atoms of the Cx diamine, x being between 9 and 36, advantageously between 10 and 18,characterized in that said copolyamide exhibits: a content of amine chain ends of greater than or equal to 20 μeq/g, a content of acid chain ends of less than or equal to 100 μeq/g, and a content of unreactive chain ends of greater than or equal to 20 μeq/g, and to the process for the preparation of said copolyamide, to a composition comprising this copolyamide and to the use of this copolyamide and of such a composition.
US09365742B2
An article of manufacture comprising a substrate and an outer polymer coating on the substrate. The polymer coating comprises an oleophobic grafted polymer comprising a crosslinked fluoroelastomer group. A perfluorinated polyether is grafted to the crosslinked fluoroelastomer group.
US09365728B2
In this invention, processes which can be used to achieve stable doped carbon nanotubes are disclosed. Preferred CNT structures and morphologies for achieving maximum doping effects are also described. Dopant formulations and methods for achieving doping of a broad distribution of tube types are also described.
US09365726B2
The ink composition of the invention is applied to a region to which a color ink composition has been applied. The ink composition contains a weather resistance enhancer, is substantially free from a colorant, and is applied to a recording medium to form a coating film exhibiting an integrated value of light transmittance of not more than 2000 for each nanometer at wavelengths of 320 nm to 360 nm and an integrated value of light transmittance of not less than 36000 for each nanometer at wavelengths of 380 nm to 780 nm.
US09365721B2
The invention relates to a family of fluorescent compounds that comprise a bridged polycyclo moiety. The compounds can be chemically linked to biomolecules, such as proteins, nucleic acids, and therapeutic small molecules. The compounds can be used for imaging in a variety of medical, biological and diagnostic applications, and are particularly useful for the in vivo imaging of regions of interest within a mammal.
US09365714B2
Disclosed is a fluorine-containing polymer prepared by polymerizing: (I) a polyfluoroalkyl group-containing (meth)acrylate, in the presence of: (II) an isocyanate compound blocked with a pyrazole compound or a malonate ester. A water- and oil-repellent composition containing the fluorine-containing polymer can impart the excellent water- and oil-repellency, and excellent durability thereof to substrates.
US09365712B2
A curable fluorine-containing elastomer composition is described which includes a first curable perfluoropolymer comprising tetrafluoroethylene, a first perfluoroalkylvinyl ether and at least two cure site monomers, each having at least one cure site, wherein tetrafluoroethylene is present in the first curable perfluoropolymer in an amount of at least about 50 mole percent; a second curable perfluoropolymer comprising tetrafluoroethylene, a second perfluoroalkylvinyl ether and at least one second cure site monomer having at least one cure site, wherein the second curable perfluoropolymer comprises fluoroplastic particles therein; and at least two curatives. Cured compositions and molded articles formed from such compositions are also disclosed.
US09365710B2
A controlled rheology polypropylene that is made from Ziegler-Natta produced random copolymer and an additive formulation, extruded in the presence of a peroxide, exhibits low fluid retention and can be used to make medical/laboratory grade equipment, such a pipette tips.
US09365709B2
Provided are a plant derived plastic blend and a manufacturing method thereof in which high density polyethylene and polylactic acid are microscopically mixed to improve the mechanical properties of the plant derived plastic blend. The plant derived plastic blend comprises 10 wt % or more and 90 wt % or less of a plant derived polyethylene and 10 wt % or more and 90 wt % or less of a plant derived polylactic acid to achieve a total of 100 wt %, and further contains 1 wt % or more and 20 wt % or less of a compatibilizing agent. The manufacturing method of the plant derived plastic blend is carried out in a cylinder by applying a shear flow field and a stretching field and melt-kneading raw material containing the plant derived polyethylene, the polylactic acid and the compatibilizing agent.
US09365706B2
A crosslinked composition is obtained by crosslinking a composition, containing: 1 to 99 parts by mass of a vinyl aromatic copolymer rubber (I) comprising 5 to 70% by mass of a vinyl aromatic monomer unit and 0.1 to 30% by mass of a conjugated diene monomer unit and having one or more tan δ peak temperatures between 75° C. and 125° C.; 99 to 1 parts by mass of an ethylenic copolymer rubber (II); 10 to 100 parts by mass of an olefinic resin (III) based on 100 parts by mass of a total amount of the vinyl aromatic copolymer rubber (I) and the ethylenic copolymer rubber (II); and 0.01 to 50 parts by mass of a crosslinking agent (IV) based on 100 parts by mass of the total amount of the vinyl aromatic copolymer rubber (I) and the ethylenic copolymer rubber (II).
US09365702B2
A composition for extrusion-molded bodies which comprises a) an inorganic material that sets as a result of baking or sintering, and b) a methylhydroxypropyl cellulose having a DS(methyl) of from 0.8 to 2.5 and an MS(hydroxypropyl) of from 0.50 to 1.20 is useful for producing extrusion-molded bodies for use as a carrier for a catalyst, a catalyst, a heat exchanger, or a filter.
US09365701B2
A particle comprising nanoparticles encapsulated within a host material is disclosed, wherein the particle includes a coating disposed over at least a portion of the outer surface of the particle. In certain embodiments, nanoparticles have light-emissive properties. In certain embodiments, the coating covers all or substantially all of the outer surface of the particle. The coating can comprise a resin having low oxygen permeability. In certain embodiments, the coating comprises a polyvinyl alcohol compound. In certain embodiments, the coating comprises a polyvinylidene dichloride compound. Other embodiments relate to a powder comprising a particle of the invention, a composition including a particle of the invention, a formulation including a particle of the invention, a coating comprising a particle of the invention, a method for making a particle of the invention, and products and applications including a particle of the invention. In preferred embodiments, a nanoparticle comprises a semiconductor nanocrystal.
US09365696B2
A powdery mineral filler comprising a calcium compound and a magnesium compound, comprising a semi-hydrated dolomite of general formula aCaCO3.bCa(OH)2.cMg(OH)2.dMg0.eCaO, a, b, c, d and e being molar fractions with (a+b+e)/(c+d) between 0.8 and 1.2, and comprising particle agglomerates, a flame-retardant polymer composition containing same, production methods and use of such mineral fillers.
US09365695B2
The invention is directed to plasticized compositions comprising esters of terephthalic acid, particularly PVC compositions.
US09365694B2
Disclosed is a polyimide composition including a copolymer including first and/or second repeating unit including an imide repeating unit, or an amic acid repeating unit to form an imide repeating unit through imidization, and a third repeating unit including an amid repeating unit, wherein at least one terminal end of the copolymer is substituted with a substituted or unsubstituted siloxane or silanol group; and an inorganic particle or a precursor thereof.
US09365690B2
An article including a polymer element including a polymer, and inorganic particles having a concentration gradient which decreases in concentration from at least one surface of the polymer element to the inside thereof, wherein the inorganic particles have a refractive index that is greater than or equal to the refractive index of air and less than the refractive index of the polymer.
US09365673B2
The polyarylate resin of the present invention includes a bisphenol residue represented by the general formula (1) and an aromatic dicarboxylic acid residue represented by the general formula (2). In formula (1), R1 and R2 each independently represent a hydrocarbon group having 1 to 6 carbon atoms, a halogenated alkyl group or a halogen atom, p and q each independently represent an integer of 0 to 4, and X represents a fluorine atom-containing divalent group. In formula (2), R3 and R4 each independently represent a hydrocarbon group having 1 to 6 carbon atoms, a halogenated alkyl group or a halogen atom, and r and s each independently represent an integer of 0 to 4.
US09365671B2
Provided are a styrene-based copolymer prepared from a mixture including (A) an aromatic vinyl-based compound, (B) an unsaturated nitrile-based compound, and (C) a silicone-based compound having two or more unsaturated reactive groups to thereby be capable of implementing a uniform and excellent low gloss property with minimal or no deterioration of physical properties such as impact resistance, heat resistance, and the like, and a thermoplastic resin composition including the same.
US09365667B2
Methods for the preparation of fluorided-chlorided silica-coated alumina activator-supports are disclosed. These activator-supports can be used in catalyst systems for the production of olefin-based polymers, such as polyethylene and polypropylene.
US09365660B2
A group of compounds defined by the general formula (I) can be used to anionically initiate polymerization of unsaturated monomers. In the formula, M is an alkali metal atom, R1 is an aryl group having at least one OR2 substituent group where each R2 is a group that is nonreactive toward M, and R is a hydrocarbyl group. The subject initiators can be used in semi-batch and continuous polymerization processes, even those which are performed at elevated temperatures.
US09365654B2
The present invention relates to an antibody, recombinant or synthetic antigen-binding fragments thereof able to recognize and bind an epitope comprised in the TrkA amino acid sequence, medical uses thereof and a pharmaceutical composition comprising at least one of the above antibody, recombinant or synthetic antigen-binding fragments thereof.
US09365653B2
Antibodies and antigen-binding fragments thereof that bind to human PAC1 are provided. Nucleic acids encoding the antibodies and antigen-binding fragments thereof, vectors, and cells encoding the same are also provided. The antibodies and antigen-binding fragments thereof can inhibit binding of PAC1 to PACAP, and are useful in a number of PAC1 related disorders, including the treatment and/or prevention of headache disorders, including migraine.
US09365652B2
Reducing liver fibrosis in a subject having or being suspected of having a liver disease using an IL-20 antagonist, which can be an antibody that blocks a signaling pathway mediated by IL-20. Such antibodies include anti-IL-20 antibodies and anti-IL-20R antibodies that specifically block the IL-20 signaling pathway.
US09365645B1
The present invention relates to methods for modulating the glycosylation profile of recombinantly-expressed proteins. In particular, the present invention relates to methods of controlling the galactosylation profile of recombinantly-expressed proteins by supplementing production medium, e.g., a hydrolysate-based or a chemically defined medium, with manganese and/or D-galactose.
US09365641B2
The present invention provides compositions and methods for treating cancer in a human. The invention relates to targeting the stromal cell population in a tumor microenvironment. For example, in one embodiment, the invention provides a composition that is targeted to fibroblast activation protein (FAP). The invention includes a chimeric antigen receptor (CAR) which comprises an anti-FAP domain, a transmembrane domain, and a CD3zeta signaling domain.
US09365631B2
This document provides natriuretic polypeptides. For example, this document provides polypeptides having a natriuretic activity. In some cases, a polypeptide provided herein can have natriuretic activities without inducing excessive hypotension. This document also provides methods and materials for inducing natriuretic activities within a mammal.
US09365629B2
The invention relates to collections of target-specific designed binding proteins based on armadillo repeat proteins, and to a method of generating them. Designed armadillo repeat proteins are based on consensus sequences of single armadillo repeat units. These repeat proteins can be used as scaffolds for peptide recognition. Such a scaffold provides a binding mode that is in principle the same for every small recognizable unit, e.g. an amino acid or dipeptide, allowing a precise and modular recognition of a peptide in extended conformation. The method allows to generate a series of modules recognizing these simple units, and to combine such building blocks to create a binding site for any desired peptide target without performing additional selections.
US09365626B2
The present invention includes a novel protein, also referred to herein as simukunin, that inhibits the function of several physiologically important enzymes. Simukunin is a potent inhibitor of the blood coagulation cascade, inhibiting Factor Xa and functioning as an efficient anticoagulant. Simukunin also inhibits the serine proteases elastase and cathepsin and demonstrates anti-inflammatory properties. Also included are methods of making and using simukunin.
US09365616B2
C-terminal endostatin polypeptides are disclosed herein. Polynucleotides encoding these polypeptide, host cells transformed with the polynucleotides, and methods of using these polypeptides and polynucleotides are disclosed. Uses of these polypeptide, polynucleotides and expression vectors include the treatment of fibrosis in a subject. Thus, methods are provided for treating fibrosis, including fibrosis of the skin and/or the lung.
US09365612B2
A compound, or a pharmaceutically acceptable salt or ester thereof, of formula I: X—W wherein X is a caspase-selective structure and W has the structure of —NH—CH(Y)(Z) wherein Y is a structure that can form a reversible covalent bond with a caspase; and Z is selected from a carboxyl moiety or a carboxylic acid mimetic.
US09365607B1
The present invention is directed towards the synthesis of high purity deuterated sugars, deuterated phosphoramidites, deuterated nucleobases, deuterated nucleosides, deuterated oligonucleotides, and deuterated RNA's of defined sequences which can exhibit biochemically useful and biologically valuable properties, thus having potential for therapeutic uses.
US09365598B2
A phosphine derivative of DyLight dyes modified with ethylene glycol or (poly)ethylene glycol groups. In one embodiment, the compounds are useful in chemoselective ligation reactions.
US09365591B2
Provided herein are novel fluoroergoline derivatives and compositions thereof. In other embodiments, provided herein are methods of treatment, prevention, or amelioration of a variety of medical disorders such as, for example, migraine using the compounds and compositions disclosed herein. In still other embodiments, provided herein are methods of agonizing receptors such as, for example, the 5-HT1D and/or the 5-HT1B receptor, without agonizing the 5-HT2B receptor using the compounds and compositions disclosed herein. In still other embodiments, provided herein are methods of antagonizing or inhibiting activity at receptors such as, for example, the adrenergic alpha2A and/or the alpha2B receptors using the compounds and compositions disclosed herein.
US09365589B2
In its many embodiments, the present invention provides certain C2-ring-substituted iminothiazine compounds, including compounds Formula (I): (structurally represented) or a tautomers thereof, and pharmaceutically acceptable salts of said compounds and, wherein R1, R2, R3, R4, X, ring A, RA, m, -L1-, and RL are as defined herein. The novel compounds of the invention are useful as BACE inhibitors and/or for the treatment and prevention of various pathologies related thereto. Pharmaceutical compositions comprising one or more such compounds (alone and in combination with one or more other active agents), and methods for their preparation and use, including for the possible treatment of Alzheimer's disease, are also disclosed.
US09365586B2
The present invention relates to a process for preparing dithiinetetracarboximides by reaction of succinic monoamides with thionyl chloride, with continuous performance of at least one of the process steps.
US09365582B2
Inhibitors of HCV replication of formula (I) and the salts and stereoisomers thereof, wherein each dashed line (represented by - - - - -) represents an optional double bond; X is N, CH and where X bears a double bond it is C; R1 is —OR7, —NH—SO2R8; R2 is hydrogen, and where X is C or CH, R2 may also be C1-6alkyl; R3 is hydrogen, C1-6alkyl, C1-6alkoxyC1-6alkyl, C3-7cycloalkyl; n is 3, 4, 5, or 6; R4 is C1-6alkyl or C3-7cycloalkyl; R5 is hydrogen, halo, C1-6alkyl, hydroxy, C1-6alkoxy, polyhaloC1-6alkyl; R6 is hydrogen, C1-6alkoxy, mono- or diC1-6alkylamino; or R5 and R6 may form a 5- or 6-membered unsaturated or partially unsaturated ring, optionally comprising one or two selected from O, N and S; R7 is hydrogen; C3-7cycloalkyl optionally substituted with C1-6alkyl; or C1-6alkyl optionally substituted with C3-7cycloalkyl; R8 is C3-7cycloalkyl optionally substituted with C1-6alkyl; C1-6alkyl optionally substituted with C3-7cycloalkyl; or —NR8aR8b; R8a and R8b are C1-6alkyl, or both may form a 5- or 6-membered saturated heterocyclic ring; pharmaceutical compositions containing compounds (I) and processes for preparing compounds (I).
US09365578B2
This invention is directed to biaryl ether sulfonamides, or pharmaceutically acceptable salts, solvates or prodrugs thereof, for the treatment and/or prevention of sodium channel-mediated diseases or conditions, such as pain.
US09365567B2
Imidazoquinoline compounds with an alkoxy substituent at the 6, 7, 8, or 9-position, pharmaceutical compositions containing the compounds, intermediates, methods of making, and methods of use of these compounds as immunomodulators, for inducing or inhibiting cytokine biosynthesis in animals and in the treatment of diseases including viral, and neoplastic, are disclosed.
US09365558B2
The present invention provides compounds of Formula (I): or a stereoisomer, or a pharmaceutically acceptable salt thereof, wherein all of the variables are as defined herein. These compounds are monoacylglycerol acyltransferase type 2 (MGAT2) inhibitors which may be used as medicaments.
US09365557B2
The present invention relates to pyrazine compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors.Certain compounds of this invention have formula IA: wherein the variables are as defined herein.
US09365551B2
The present invention relates to novel compounds that inhibit LRRK2 kinase activity, processes for their preparation, to compositions containing them and to their use in the treatment of diseases characterized by LRRK2 kinase activity, for example Parkinson's disease or Alzheimer's disease.
US09365541B2
The present invention relates to compounds useful for treating parasitic diseases, which are infectious diseases caused or transmitted by a parasite. Compounds of the invention are particularly active against the causative pathogens in malaria. Such compounds are selective inhibitors of parasitic histone deacetylase (PfHDAC) and suppress the growth of parasites, such as Plasmodium falciparum, at a lower concentration than the concentration required for the inhibition of the growth of mammalian cells.
US09365539B2
Compounds of structural formula I are inhibitors of prolylcarboxypeptidase (PrCP). The compounds of the present invention are useful for the prevention and treatment of conditions related to the enzymatic activity of PrCP such as abnormal metabolism, including obesity; diabetes; metabolic syndrome; obesity related disorders; and diabetes related disorders.
US09365536B2
A method for producing glycolide provided with: step (1) wherein a GAO composition, which preferably contains a high-boiling-point organic solvent or a solubilizing agent, is supplied into a reactor and heated to a temperature at which a depolymerization reaction of the GAO occurs; step (2) wherein the heating is continued to subject the GAO to the depolymerization reaction, thereby producing glycolide; step (3) wherein glycolide is distilled out of the reactor; step (4) wherein the distillate is introduced into a rectifier and is rectified by means of gas-liquid countercurrent contact; and step (5) wherein glycolide is recovered. A method for purifying crude glycolide provided with: step (i) wherein a crude glycolide composition, which preferably contains a high-boiling-point organic solvent or a solubilizing agent, is supplied into a reactor and heated so that glycolicde is distilled; step (ii) wherein the distillate is introduced into a rectifier and is rectified by means of gas-liquid countercurrent contact; and step (iii) wherein glycolide is recovered. A glycolide producing apparatus and a crude glycolide purifying apparatus, each of which is provided with a reactor and a rectifier.
US09365535B2
The invention provides a process for the preparation of an alkylene glycol from an alkene. A gas composition from an alkylene oxide reactor is supplied to an alkylene oxide absorber comprising a column of vertically stacked trays or comprising a packed column. Lean absorbent comprising at least 20 wt % water is supplied to the alkylene oxide absorber and is contacted with the gas composition in the presence of one or more catalysts that promote carboxylation and hydrolysis. At least 50% of the alkylene oxide entering the alkylene oxide absorber is converted in the alkylene oxide absorber. Fat absorbent is withdrawn from the absorber, is optionally supplied to finishing reactors and/or a flash vessel or light ends stripper, and is subsequently subjected to dehydration and purification to provide a purified alkylene glycol product stream.
US09365529B2
Benzenesulfonamide compounds having a structure of formula (I) are described. Also described, are methods for synthesizing the compounds and to the use thereof in pharmaceutical compositions for human or veterinary medicine and in cosmetic compositions.
US09365525B2
An organosolv process for producing bio-products by decomposing lignocellulosic materials comprises providing an initial lignin solvent with water, an acid, and a lignin dissolving chemical comprising at least one of an organic ester, butyl acetate, an organic furan, and furfural. The process also includes placing the lignin solvent in contact with a biomass to form a circulation solvent, and recycling at least a portion of the circulation solvent by circulating the circulation solvent back into contact with the biomass. The circulating of the circulation solvent occurs for a period of time, after which, the process then includes separating material such as chemicals and lignin from the circulation solvent. The chemicals can be recycled as new solvent or sold while lignin can be used as natural and renewable colorant for polymers such as poly lactic acid.
US09365519B2
Described herein are compounds of Formula (I), pharmaceutically acceptable salts thereof, and pharmaceutical compositions thereof. Compounds of the present invention are useful for inhibiting PRMT5 activity. Methods of using the compounds for treating PRMT5-mediated disorders are also described.
US09365515B2
Oxime ester compounds of formula (I), wherein R1, R2, R3, R4, R5, R6, R7, R8, R9, and R10 independently of each other are hydrogen, C1-C20alkyl, (A), COR14, NO2, or OR15; provided that at least one of R1, R2, R3, R4, R5, R6, R7, R8, R9, and R10 is (A), and provided that at least one of the remaining R1, R2, R3, R4, R5, R6, R7, R8, R9, and R10 is COR14 or NO2; R11 is for example C1-C20alkyl, M or (B); X and X1 are for example a direct bond; R12 and R′12 are for example hydrogen or C1-C20alkyl; R13 and R′13 are for example C6-C20aryl or C3-C20heteroaryl; M is (X), (Y) or (Z); X3 is O, S or NR19; R14 and R15 are for example phenyl; R20, R21, R22, R23, R24, or R25 for example are hydrogen, COR14, NO2, or (B); provided that at least two oxime ester groups are present in the molecule; are useful as photoinitiators.
US09365505B2
A photoresist monomer, a photoresist and a method for the preparation thereof, a color filter. The photoresist monomer has a structure represented by Formula I, wherein, R1 is hydrogen or methyl; R2 is hydrogen, methyl, ethyl, or propyl; R3 is hydrogen or C1-6 alkyl; and n is from 1 to 4. The resulting photoresist exhibits a compact and smooth surface and a gentle angle of slope.
US09365493B2
The tetracycline class of antibiotics has played a major role in the treatment of infectious diseases for the past 50 years. However, the increased use of the tetracyclines in human and veterinary medicine has led to resistance among many organisms previously susceptible to tetracycline antibiotics. The modular synthesis of tetracyclines and tetracycline analogs described provides an efficient and enantioselective route to a variety of tetracycline analogs and polycyclines previously inaccessible via earlier tetracycline syntheses and semi-synthetic methods. These analogs may be used as anti-microbial agents or anti-proliferative agents in the treatment of diseases of humans or other animals.
US09365488B2
The present invention provides a method for producing alkyl nitrate. The centrifugal extraction equipment acts as the esterification separator; a mixed acid solution containing sulfuric acid and nitric acid enters from the heavy phase inlet of the centrifugal extraction equipment; alkyl alcohol enters from the light phase inlet of the centrifugal extraction equipment; the feeding molar ratio of alkyl alcohol and nitric acid equals to 1:1.0-3.0; esterification reaction occurs with the mixed acid and alkyl alcohol at a temperature of 10˜60° C. under the rotating speed of 800-2000 r/min; under the action of centrifugal force, the generated coarse ester as a light phase and the spent acid as a heavy phase are separated; coarse ester as a light phase is discharged through the light-phase outlet of the centrifugal extractor; the spent acid as a heavy phase is discharged through the heavy-phase outlet of the centrifugal extractor; after alkali washing and water washing conventionally, coarse ester is dehydrated for drying and purified, then the refining products of alkyl nitrate is obtained. In the method of the present invention, esterification reaction, the separation of reaction products and the spent acid are finished in the same reactor simultaneously, which reduces the contact time of reaction products with the spent acid greatly, avoids the side reaction effectively, and ensures the safety of esterification process.
US09365478B2
The present invention concerns a method for directly synthesizing acrolein or methacrolein from a mixture of methanol and ethanol or propanol. The method of the invention comprises two successive phases: oxidation in the presence of a selective oxidation catalyst of the light alcohols of the feedstock, then condensation by aldolization of the aldehydes formed during oxidation in the presence of a condensation catalyst (aldolization). Alternatively, the two phases can be carried out in the presence of a single catalyst, in particular in the presence of a molybdenum-based selective oxidation catalyst. These two phases can be conducted in a single reactor or in two cascade reactors.
US09365474B2
Disclosed herein are processes for producing phenol. The processes include oxidizing cyclohexylbenzene to produce an oxidation composition comprising cyclohexyl-1-phenyl-1-hydroperoxide. The cyclohexyl-1-phenyl-1-hydroperoxide in the oxidation composition may undergo a cleavage reaction to produce a cleavage reaction mixture comprising phenol, cyclohexanone and at least one contaminant. The cleavage reaction mixture may be contacted with a basic material to convert at least a portion of the contaminant to a converted contaminant, thereby producing a modified reaction mixture.
US09365473B2
The present invention relates to a method for preparing a catalyst composition comprising cobalt and molybdenum on a carbon support, characterized in that the cobalt- and molybdenum-source are dissolved in an organic solvent that is miscible with water. Moreover, a carbon supported cobalt molybdenum catalyst composition obtainable by said method and a process for producing alcohols from syngas using said carbon supported cobalt molybdenum catalyst composition is provided.
US09365468B2
Methods and systems for reforming and transalkylating hydrocarbons are disclosed. A method for processing a hydrocarbon stream includes the steps of separating para-xylene from a first mixed-xylene and ethylbenzene-containing stream to produce a first non-equilibrium xylene and ethylbenzene stream and isomerizing the first non-equilibrium xylene and ethylbenzene stream to produce additional para-xylene. The method further includes transalkylating a toluene stream to produce a second mixed-xylene and ethylbenzene-containing stream, separating para-xylene from the second mixed-xylene and ethylbenzene-containing stream to produce a second non-equilibrium xylene and ethylbenzene stream, and isomerizing the second non-equilibrium xylene and ethylbenzene stream using an ethylbenzene dealkylation type xylene isomerization process to produce additional para-xylene.
US09365465B2
An illumination composition comprising at least one oxidizer, at least one of a fuel and a binder, and at least one combustion rate modifier. The at least one oxidizer is selected from the group consisting of a potassium-containing oxidizer and a rubidium-containing oxidizer, the at least one oxidizer present in the illumination composition at from about 50 wt % to about 70 wt % and comprising particles each independently having a size within a range of from about 25 μm to about 325 μm. Additional illumination compositions, illumination flares, and methods of illuminating a target are also disclosed.
US09365461B2
An IBTL system having a low GHG footprint for converting biomass to liquid fuels in which a biomass feed is converted to liquids by direct liquefaction and the liquids are upgraded to produce premium fuels. Biomass residues from the direct liquefaction, and optionally additional biomass is pyrolyzed to produce structured biochar, hydrogen for the liquefaction and upgrading, and CO2 for conversion to algae, including blue green algae (cyanobacteria) in a photobioreactor (PBR). Produced algae and diazotrophic microorganisms are used to produce a biofertilizer that also contains structured biochar. The structured biochar acts as a nucleation agent for the algae in the PBR, as a absorption agent to absorb inorganics from the biomass feed to direct liquefaction or from the liquids produced thereby, and as a water retention agent in the biofertilizer. The ratio of cyanobacteria to diazotrophic microorganisms in the biofertilizer can be selected to optimize the so as to achieve desired total chemically active carbon and nitrogen contents in the soil for a given crop.
US09365452B2
The invention relates to a monomer-based condensation product, wherein the monomers comprising at least one monomer having an aldehyde moiety and at least one monomer having a ketone moiety, which is carrying at least one non-aromatic moiety and the condensation product comprises at least one moiety from the series of phosphono, sulphino, sulpho, sulphamido, sulphoxy, sulphoalkyloxy, sulphinoalkyloxy and phosphonooxy groups and/or salts thereof, wherein the monomers further comprising gallic acid. Additionally disclosed are the preparation and the use of these condensation products in chemical products for the construction industry.
US09365451B2
Coal is combusted in the presence of a clay additive and a slag additive to produce a combustion product that is useful as a pozzolanic additive for cement. The combustion process may be performed in a coal-fired boiler of an electrical power generation plant, resulting in improved operational efficiency and controlled emissions.
US09365450B2
Low emissivity coated panels can be fabricated using a base layer having a low refractive index layer on a high refractive index layer. The low refractive index layer can have refractive index less than 1.5, and can include MgF2, CaF2, SiO2, or BO. The high refractive index layer can have refractive index greater than 2.3, and can include TiOx, NbOx, or BiOx. The multilayer base structure can allow color tuning with enhanced transmission, for example, as compared to similar structures having single layer base layer.
US09365440B2
A method of producing an apparatus for removal of ions from water. A stack of the apparatus may be manufactured by: providing a first electrode with a first current collector; providing a spacer on top of the first electrode; and providing a second electrode on top of the spacer. The first electrode may be connected with a first connector to a first power terminal and a pressure may be exerted on the stack so as to move the first and/or second electrodes. The first connector may allow movement of the first electrode with respect to the first power terminal.
US09365436B2
A method and system of providing ultrapure water for semiconductor fabrication operations is provided. The water is treated by utilizing a free radical scavenging system and a free radical removal system. The free radical scavenging system can utilize actinic radiation with a free radical precursor compound, such as ammonium persulfate. The free radical removal system can comprise use of a reducing agent. The ultrapure water may be further treated by utilizing ion exchange media and degasification apparatus. A to control system can be utilized to regulate addition of the precursor compound, the intensity of the actinic radiation, and addition of the reducing agent to the water.
US09365418B2
A microfluidic device platform may include a valve manifold adapted to deliver a programmable pressure to a plurality of ports, a cell chamber having programmable environmental control, and a chip-to-world interface.
US09365415B2
An electronic device may include first and second laterally spaced apart interconnect substrates defining a slotted opening, and a first IC in the slotted opening and electrically coupled to one or more of the first and second interconnect substrates. The electronic device may include a first other IC over the first IC and electrically coupled to one or more of the first and second interconnect substrates, and encapsulation material over the first and second interconnect substrates, the first IC, and the first other IC.
US09365411B2
A MEMS device is provided in which, in order to suppress generation of a gas from an inner wall of a space in which a MEMS portion is disposed, the MEMS portion is disposed in a space constituted by at least a silicon nitride film and a silicon film, the silicon film has a first hole, the first hole is filled with a metal film or a metal silicide, and an airtight structure is formed by the metal film or the metal silicide, the silicon nitride film, and the silicon film.
US09365401B2
A battery powered forklift including a fork mounted on a front of a body to which a front wheel and a rear wheel are attached, a counter weight provided on a rear of the body, and a driving electric motor that allows the body to travel, the forklift includes: a battery mounted on the body above the rear wheel; a cargo-handling electric motor configured to generate oil pressure on operating oil that operates the fork; a control device configured to control the cargo-handling electric motor and the driving electric motor; a storage space provided in the body, below a bottom of the battery, and above a bottom of the body for storing the cargo-handling electric motor and the control device; and a fan that exhausts air in the storage space to an outside.
US09365400B1
Linear brake systems are provided. For example, in one embodiment, a baseplate having a linear brake housing mounted thereto is provided. A linear brake is partially disposed within the brake housing. The linear brake includes a braided cable; a collar attached to the proximal end of the braided cable; a member attached to the distal end of the braided cable; a rope having a portion that passes into a bore in the collar, through a tunnel formed by the braided cable and the collar, and exits the braided cable by passing between cable strands; and an interface mounted to the baseplate to extend the braided cable and constrict the braided cable upon the rope. The collar secures the proximal of the braided cable to the brake housing and the member secures the distal end of the braided cable to the interface.
US09365395B2
A load bearing member for supporting an elevator car has a plurality of tension members that bear the weight of the elevator car. The plurality of tension members extends along a length. An outer cover at least partially covers the plurality of tension members and has a first surface and a second surface.
US09365393B2
A conveying system and a method for registering service requests in a conveying system, including at least one transport device, is provided. A detection area bounded on a floor surface is in connection with the transport device, in which detection area the identification data contained in the personal identifiers of passengers is read. The service profiles of passengers who have arrived in the detection area and/or who have left the detection area are determined on the basis of the identification data, and a service request according to the service profiles is registered for transporting and/or admitting passengers in the detection area to the location indicated by the service request.
US09365388B2
An apparatus for continuously winding up a thread is described and includes two winding spindles that are held in a projecting manner on a rotary table and are associated with spindle drives to allow the thread to be alternately wound to form a bobbin. The rotary table can be activated in order to exchange the winding spindles between a winding region and a changing region. A moveable changing device transfers the thread between the winding spindles and during the exchange of the winding spindles, guides the thread between the winding spindles for transferring to a catching device on one of the winding spindles. The changing device has at least one deflecting thread guide and a movable feeding thread guide, which can be positioned in a deflecting position, the thread being guided at a distance from the winding spindle which receives the thread.
US09365387B2
A tensioning system for articles of footwear and articles of apparel is disclosed. The tensioning system includes a tensioning member that is tightened or loosened using a motorized tensioning device for winding and unwinding the tensioning member on a spool. The tensioning system may be used with various sensors to determine how the motorized tensioning device should be controlled.
US09365382B2
An installation for the detection of projecting material defects in a paper web or corrugated cardboard web moved in a feed direction. The device comprises a sensor device comprising a first sensor unit with a first emitter for emitting first sensor beams and a second emitter for emitting second sensor beams and with a second receiver, wherein the first sensor beams run parallel to the material surface to be monitored of the paper web or corrugated cardboard web and travel along a first signal path S1 in-between. The sensor device further has a second sensor unit comprising a second emitter for emitting second sensor beams and a second receiver, wherein the second sensor beams run parallel to the material surface and travel along a second signal path S2 in-between. The first and second sensor units are oriented in such a way that the distance between the first and second sensor beams relative to the feed direction changes along their signal paths S1, S2.
US09365378B2
A winder for winding continuous webs or interleaved web segments having a machine direction and a cross-machine direction coplanar and orthogonal thereto into rolls is disclosed. The winder provides a plurality of winding spindles orbiting about a winding turret axis and a plurality of surface contact rolls cooperatively associated with a respective winding spindle. Each surface contact roll is capable of cooperative engagement with the respective winding spindle when the web material is disposed therebetween. The longitudinal axis of each surface contact roll is adjustable relative to the axis generally parallel to the winding turret axis when the web material is received by the winding spindle cooperatively associated thereto.
US09365375B2
An image forming apparatus reflecting one aspect of the present invention includes a deviation detecting portion, a registration roller, and a leading end detecting portion. The deviation detecting portion detects a deviation amount of the sheet being fed from a reference position in a sheet width direction orthogonal to a feeding direction. The registration roller modifies deviation by swinging the sheet being fed in the sheet width direction in accordance with the deviation amount detected by the deviation detecting portion. The leading end detecting portion is disposed on the downstream side in the sheet feeding direction of the registration roller and detects a leading end of the sheet being fed. The leading end detecting portion detects the leading end of the sheet after deviation is modified by the registration roller.
US09365363B2
A structure for suppressing a baggage jam, includes: a jam suppressing unit which is provided at a gap between a first conveyor and a second conveyor to suppress baggage transferred from the first conveyor to the second conveyor from being jammed in the gap, and the jam suppressing unit may be provided to be protruded to a position higher than a jam threshold point having the narrowest space in the gap and to a position lower than a transport surface on which the baggage is transported by the first and second conveyors.
US09365361B1
A transverse belt drive assembly has multiple belt drive frames spaced in a first direction and positioned between the rollers of a main conveyor which advances articles in the first direction. The belt drive frames support looped toothed belts which are advanced in a second direction perpendicular to the first direction. The belt drive frames are mounted to a platform which is driven on demand by an actuator to raise the belt drive frames to extend up above the roller surfaces of the main conveyor rollers causing the belts to engage articles carried on the conveyor rollers, lifting and advancing the articles in the first direction to transfer them off the conveyor rollers. Each belt has a body with converging walls and is received within a channel within a converging side wall track mounted to a belt drive frame. Rotatable bearings are mounted beneath each channel to support the belt.
US09365359B2
A component feeder including a lift for elevating a selection of components from a bulk storage, and a pick surface adjacent to the lift for receiving the selection of components. A spreader gives the selection of components a push for spreading the selection of components from the lift on the pick surface. The combination of a vertical lift and a separate pick surface adjacent to the lift enables the bulk storage being positioned right below the pick surface. The area of the pick surface is large in relation to the total footprint of the component feeder.
US09365357B2
A postal sorting machine comprises a conveyor system having a conveyor adapted to move mailpieces along a certain conveyor path along sorting outlets of the sorting machine. The sorting machine includes at least one pass sensor to detect the mailpieces in motion on the conveyor going past at a certain point of the conveyor path and to respond to a detection of the mailpiece by delivering a pass detection signal to a monitoring and control unit which responds to the detection signal by delivering a control signal for an electromechanical actuator of the conveyor. The pass sensor is a virtual sensor. A movement tracking system generates digital images of the mailpieces. An emulator generates 3D-modeled mailpieces and detects interactions between the 3D-modeled mailpieces a 3D model of the conveyor to generate the pass detection signal.
US09365354B2
A linear conveyor is provided with a linear motor stator including electromagnets and operable to individually undergo electric current supply control with respect to each zone; a conveyor carriage provided with a linear motor rotor and a unique information storing device; motor control devices configured to perform electric current supply control for the electromagnets with respect to each zone; and a reading device configured to read position correction data of the conveyor carriage stored in the unique information storing device. Each of the motor control devices is configured to correct a target stop position of the conveyor carriage, with use of the position correction data read by the reading device for performing electric current supply control based on the corrected target stop position.
US09365351B2
The conveying device (1) according to the invention has a conveying channel (4). The conveying channel (4) is formed in particular as a conveying pipe (5). At least one carrier (2) is arranged in the conveying channel (4). In particular, at least two carriers (2) are arranged in the conveying channel (4). The conveying device (1) has at least one drive (6) for driving the at least one carrier (2) in order to convey bulk goods along a conveying channel axis. The at least one carrier (2) is loosely arranged in the conveying channel (4) at least in some sections along the conveying channel axis.
US09365344B2
To fix a valve piece encompassing a connecting shell and a valve to a can jacket, an embodiment of a method includes a welding step in which the connecting shell of the valve piece is fastened to the can jacket as a top closing element along with the valve by laser welding. According to an embodiment, a shoulder-shaped constricted cross section is embodied on the can jacket towards the top face thereof while the border area of the closing element which rests against the shoulder is tightly pressed theragainst and is sealingly joined to a laser seam, the top face of the can jacket lying inside the can. The method dispenses with the need to configure or fix a valve seat while eliminating the technically complex crimping step, thus also dispensing with the need for an installation used for crimping connecting shells in the filling station. The method makes it possible to produce also aerosol cans whose diameter is smaller than the diameter of a standard valve seat.
US09365342B2
The invention relates a metering device for fluids from a containment volume. The metering device is a means to dispense metered volumes of fluids such as detergents, medicaments, lotions and the like. The invention further provides a container for fluid material to be dispensed in metered doses.
US09365341B2
A fluid dispenser device having at least one reservoir containing fluid to be dispensed and dispenser mechanism that is actuatable by a user so as to dispense the fluid through a dispenser orifice. The dispenser device having a plurality of assembled-together component parts, at least one of the component parts including a unique marking so that each individual dispenser device is identifiable and/or traceable by the unique marking.
US09365333B2
Novel lockable safe containers for dispensing valuable, dangerous and potentially dangerous goods via a main opening that is easy for adults to open and difficult for children to open, using a finger pressure on a sliding closure with a deflectable extension operable by finger pressure to enable. The novel safe containers have many additional advantages including human factors, ergonomics, manufacturing, supply chain and distribution, warehousing, retail, tamper resistance advantages, and labeling. The slidable closure exits the main opening zone via an auxiliary opening but wholly without exiting the container in normal usage.
US09365325B2
Child proof containers are provided. In some embodiments, the child proof container comprise: a removal tool having a first end; a pouch with a first edge and a second edge that together form an opening to the pouch; a first handle portion that is attached to the first edge and that includes an opening sized to receive the first end of the removal tool; a second handle portion that is attached to the second edge, that is configured to fit into a cavity in the first handle portion, that interlocks with the first handle portion when in the cavity, and that can be pushed out of the first handle portion using the first end of the removal tool.
US09365321B2
A versatile storage bin structure includes a storage bin body. A receiving space, an upper opening coverable with an upper lid, and a lateral opening coverable with a right lateral lid are disposed at the storage bin body. A long groove is disposed beneath the lateral opening and communicates with a bottom space of the storage bin body. The bottom space has therein two rail grooves. Two tenons are disposed at two ends of the bottom edge of the right lateral lid, respectively, and inserted into the space defined by the rail grooves and the long groove. The right lateral lid can be pushed into the long groove for concealment. The first and second fasteners are disposed at the right lateral lid and the left lateral face, respectively, to fasten the upper lid. A frame-like rib is disposed on the upper lid to stack and elevate the storage bins.
US09365315B2
In one implementation, a device for dispensing items includes a plurality of compartments for storing medicines or medical supplies, a respective light source associated with each of the plurality of compartments, and a computerized controller coupled to the light sources. The computerized controller maintains an inventory of the contents of the plurality of compartments and receives requests to dispense medicines or medical supplies from the plurality of compartments. In response to a request to dispense a particular medicine or medical supply item, the computerized controller illuminates the light source associated with the compartment holding the particular medicine or medical supply item, the light source being illuminated with a brightness controlled by the computerized controller. The brightness of the light source may be controlled in accordance with a detected brightness of the ambient environment. The light source may be a multi-colored light source.
US09365307B2
A device for packaging products in a box, includes a frame having a moving conveyor, a guide for supporting the products from an entry end to an exit end of the guide, and a mechanism for holding a box at the exit end of the guide such that the opening of the box extends parallel to the guide at the other side thereof. The conveyor has support members extending perpendicular to the conveyor and towards the guide when they move along the guide. The device further includes a feeder for feeding the products at the entry end of the guide between two support members, wherein the products are stacked in parallel for moving the stack of products at the exit end past the edge of the exit end into-said the box, and a mechanism for transporting the box in a direction parallel to the guide.
US09365304B2
A container arrangement includes a plurality of flexible disposable bags (20a, b, c) which each have an inlet element to which a flexible connecting tube (18a, b, c) is attached, wherein each connecting tube (18a, b, c) branches off from a flexible common main line (12, 14, 16) which has a common inlet section (12) on the intake end. The main line (12, 14, 16) has a common gas outlet section (14) at the discharge end. A non-return valve (146) which closes against the gas outlet direction and a gas-permeable, liquid-tight sterile filter (144) are arranged in the common gas outlet section.
US09365301B2
A method of command of magneto-torquers of an attitude control system of a space vehicle subjected to an external magnetic field of variable direction. The magneto-torquers are configured to desaturate an angular momentum storage device by transferring angular momentum and configured to form, in cooperation with the local external magnetic field, magnetic couples in a plane orthogonal to the direction of the local external magnetic field or a local control plane. The magnetic couple to be formed in the local control plane is determined as a function of the component of a desired attitude control couple which is orthogonal to the local control plane or a locally uncontrollable component. The contribution of the locally uncontrollable component to the magnetic couple to be formed is non-zero when the locally uncontrollable component is non-zero.
US09365300B2
An orbit attitude control device includes a plurality of nozzles for injecting combustion gas supplied from a combustion chamber, and a control section configured to calculate nozzle opening degree correction values so that a deviation between a detection value of the pressure of the combustion chamber and a command value becomes smaller. The control section is configured to calculate a total correction value so that the deviation between the detection value and the command values becomes smaller. A total value T1 for first group nozzles and a total value T2 for second group nozzles are calculated. The total correction value is distributed to the opening degree correction values for the first group nozzles with a ratio of T2/(T1+T2) and to the opening degree correction values for the second group nozzles with a ratio of T1/(T1+T2).
US09365298B2
The present disclosure provides an airplane ground deicing installation that minimizes the impact of deicing operations on the airport during icing conditions. The installation does not require alteration of a normal taxi pattern and can be performed as quickly as the average separation time between take-offs. The installation allows modification of its shape to adapt to the contour of almost all types of commercial passengers airplanes operating from major airports, and simultaneously deices large surfaces of the airplane. Deicing and anti-icing fluids are applied to airplane surfaces from nozzles positioned in close proximity to the airplane's surface. Speed and adaptability to different types of airplanes, combined with a design that allows rapid relocation of the installation, are key features that make it possible to place the installation on the taxiway, close to the head of the runway it serves, such that the taxi pattern and the separation in between takeoffs are not altered as compared to the normal operations of the airport.
US09365297B2
A hose management system with a longitudinally collapsible duct-like air hose may supply conditioned air for heating and/or cooling an aircraft. The system has a temperature controlled container and a motorized remotely controlled drive with treads for feeding out hose to a length appropriate to hook up to a stationary aircraft. The motorized drive also retracts the hose back into the container. The hose may have scuff strips, hook and loop fasteners, and reflective strips.
US09365284B2
A variable camber Krueger flap deployment linkage mechanism is presented. A first linkage assembly couples a flap assembly and an airfoil, and comprising a first drive arm, a first drive link, and a support arm. A second linkage assembly couples the flap assembly and the first drive arm, and comprises a drive transfer arm, a middle connection segment, and a bullnose link.
US09365279B2
The present invention relates to a fuselage of an aircraft or spacecraft, with at least one shell element and a structural element. An interspace to which air can be admitted by an air stream is provided between the at least one shell element and the structural element. The fuselage is distinguished by the fact that, to form the air-admitting air stream as an outgoing/incoming air stream of a pressurized interior space of the fuselage, the interspace is connected to a corresponding outgoing/incoming air connection of the interior space. The invention also relates to a corresponding aircraft or spacecraft and to a method of actively insulating such a fuselage.
US09365278B2
An apparatus comprising an outer sleeve and an inner sleeve. The outer sleeve has a first channel with an inner wall with a first number of substantially planar surfaces. The inner sleeve has a second channel and an outer wall with a second number of substantially planar surfaces. The outer wall is configured to be received within the first channel. At least one of the second number of substantially planar surfaces on the outer wall of the inner sleeve is configured to slide against at least one of the first number of substantially planar surfaces.
US09365274B1
An outboard marine propulsion device comprises an internal combustion engine having a cylinder head and a cylinder block and an exhaust manifold that discharges exhaust gases from the engine towards a vertically elongated exhaust tube. The exhaust manifold has a plurality of inlet runners that receive the exhaust gases from the engine, and a vertically extending collecting passage that conveys the exhaust gases from the plurality of inlet runners upwardly to a bend that redirects the exhaust gases downwardly towards the exhaust tube. A cooling water jacket is on the exhaust manifold and conveys cooling water alongside the exhaust manifold. A catalyst housing is coupled to the exhaust manifold and a cooling water jacket is on the catalyst housing and carries cooling water alongside the catalyst housing. A catalyst is disposed in the catalyst housing.
US09365272B1
This invention pertains to an aquatic stand up board where the rider is standing on the board and provides propulsion by means of a manual hand crank. The hand crank operates two sprockets and a chain causing a double paddle wheel beneath the board to rotate thereby providing thrust. Forward or backward motion depends on whether the manual crank is rotated clockwise or counterclockwise. Steering is achieved by turning the crank in a horizontal plane, similar to a bicycle handlebar, which rotates the paddle wheels in the desired direction.
US09365267B2
A floating platform is provided including the following: a covering element; at least three buoyant bodies, which are separated from each other, are fixedly mounted to the lower face of the covering element, are open toward the bottom, and are made of a gas-tight, pressure- and corrosion-resistant flexible material. The buoyant bodies enclose a closed hollow space when coming into contact with a liquid surface. At least one compressed-air generating device is also provided for generating an overpressure in the individual hollow spaces.
US09365265B2
A hybrid winch system for use with an anchor handling vessel comprises an electric winch mountable on the anchor handling vessel, an electric generator for providing generated power to the electric winch, a battery for providing stored power to the electric winch, an anchor cable wound around the electric winch and passing over a roller drum for guiding the anchor cable, an anchor attached to a distal end of the anchor cable and a winch controller for selectively applying the generated power and the stored power to the electric winch. The winch controller is configured to provide the stored power to the electric winch for controlled release of the anchor cable in case of loss of the generated power.
US09365245B2
A bracket for protecting a flange of a body of a vehicle includes a first portion, a second portion, and a channel defined between the first and second portions. The channel receives the flange. The bracket includes a back side and adhesive disposed on the back side. A front side of the bracket is disposed opposite the back side. A transition surface on the front side slopes inwardly from the first portion to the second portion for deflecting a wheel away from the flange during an offset impact.
US09365242B1
A pillar assembly for a vehicle includes an outer panel, a reinforcement and an inner panel. The outer panel extends from a roof to a rocker. The reinforcement is attached to the outer panel and extends from the roof to a lower end that is spaced from the rocker. The reinforcement defines an opening in one side extending upwardly from the lower end of the reinforcement to a hip seating reference point level. The inner panel encloses the lower end of the reinforcement in conjunction with the outer panel. The pillar reinforces the assembly to facilitate inwardly collapsing a lower portion of the pillar to a greater extent than an upper portion of the pillar in a side impact collision.
US09365240B2
A device for absorbing frontal collision impact for a vehicle includes side members extending in the length direction of the vehicle and impact-absorbing structures mounted on the side members and protruding outward in the width direction of the vehicle. The device can effectively cope with a frontal small offset collision of a vehicle.
US09365239B2
A tracked vehicle (5) with a drive engine (1) for providing mechanical drive power, with a gearshift transmission (2) coupled to the drive engine (1) and with at least one steering gear system (6) coupled to the final drives (12, 12A) of each track (10, 10A). At least one pump (3) supplies hydraulic power to at least one hydraulic motor (4, 4A) of the steering gear system (6). The drive engine (1), the gearshift transmission (2) and the pump (3) are arranged as a drive unit (16) separately from the steering gear system (6).
US09365237B2
A steering control device set a steering reaction force characteristic to coordinates so that the self-aligning torque increases as the steering reaction force increases. Upon applying a steering reaction force corresponding to the self-aligning torque to a steering unit based on the steering reaction force characteristic to offset the steering reaction force characteristic at coordinates more in a direction in which an absolute value of the steering reaction force increases as a lateral position of a host vehicle approaches to a white line, the offset of the steering reaction force characteristic is suppressed when a turn signal operation is started while suppression of the offset of the steering reaction force characteristic is released when the turn signal operation is ended so that an absolute value of an increase gradient when releasing suppression of the offset becomes smaller than an absolute value of a decrease gradient when suppressing the offset.
US09365236B2
Systems and methods for controlling the speed and direction of vehicles such as tractors.
US09365234B2
A telescopic steering apparatus includes a steering column having an outer column and an inner column. An inner peripheral surface of the outer column has a supporting portion that supports the inner column. An inner peripheral surface of the outer column further has a shock absorbing portion at a location shifted toward one side in an axial direction from an axial end face of the inner column, a diameter of an inscribed circle of the shock absorbing portion being smaller than an outer diameter of the inner column. The outer column, including the supporting portion and the shock absorbing portion, and a movable bracket are integrally formed by an expansion forming.
US09365226B1
Aspects of a transport dolly for repositioning a drive unit are described. In one embodiment, the transport dolly includes a base frame, an elevated handgrip bar, and a wheel lock assembly that locks at least one jack wheel of the drive unit into an engaged position for manual displacement of the drive unit using the elevated handgrip bar. The transport dolly may be relied upon to assist an individual with manual movement of the drive unit, by engaging and locking one or more jack wheels of the drive unit into a position which lifts the drive unit off the drive wheels of the drive unit. Once the jack wheels are engaged and locked in position, the drive unit may be more easily repositioned manually.
US09365221B2
A strut for a brake beam assembly includes a strut body extending along a longitudinal axis between a proximal end and a distal end. At least one slot is defined in the strut body and receives and supports a brake lever extending non-parallel to the longitudinal axis. A compression member engager is connected to a distal end of the strut body and is configured to connect the strut body to a compression member of the brake beam assembly. A tension member engager is connected to the proximal end of the strut body and is configured to engage a tension member of the brake beam assembly. At least one fastener is configured to engage the compression member engager to fasten the compression member engager on the compression member. At least a portion of the strut body is rotatable about the longitudinal axis with respect to the compression member engager and the tension member engager to be oriented at opposing angles with respect to a horizontal plane extending through the longitudinal axis.
US09365218B2
A vehicle system includes a user interface device and an autonomous mode controller. The user interface device receives a user input representing a driving mode selection. The autonomous mode controller commands one or more vehicle subsystems to operate in accordance with characteristics associated with the driving mode selection. Examples of characteristics can include how aggressively the vehicle accelerates or decelerates, a minimum distance from the vehicle to a front vehicle, or how frequently the vehicle changes lanes, among others.
US09365214B2
Systems and methods use cameras to provide autonomous navigation features. In one implementation, a traffic light detection system is provided for a vehicle. One or more processing devices associated with the system receive at least one image of an area forward of the vehicle via a data interface, with the area including at least one traffic lamp fixture having at least one traffic light. The processing device(s) determine, based on at least one indicator of vehicle position, whether the vehicle is in a turn lane. Also, the processing device(s) process the received image(s) to determine the status of the traffic light, including whether the traffic light includes an arrow. Further, the system may cause a system response based on the determination of the status of the traffic light, whether the traffic light includes an arrow, and whether the vehicle is in a turn lane.
US09365210B2
In a method and an arrangement for powering up a DC distribution system in a hybrid vehicle power train, the power train includes an electric storage system, an internal combustion engine, an electric motor/generator, a clutch device to connect the electric motor/generator to the internal combustion engine, a power electronics unit with a voltage regulator connected to the electric motor/generator, and an electronic control unit for controlling the power train. The electric storage system and the electric motor/generator are connectable to one or more electrical loads for driving the vehicle. The powering up includes initializing internal combustion engine ignition, initializing a diagnostics test of power train components, cranking the internal combustion engine, requesting pre-charge of the electrical loads from the power electronics unit, connecting the electric storage system to the electrical loads when the pre-charge and the diagnostics test are completed, and resuming normal operation for the power electronics unit.
US09365194B2
A drum brake is provided that improves the direction of the actuating forces to reduce stress, improve efficiency and permit thicker brake linings. First and second brake shoes each have a first end pivotally coupled to the same or different anchor pins on a brake spider. First and second cam followers are disposed at corresponding second ends of the brake shoes. A cam engages the cam followers with movement of the cam causing the brake shoes to move between positions of engagement and disengagement with a braking surface. The cam followers are offset such that distances between the centers of the first cam followers and the anchor pin or pins supporting the brake shoes differ so as to improve the direction of the cam force vector.
US09365193B2
A fixed caliper brake for a motor vehicle, including a housing with two housing limbs and a housing bridge connecting the housing limbs in a flexurally rigid manner at a defined distance from one another, pistons, which are received in bores in the housing limbs and are guided displaceably along an axis A in relation to the brake disk, and brake pads which are provided in pairs, are guided in an axially displaceable manner in the housing and arranged in the circumferential direction while being supported against circumferential forces, each brake pad being actuable directly by at least one piston. The brake pads are supported in a form-fitting manner on the housing bridge at least on the run-in side. At least each arm on the run-in side is configured with a hook shape open on the radially outer side and serves at least partially for form-fitting abutment against the housing.
US09365190B2
The present invention discloses a connecting device of a windshield wiper. The connecting device includes a connector main body. Through the connector main body to cooperate with other parts, a buckle cap, a resilient engaging member, a reverse U-like limit block, or a functional outer cap, the connecting device of the present invention can be applied to connect with nine windshield wiper arms when in use, so it can be used widely.
US09365189B2
A windscreen wiper device comprising an elastic, elongated carrier element, as well as an elongated wiper blade of a flexible material, which can be placed in abutment with a windscreen to be wiped, which wiper blade includes opposing longitudinal grooves on its longitudinal sides, in which grooves spaced-apart longitudinal strips of the carrier element are disposed, wherein neighboring ends of said longitudinal strips are interconnected by a respective connecting piece, which windscreen wiper device comprises a connecting device for an oscillating arm, wherein the oscillating arm is pivotally connected to the connecting device about a pivot axis near one end, with the special feature that the connecting device comprises at least two parts provided with protrusion/hole features for detachably connecting the parts together, wherein the first part is retained onto the wiper blade and wherein the second part has an at least substantially U-shaped cross-section at the location of its connection to said first part, wherein each leg of said U-shaped cross-section is allowed to bend outwardly upon insertion of the oscillating arm into said second part for connecting said first and second parts together through a snapping operation.
US09365188B1
Methods and systems are provided. One method includes receiving a request to generate electronic key (e-key) for an identified recipient to use a vehicle. The request includes identifying information for enabling sending of the e-key to the recipient via an electronic transmission. The request includes a condition of use of the vehicle. The method includes generating the e-key. The e-key is associated with the condition of use of the vehicle. The method includes transmitting the e-key to a device or user account of the recipient. The method further includes transmitting data to the vehicle to enable use of the vehicle via the e-key and receiving use data regarding use of the vehicle for when the vehicle is used via the e-key. The use data identifies information regarding the use of the vehicle. The information identifies a violations of the condition of use. The receiving and the transmitting is processed by at least one server having logic for generating e-keys and receiving data regarding use of the vehicle when the e-key is used for the vehicle. The server is accessible over the Internet, and the vehicle has wireless communication systems for communicating with the server and for communicating with devices local to the vehicle.
US09365187B2
Methods, systems, computer-readable media, and apparatuses for expanding the functionality of a security system are disclosed. The security system may be integrated with a vehicle security system. For example, a vehicle security node of a vehicle may transmit a signal that may be received by the security system. The security system may authenticate the vehicle security node and integrate the vehicle security node into its network. Various information may be communicated in both directions between the security system and the vehicle security node. The vehicle security node may communicate with an alarm panel that may include a dock for connecting a portable device.
US09365186B2
Computing devices, methods, and systems for locking vehicle operations when an occupant is not wearing a correctly positioned seatbelt are disclosed. One example method for locking vehicle operations includes identifying an occupant position and a seatbelt position based on information relating to an occupant of the vehicle and a seatbelt associated with the occupant; determining whether the occupant is correctly wearing the seatbelt based at least in part on the occupant position, the seatbelt position, and a reference model; and locking one or more vehicle operations if the occupant is not correctly wearing the seatbelt. Example implementations include using depth-sensing cameras, rendering a three-dimensional model representing the occupant position and the seatbelt position, and comparing the three-dimensional model and the reference model. Examples of vehicle operations that may be locked include ignition operations, gear shift operations, and autonomous driving operations.
US09365177B2
A method for series production of a vehicle assembly, especially an interior assembly, including a vehicle-side support, especially a vehicle steering wheel (12), and a component to be fastened at the support, especially a horn module (14), wherein a module-side bearing unit (22) consisting of at least two bearing members (46, 50) is assigned to the component and/or a support-side bearing unit (24) consisting of at least two bearing members (26, 28) is assigned to the support, and wherein one of the bearing members (28, 50) of the respective bearing unit (22, 24) has a contact surface (34, 58) and the other one of the bearing members (26, 46) has at least one bearing surface (38, 54) includes the step of individually orientating the two bearing members (26, 28, 46, 50) of at least one bearing unit (22, 24) relative to each other as a function of the actual dimensions of the support installed and/or the component installed, fastening the two bearing members (26, 28, 46, 50) orientated relative to each other, and fastening the component to the support. The position of the support and the component relative to each other is defined by at least one bearing unit (22, 24).
US09365173B2
A device (1) for stabilizing a supply voltage (UBatt) in a motor vehicle, having a function component of the motor vehicle, in particular in the form of a starter (4), a voltage source (10) which is connected to the function component (4) in order to supply the function component (4) with the supply voltage (UBatt), characterized in that the voltage source (10) is connected to the function component (4) via a resistor cascade (30) in order to stabilize the supply voltage (UBatt).
US09365166B2
An automotive vehicle including a pillar assembly. The pillar assembly comprises a structural reinforcement member and an associated garnish. The garnish is constructed of an elongated polypropylene inner layer mated to a cooperatively shaped fiber filled outer layer.
US09365156B2
A lighting apparatus, in particular a reading lamp, is provided. The apparatus can be recessed in a trim of a passenger cab of a vehicle, which can be a land vehicle, an aircraft, or a watercraft. The apparatus has a first light-emitting device that is pivotably mounted to a recess-mounting frame, so that a light-emitting direction of the first light-emitting device with respect to the recess-mounting frame is changeable. To simplify the design of the apparatus, a second light-emitting device is mounted to a visible side of the recess-mounting frame. The second light-emitting device at least partially surrounds the first light-emitting device and is fitted to the recess-mounting frame, so that the light-emitting direction of the second light-emitting device is invariable.
US09365155B2
This invention relates in general to the field of safety devices, and more particularly, but not by way of limitation, to systems and methods for providing advanced warning and risk evasion when hazardous conditions exist. In one embodiment, a vicinity monitoring unit is provided for monitoring, for example, oncoming traffic near a construction zone. In some embodiments, the vicinity monitoring unit may be mounted onto a construction vehicle to monitor nearby traffic and send a warning signal if hazardous conditions exist. In some embodiments, personnel tracking units may be worn by construction workers and the personnel tracking units may be in communication with the vicinity monitoring unit. In some embodiments, a base station is provided for monitoring activities taking place in or near a construction site including monitoring the locations of various personnel and vehicles within the construction site.
US09365150B2
A loading rail has a cross-sectional profile which is uniform over at least part of the length of said loading rail, has, on an upper side, a longitudinal groove for receiving at least one sliding block, the longitudinal groove being constricted in an upper region by at least one web, which is attached to a side wall of the longitudinal groove, to form a longitudinal slot, and the web bearing at least one downwardly projecting projection, wherein the projection forms an undercut on a side facing away from the longitudinal slot, as seen from below. The disclosure also relates to a sliding block for a loading rail.
US09365147B2
A trailer comprising: a trailer body defining an interior chamber and having left and right side walls; a rear gate mounted adjacent a rear end of the trailer body; an inner gate which divides the interior chamber into a forward and rearward compartments; a perforated panel which has a plurality of holes formed therein, which is mounted along one of the left and right side walls adjacent a lower end of the one of the left and right side walls and which is adapted to allow fluids to drain through the holes; a doorway which is formed in the inner gate, which communicates with the forward and rearward compartments and which is adapted to allow a person to walk through the doorway; and a rigid door which is mounted on the inner gate and which is movable between open and closed positions for opening and closing the doorway.
US09365146B1
The Hot or Cold Cup Holder for Vehicles is a beverage holder that is capable of warming or cooling a beverage to a temperature suitable for consumption. It provides a space to store the beverage, an apparatus capable of heating or cooling the stored beverage, switching capable of changing the cup holder mode from heating to cooling and vice versa, and the power system necessary to support these functions.
US09365144B2
A foot-rest for a motor vehicle including a support surface facing at least part of which a sound insulation mat can be extended, mounted on the floor of the motor vehicle, including an insulating layer interposed between the floor and a coating layer mounted on the insulating layer, the foot-rest further including a storage compartment. The support surface includes an inner face configured to be positioned facing an outer face of the coating layer, the inner face being including links configured to support the storage compartment such that an inner volume of the storage compartment extends between the inner face of the support surface and the outer face of the coating layer.
US09365143B2
A vehicle seating assembly includes a composite support structure formed by a lower pressure compression mold and defines at least one open section. A subassembly is disposed over the composite support structure and includes a trim piece integrally formed on the subassembly and defines a center seat and at least one cushion attachment support is disposed adjacent to the at least one open section. A seat cushion insert is operably coupled to the at least one cushion attachment support and is disposed over the at least one open section and defines a side seat.
US09365137B2
An apparatus for locking a folded state of a seat for a vehicle may include first links each of which rotates depending on whether the seat is fastened to a vehicle body, a second link that rotates depending on the rotation of the first links, and a locking link which has a plurality of fastening portions and is rotatable in accord with rotation of the seat. The second link is selectively fastened to different fastening portions of the locking link depending on the rotation of the second link.
US09365130B2
A technique for supercharging a fuel cell is provided. In particular, a speed of an acceleration pedal is calculated and a first output order value of a fuel cell stack or a second output order value of the fuel cell stack which is smaller than the first output order value is set, in accordance with the value of the calculated speed. An amount of air flow corresponding to the set first output order value or the second output order value to be supplied to the fuel cell stack is then controlled accordingly.
US09365123B2
In electric vehicle supply equipment (EVSE), interruption of charging due to overheating is prevented by adjusting the pulse duty cycle on the control pilot conductor communicating the maximum allowed current level to the electric vehicle, the adjustment being performed whenever the EVSE temperature exceeds a predetermined threshold temperature below the maximum operating temperature as a function of the approach of the temperature to the maximum operating temperature.
US09365118B2
An electronics housing for a high voltage system of a vehicle defines an interior region, and includes a connection header wall having a window. An optical proximity sensor is disposed within the interior region of the electronics housing, adjacent the window. A cover is removably attached to the electronics housing adjacent an exterior surface of the connection header wall. The cover is disposed over the window. The optical proximity sensor is operable to sense the presence of the cover through the window when the cover is attached to the electronics housing.
US09365116B2
The present disclosure relates to an electric vehicle, including: a connector configured to receive a charging plug; and an ejection mechanism positioned with respect to the connecter, configured to eject the plug under predetermined conditions.
US09365115B2
A power management system for a vehicle having wheels and an electric machine operable to provide torque to drive at least one of the wheels includes a first energy storage system capable of supplying power to operate the electric machine. The system also includes a second energy storage system capable of supplying power directly to at least one vehicle load at a lower voltage than the first energy storage system. A voltage conversion device is operable to reduce a voltage of the power supplied by the first energy storage system to the lower voltage to charge the second energy storage system when the vehicle is in a key-off state.
US09365114B2
The present invention provides a high voltage system of an electric vehicle. More particularly, it relates to a high voltage system of an electric system which makes it possible to remove a sub-battery conventionally required in such systems by allowing a high voltage battery to function as the sub-battery. The high voltage system includes a high voltage battery, in which a cell and/or a module of the high voltage battery is connected to low voltage electric equipment through an NC relay, such that power of the cell and/or the module of the high voltage battery is supplied to the low voltage electric equipment at ignition-off.
US09365110B2
While a vehicle speed is between a first certain vehicle speed and a second certain vehicle speed lower than the first certain vehicle speed, it is determined whether to perform vehicle control in accordance with conditions excluding a condition based on the estimated road surface slope.
US09365109B2
A fuel cap configured to be coupled with the opening of a fuel tank defining an interior for containing a volume of fuel. An inlet opening is configured to establish fluid communication with the fuel tank interior. An exit is in communication with a surrounding atmosphere, exterior to the fuel cap. A flow path is defined from the inlet opening to the exit. Adsorption media substantially fills the flow path and is configured to reduce the emission of VOC vapors through the exit to the surrounding atmosphere. The flow path extends spirally about an axis of the fuel cap from the inlet opening to the exit.
US09365101B2
A fluid-filled vibration damping device including a main rubber elastic body composed of a first rubber elastic body and a second rubber elastic body which are overlapped in an axial direction, and a pair of axis-perpendicular liquid chambers formed between the first and second rubber elastic bodies. A pair of dividing walls which divide the axis-perpendicular liquid chambers are constituted by a first division piece protruding from the first rubber elastic body and a second division piece protruding from the second rubber elastic body being overlapped in a circumferential direction. The first rubber elastic body has a thickness, diameter and spring constant all set larger than those of the second rubber elastic body, while having a tapered shape. With the device mounted on a vibration transmission system, a static support load is input so as to compress the first rubber elastic body.
US09365093B2
A vehicle includes a drive motor, a battery, a front seat, a rear seat, a passenger-compartment air conditioning unit, an inlet port, a blower, a temperature sensor and a controller. The controller is configured to control the passenger-compartment air conditioning unit so as to selectively perform a first air conditioning mode, a second air conditioning mode, and a third air conditioning mode. The controller is configured to control the passenger-compartment air conditioning unit so as to perform the third air conditioning mode when the temperature of the battery is higher than a first temperature threshold.
US09365092B2
An assembly for a console of a vehicle including a main body, a first hook connected to the main body wherein the hook is positioned adjacent and spaced apart from a second hook. A duct member having an aperture connects to the first hook and the second hook. During installation of the duct portion the aperture is first angled and positioned over a first hook then rotated downwards over the second hook wherein the second hook includes a ramped portion. The duct portion is snapped into place and is secured tightly over both the first hook and the second hook. During installation and rotation of the duct portion over the first hook and the second hook, the first hook and the second hook resiliently bend towards each other in compression and are relaxed once the aperture is fully over the first hook and the second hook.
US09365086B2
A vehicle module having a height, a width and a length, front and rear vertical panels and a horizontal floor, and wherein said height and width are adjustable and the front and rear vertical panels are foldable to allow enlargement of an empty module to pass over another module. The modules are useful for transport of passengers or goods, particularly in a guided rail system.
US09365077B2
A hub bearing assembly includes a hub of light metallic material forming a cylindrical portion, on which an inner tubular ring having a raceway is mounted; on the first inner tubular ring a second inner ring having a second raceway is fastened; formed between the cylindrical portion of the hub and the inner tubular ring is a cylindrical interstice containing a brazing bonding material or a structural adhesive which integrally binds the hub to the first inner tubular ring.
US09365075B2
A wheel rim cover assembly for use with a vehicle wheel rim is provided. The wheel rim cover assembly comprises a rim cover element, a rotating element, and a controller element. The rotating element comprises at least one blade that is rotatable in speed and moves in a direction independent from the rotation of the vehicle wheel rim to which it is attached.
US09365074B2
The present invention relates to attaching aerodynamic wheel covers to the wheel of a truck or other heavy duty vehicle, and to a method of installation that does not require the removal of the nuts retaining the wheel to the hub of the axle and allows the air pressure of tires on such wheels to be easily adjusted.
US09365063B1
A filtration system, mechanism and method is proved that continuously filters waste fluid from variable data ink-based printing system cleaning subsystems. Waste fluid from a cleaning subsystem is forced through a bank of progressively finer filter media. Initial coarse filters remove large components of the ink and/or skin that would rapidly clog the later finer filters required to remove small components of the ink and/or skin. The filtered fluid is recycled for printing surface cleaning and filtration. To avoid clogging, the filter media are cleaned by reversing the flow of fluid through the filters. This back-flushing operation is accomplished with a relatively small volume of fluid that is routed as concentrated waste fluid to a waste container for disposal. To avoid disruption to the printing process, two or more filter banks are preferably used. While one filter bank is filtering the waste fluid any other bank(s) may be back-flushed.
US09365061B2
An external table height adjustment technique for a printer system is disclosed. An operator can align an image gap between a printer table of the printer system and a printhead carriage via a height adjustment mechanism. The operator can perform the table height adjustment while a belt is installed on the printer table and media is loaded on top of the printer table. A height adjustment assembly is secured onto a supporting frame of the printer table such that an adjustment component exposed beyond an edge of the belt can raise or lower a portion of the printer table where the height adjustment assembly is secured.
US09365056B2
In one aspect of the present disclosure, an apparatus for protecting a paper skew of a printer comprises a printer head unit comprising a support shaft installed on a support frame and a thermal printer head installed on the support frame to print printing paper, a platen roller unit comprising a roller frame and a platen roller, and paper guides formed at both sides of the support shaft.
US09365055B2
The invention relates to a printer (11) for printing on printing media in the form of label and/or receipt rolls (23, 43), comprising a print head (27) and a top cover (17), which can be folded between a closed position and an open position and which provides access to an accommodating chamber (15) for a label or receipt roll in the open position. The printer (11) also comprises a drive roller (29) that can be driven by a drive of the printer for transporting the particular printing medium and a front cover (21), which can be folded between a closed position and an open position and which provides access to an additional accommodating chamber (19) for a receipt roll (29) in the open position, wherein the drive roller is provided on the front cover (21).
US09365049B2
An improved print head for use by a magnetic printer consists of multiple flat metal layers that form a flat metal inductor coil about a hole having a first diameter on a first side of the print head and having a second diameter smaller than the first diameter on a second side of the print head.
US09365048B1
An ultraviolet (UV) radiation resistance enhanced printing process uses a thermally migratable ultraviolet radiation absorber applied to a substrate to form a surface protection layer for sublimation images within the substrate. The process involves powder coating polymeric materials having an affinity to both sublimation colorants and hydrophobic thermally migratable ultraviolet radiation absorbers. A hydrophobic thermally migratable ultraviolet radiation absorber may be applied to a transfer media prior to image transfer. The application of the radiation absorber to the transfer media may be delivered digitally, either by inks comprising both sublimation colorants and the radiation absorber, or by inks comprising the radiation absorber.
US09365047B2
Disclosed is an inkjet printing apparatus including a printing head, an overcoating head discharging an overcoating agent, and a controller operating the printing head and the overcoating head to perform printing to a print medium. The controller operates in a normal discharge mode having a printing rate in the print medium relative to a given area of less than 100% for printing to the print medium, and an inspecting discharge mode having a printing rate in the print medium relative to the given area higher than the printing rate of the normal discharge mode for confirming a discharge state of the overcoating agent. In the inspecting discharge mode, the controller operates the printing head to form an inspecting region on the print medium, and operates the overcoating head to discharge the overcoating agent onto the inspecting region, whereby an overcoating inspecting chart is formed.
US09365044B1
A print cartridge including a cartridge housing having a container body and a lid that encloses the container body. The lid includes a bottom surface and a top surface. One or more air vent openings are formed through the entire thickness of the lid from the top surface to the bottom surface. A hydrophobic coating is disposed on at least one of the top or the bottom surfaces of the lid, with the hydrophobic coating being absent over the one or more air vent openings. The hydrophobic coating is deposited in liquid or gaseous form.
US09365039B2
A liquid jet head includes a base plate, and an actuator portion fixed to the base plate and having an array of alternating ejection channel and a dummy channel. drive electrodes are formed on inner surfaces of the ejection channels and the dummy channels, and extracting electrodes are formed on the base plate on a rear side of the actuator plate and electrically connected to the drive electrodes. an electrode formation region of the base plate on which are formed the extracting electrodes has a surface roughness greater then that of other regions of the base plate.
US09365038B2
A liquid jet head includes a head chip and a circuit board connected to the head chip. The head chip includes common terminals arranged in a reference direction. The circuit board includes shared terminals, an upper common wiring, and a through electrode. The shared terminals are provided on a lower surface of the circuit board on the head chip side and are electrically connected to the common terminals. The upper common wiring extends in the reference direction and is provided on a top surface of the circuit board opposite to the head chip. The through electrode electrically connects each of the shared terminals to the upper common wiring.
US09365032B2
A nozzle ejection amount correcting method includes: a first signal correction for performing first signal correction by calculating correction amounts of the plurality of driving signals from a difference C between a predetermined amount B in a case of ejecting liquid droplets from the selected nozzles to the ejecting regions in the main scanning performed a plurality of times and the predetermined amount A that is set in advance; a second signal correction for performing second signal correction by calculating correction amounts of the plurality of driving signals before the correction corresponding to the main scanning in the later stage from a difference E between a predetermined amount D in a case of ejecting the liquid droplets to the ejecting regions and the predetermined amount A by using the plurality of driving signals, by which the first signal correction is performed, in the main scanning in the former stage.
US09365025B2
A method for forming fine patterns includes (S1) closely contacting a cliche-forming film to a hard mold concavely patterned, thereby making a disposable cliche; (S2) coating an elastic blanket cylinder with ink or resin; (S3) compressing the elastic blanket cylinder to the disposable cliche to remove ink or resin on a surface of the elastic blanket cylinder at a portion contacting with a relatively protruded embossed portion of the disposable cliche; and (S4) transcribing ink or resin remaining on the surface of the elastic blanket cylinder to a substrate. This method allows simple and fast works and greatly reduces costs by adopting a disposable cliche that may be easily installed and removed. Also, this method may be effectively utilized to form a fine pattern of an electronic device or a display device such as color filter and electrode.
US09365022B2
A method of joining a first bulk composite core and a second bulk composite core by applying an adhesive to a surface network of the first bulk composite core; inserting a plurality of mandrels into a plurality of cell members of the first bulk composite core and a plurality of cell members of the second composite core, thereby aligning the cell members of the first bulk composite core to the cell members of the second bulk composite core; pressing the respective surface networks of the first bulk composite core and the second bulk composite core together with the adhesive located therebetween; and curing the adhesive.
US09365017B2
Moldable fire resistant composites and processes for making moldable fire resistant composites are herein disclosed. According to one embodiment, a moldable fire resistant composite includes a first composite layer comprising an intumescent resin and a heat-dissipating component adhered to a second composite layer comprising a halogenated resin and a reinforcing structure.
US09365016B2
Provided are a fluorine-containing (meth)acrylic (co)polymer that scarcely generates gas when subjected to molding process, and is capable of supplying a molded body excellent in external appearance and transparency; a fluorine-containing (meth)acrylic resin film thereof; and a fluororesin laminated resin film having the same properties. The (co)polymer is a fluorine-containing (meth)acrylic (co)polymer obtained by polymerizing a monomer component including 100 to 70% by weight of a fluoroalkyl(meth)acrylate monomer, and 0 to 30% by weight of a different monomer copolymerizable therewith by effect of a radical polymerization initiator having a solubility in water of 0.1% or less by weight at 25 C, and having 8 to 14 carbon atoms.
US09365015B1
The disclosure includes multi-layered panels (10) including exterior layers of glass (12, 44) and interior layers of urethane (20, 36) and at least one layer of polycarbonate (16) between the urethane layers (20, 36) that result in enhanced shatter resistance within panels that weigh between about 4.1 and 4.6 pounds per square foot. An insertion tab (23) of the polycarbonate layer (16) enhances performance of the panel (10). A method of on-site retrofitting and reinforcing of existing passageway (70) frames (72) without removal of the frames (72) from a building provides for low-cost, highly efficient improvement of intrusion resistance of passageways (70) such as doors and windows of schools, hospitals and other public and private buildings.
US09365011B1
A method of manufacturing a roll of bottom gusseted pouches serially connected in a top-to-bottom end orientation is provided. The method comprises unwinding a pouch webbing in a first flow direction, the pouch webbing defining front and back panels of a respective pouch; inserting a gusset webbing between the panels in a second flow direction; attaching the gusset webbing to the panels to form the bottom gusseted end of the pouch; inserting a closure mechanism between the panels in a third flow direction; attaching the closure mechanism to the panels to form the resealable top end of the pouch; sealing the side edges of the panels to complete the pouch; winding the completed pouch onto the roll; and repeating these steps to form the other bottom gusseted pouches in the roll. At least one of the pouch webbing and the gusset webbing is formed of a supported film.
US09364994B2
The method for welding profiled elements made of a plastic material, in particular PVC, comprises the steps of: preparing two profiled elements (3) made of a plastic material, arranged with respective zones to be welded (4) facing one another; heating the zones to be welded (4); before the heating step, the step of making a groove (19) in correspondence to a peripheral edge of each of the zones to be welded (4); coupling the zones to be welded (4) to one another, by pressing the profiled elements (3) against one another to keep the zones to be welded (4) in reciprocal contact, the step of coupling the zones to be welded (4) defining a sub-step of melting the zones to be welded (4) into one another to define a welding bead and comprising the sub-steps of: arranging pressing means (27, 28) in correspondence to the grooves (19) to define, in collaboration with the grooves (19), a containing compartment (19a) of the welding bead, the pressing means (27, 28) comprising: a first work surface (62) having a protruding portion (63); and a second work surface (64) of final finishing; and displacing the pressing means (27, 28) alternately between: an idle position moved away from the profiled elements (3); a first work position wherein the first work surface (62) is abutted on the grooves (19) with the protruding portion (63) located inside the containing compartment (19a) to deviate the welding bead towards the side walls (61) of the containing compartment (19a); and a second work position wherein the second work surface (64) is abutted on the grooves (19) so as to obtain a finished welding bead.
US09364992B2
A thermoforming device using a hot plate heating includes a frame; a hot plate; a decompression unit connected to the frame; a decompression unit which is connected to a hot plate; a unit which is connected to the hot plate and opens a heating surface side to an atmosphere or pressures the heating surface side; an adsorption and heating control unit which performs the adsorption and heating operation of the sheet by the hot plate; a decompression control unit which performs a decompression operation in the concave portion; and a molding operation control unit which concurrently performs the adsorption and heating operation and the decompression operation, stops the adsorption and heating operation of the sheet after a predetermined time from the start of the operation, and opens a portion between the hot plate and the sheet to the atmosphere or pressures the portion.
US09364990B2
A system for forming a container from a preform includes a first mold operable to receive the preform and operable to blow mold a first form of the container from the preform. The system also includes a second mold operable to receive the first form and operable to blow mold a second form of the container from the first form. The preform, the first form, and the second form each include a substantially common transitional wall. Also, the first form can include various features that ensure that material will be distributed as desired throughout the container, to ensure high wall strength, and to ensure high crystallinity.
US09364989B2
The sealant injector for molding a display frame is provided for extruding the sealant out of the cavity, the large impurity particles could be insulated from the filtrating holes for preventing the mixing particles or the air bubble forcing out from the spray nozzle. The extrusion sealant could be more uniform. The sealant could be coated on the base board with the filtering and forcing. Accordingly, it would increase the continuation, the stability, the strength and the tenacity of the sealant and then improve the rate of good products. On the process of filtering and extruding together, it could reduce the molding time and improve the manufacture efficiency. The present invention also provides a method for injection molding a display frame using the sealant injector.
US09364977B2
A variable-position mold system with a plurality of injection systems operable to deliver molten material at a substantially constant pressure of between about 6.89 megapascals (1,000 psi) and about 103.42 megapascals (15,000 psi) to a set of mold cavities of at least one multi-cavity injection mold insert when in fluid communication therewith. The multi-cavity injection mold inserts have a thermal conductivity of greater than 30 BTU/HR FT ° F., and have little or no cooling channels therein.
US09364975B2
A method of molding composite plastic sheet material to form a compression molded, deep-drawn article is provided. The method includes placing a heated blank of moldable, composite plastic sheet material over a female die having an article-defining cavity defined by inner surfaces of the die so that the heated blank has a predetermined position and orientation over the cavity. Then an inner portion of the heated blank is forced into the cavity along a substantially vertical axis and against the inner surfaces of the die to obtain deep-drawn material. Outer peripheral portions of the heated blank adjacent the cavity are controllably held with corresponding predetermined holding forces based on the size and shape of the article to resist movement of the outer peripheral portions towards the cavity during the step of forcing wherein the deep-drawn material controllably stretches during the step of forcing without wrinkling, tearing or ripping.
US09364974B2
A method of preparing an article includes compressing a polymeric material to form a body and hot isostatic pressing (HIP) the body in an inert atmosphere at a pressure of at least 3 ksi without an encapsulant. The body may optionally be sintered prior to hot isostatic pressing (HIP). The body may have a porosity of not greater than 8% prior to hot isostatic pressing (HIP). The polymer material may be a non-melt processible polymer.
US09364973B2
A multi-component composite block includes a pair of opposed and parallel masonry face panels amalgamated with transverse non-masonry truss-webs or a truss-module including a plurality of joined non-masonry truss-webs. Truss-webs and/or truss-module are delivered within the mold assembly and aligned, retained, and held fast in place by mold apparatuses. Portions of truss-web and/or truss-module unite together with mold apparatuses to shape partitioned residual cavity spaces for the addition of concrete block forming material to form face panels. The truss-web members and/or truss-module have configured elements that integrate with the concrete mass of the face shells providing a permanent amalgamated bond. The assembled multi-component composite block is rigidly stable, durable, structural, lightweight, and thermally efficient.
US09364971B2
A sealing apparatus of a foam injection mold that includes an upper mold that is disposed on an upper side as a movable mold to inject a core and a vacuum forming mold to form a skin. The upper mold and the vacuum forming mold are operated integrally and a lower mold is used during injection-molding and foaming of the core. A resilient sealing unit is integrally formed with the core when the core is injection-molded between the upper mold and the lower mold, to attach the core and the skin while the lower mold in which the core is formed and the vacuum forming mold in which the skin is formed are combined using a resilient restoring force. The resilient sealing unit seals a foaming space between the core and the skin.
US09364970B2
A table cutting machine includes a table for carrying an object to be cut; a cutting device, associated with the table, for cutting the object to be cut; a water tank for providing a cooling water to the cutting device; and a water level indicating device for indirectly indicating a water level of the cooling water from a top of the table or a side of the water tank. The device thus enables the user to observe the water level from the top of the table or the side of the water tank of the table cutting machine without removing the table during the observation.
US09364967B2
A device for cutting to size and handling a substantially planar blank from a planar CFRP semi-finished product positioned on a cutting table by a cutting means, it being possible for the separated blank to be drawn up by suction and at least raised by a vacuum effector, characterized in that at least one blank electrode can be brought into contact with the blank and at least one peripheral electrode can be brought into contact with a peripheral portion separated from the CFRP semi-finished product and the at least two electrodes are connected to a voltage source and to a measuring means, the measuring means being able to detect a complete separation of the blank from the CFRP semi-finished product.
US09364963B2
A cutter for printed substrates includes a supporting plane adapted to receive a substrate on which images separated by mutually perpendicular edges are printed, and a plurality of cutting units suitable for cutting the printed substrate along the edges. Each cutting unit has a pair of parallel blades spaced apart at a distance corresponding to a width of the edges, a backing plane arranged underneath the supporting plane of the cutter, and a connecting arm which extends from a frame of the cutting unit to the backing plane. The connecting arm is parallel to the blades and is arranged between them and a through opening is formed in a portion of the backing plane under the connecting arm.
US09364960B2
A rotary electric shaver with an outer cutter having a circular shaving top surface with numerous hair introduction openings and an inner cutter having a small cutter slidably rotating in contact with a bottom surface of the outer cutter. The rotary electric shaver includes an outer cutter set wherein the outer cutter is assembled in an outer cutter holding unit and an inner cutter set wherein the inner cutter is assembled in an inner cutter holding unit. The outer cutter set and the inner cutter set are respectively provided with a positioning convex portion on one and a positioning concave portion on the other. The positioning convex portion can fit in the positioning concave portion such that the outer cutter set can be assembled with the inner cutter set only in a case where the outer cutter set and the inner cutter set are in a predetermined assembly position.
US09364959B1
A solar knife that is used as a cutting or chopping tool that includes handle scales that have reflective shallow parabolic outside surfaces that can be used to ignite combustible materials using solar energy. The solar knife has a tinder holder blue print machined into its surface and also has an angled tinder holder mounting hole. Using the tinder holder blue print on the invention and the cutting edge of the solar knife, the user can fashion a precision tinder holder in the field using a tree branch or twig. The fashioned tinder holder is then inserted into the tinder holder mounting hole which allows the tinder to be held firmly at the exact focus of the parabolic outside surface of the handle scales where it is ignited using only energy supplied by the sun. The solar knife also includes sacrificial anodes to minimize metal oxidation.
US09364958B2
The present invention generally relates to pen cutters. Specifically, embodiments of the present invention relate to a pen cutter apparatus with an auto-retractable blade. Embodiments of the pen cutter apparatus are further comprised of a tether-hole and a blade slider button.
US09364957B2
A folding knife has a handle portion and a safety liner with a spring biased portion that slides laterally lodging the end of the spring biased portion under the tang of the knife blade to hold the blade in a safe open position. An adjustment screw has an extended ball surface disposed in a sleeve extending through and attached to one side of the handle and the safety liner. A rotational safety has a safe on detent and a safe off detent for receiving the ball is disposed between the safety liner and the tang of the blade. The blade is secured in the open position by rotating the rotational safety to a safe on position, lodging a safety engagement end under an edge of the spring safety portion of the safety liner and lodging the ball surface into the safe on detent. The adjustment screw is adjusted by to maintain the safety of the knife over time.
US09364949B2
A socket rail tray receives socket rails therein in releasable locking engagement. A slide-click-lock function is provided to lock the rail to the tray, and depressing a release button allows the rail to be removed from the tray. Both ends of the rail as well as a central portion thereof are secured by the tray.
US09364944B2
Provided is a power tool which is capable of more reliably detecting excessive reaction torque acting on a tool body. More specifically, provided is a handheld power tool which causes a tip tool to rotate so as to carry out a predetermined machining operation, the handheld power tool comprising a tool body, a motor which is housed in the tool body and causes the tip tool to rotate, a first sensor which detects the torque state of the tip tool, a second sensor which detects the motion state of the tool body, and a torque cut-off mechanism which cuts off the transmission of torque between the motor and the tip tool. The torque cut-off mechanism is configured to cut off the transmission of torque on the condition that the first sensor and the second sensor respectively detect a preset threshold value for the first sensor and the second sensor.
US09364936B2
Composite materials for use with a drill bit for drilling a borehole in earthen formations. The composite material comprises a first pre-infiltrated hardphase constituent and a second pre-infiltrated hardphase constituent. The second pre-infiltrated hardphase constituent is a carbide which comprises at least 0.5 weight % of a binder and at least about 1% porosity. The composite material further comprises an infiltrant.
US09364931B2
A laser-assisted machining device includes a spindle, a beam splitting module and a cutting tool. The spindle has a chamber, and multiple exit holes. The beam splitting module is disposed in the spindle and includes a beam splitter for splitting a main laser beam into a plurality of secondary laser beams that are directed into the chamber, and an outer reflecting unit mounted in the chamber for reflecting the secondary laser beams out of the spindle through the exit holes. The cutting tool is fixedly mounted on the spindle, for machining a workpiece, and includes multiple cutting teeth. The secondary laser beams maintain constant irradiation on multiple areas of the workpiece during rotation of the spindle.
US09364928B2
Embodiments of a tool and method for removing sweeper bristles from a railway track broom are disclosed. An exemplary tool may include a tube member for insertion into a sweeper bristle gripped onto a nipple element, wherein two or more slits split a front portion of the tube member into flexible prongs each having outward-facing gripping elements near its tip. A plunger element, located inside the tube member, can be propelled forward into a front end of the tube member to cause the flexible prongs to substantially expand at least part of the front portion of the tube member, thereby loosening the sweeper bristle's grip on the nipple element. A hydraulic assembly coupling the plunger element to a hydraulic pressure source is controlled by a trigger mechanism to supply hydraulic pressure to propel the plunger element.
US09364926B2
A system for distortional clamping of a flexible member may include a dimensional reader and a positioning fixture. The dimensional reader may have a plurality of reader pogos that may be axially movable into contacting relation with a detail to measure a detail contour. The positioning fixture may have a plurality of positioning pogos and at least one clamping finger configured to mechanically clamp a flexible member between the positioning pogos and the clamping finger. The positioning pogos may be axially movable to deflect the flexible member into a contour that may be complementary to the detail contour.
US09364925B2
An assembly tool apparatus includes a manipulator having a range of motion defined by a plane and an axis that is substantially normal to the plane, a jig having an assembly surface operative to move from a first orientation relative to the axis to a second orientation relative to the axis, a first tool tip operative to engage with and be positioned by the manipulator, and a second tool tip operative to engage with and be positioned by the manipulator.
US09364923B2
The present invention relates to a method for the production of a piston (1), composed of a piston upper part (2) and a piston lower part (3), of an internal combustion engine, in which the piston upper part (2) is welded with the piston lower part (3) via a contact surface (4) and thereby a cooling duct (5), delimited therebetween, is formed. It is essential to the invention here that for the production or keeping free of an net opening (6) and/or of an outlet opening (7) of the cooling duct (5) during or immediately after the welding of the piston upper part (2) with the piston lower part (3) at least one pin (8) is held out from the piston lower part (3) in the cooling duct (5) or is pushed therein and is drawn out again after the welding process, so that a welding bead (9) occurring on the welding process does not constrict a cross-section of the net opening (6) and/or of the outlet opening (7). Hereby, the piston (1) can be produced at a comparatively favorable cost.
US09364915B2
A diffuser insert is provided for use with a welding diffuser and contact tip assembly comprising a diffuser with an interior chamber configured to receive a wire conduit that supplies electrode wire and a shielding gas used during a welding operation and a contact tip coupled to the diffuser and configured to receive electrode wire. The diffuser insert comprises a diffuser insert body configured to be disposed within the interior chamber of the diffuser, and further comprises an insert bore extending therethrough configured to receive electrode wire. An outer periphery of the diffuser insert has at least one surface feature configured to manipulate a flow of said shielding gas from within said interior chamber of the diffuser and out of exit passages to thereby direct said flow of shielding gas about a molten welding puddle formed during a welding operation.
US09364912B2
The invention refers to a method for the electrochemical machining of work pieces, such as, for example, nozzles, in particular nozzles with a blind hole. The invention also refers to a device for the electrochemical machining of work pieces.The invention is characterized by a relative movement, in particular a rotary movement during the machining between work piece and cathode. The device is characterized in that cathode and/or work piece are supported rotatably on bearings for a relative movement.
US09364903B2
A drill bit has a shank adapted to be attached to a power tool and a cutting portion adapted to drill a hole in a material. A collar is spaced along the length of the drill bit to set a depth distance that the drill bit is allowed to be inserted into a material being drilled. The drill bit further comprises a first engagement structure. A sleeve comprises a second engagement structure that is releasably engageable with the first engagement structure. The sleeve further comprises a coupling mechanism for connecting the sleeve to a fastener driver.
US09364897B2
A metal powder reconditioning apparatus and method recondition contaminated residual powder from an additive manufacturing device. The apparatus and method include a reducing chamber that receives contaminated residual powder resulting from an additive manufacturing process and remove oxygen from the contaminated residual powder to produce reconditioned powder. The reconditioned powder may be reused in the additive manufacturing process, or may be stored in a non-oxidizing atmosphere for later reuse.
US09364887B2
A method for producing a metal component such as a metal turbomachine blade reinforcement, includes positioning a plurality of metal staples in a forming tool having a die and a punch; and hot isostatic pressing the plurality of metal staples causing the agglomeration of the metal staples so as to obtain a solid component.
US09364881B2
Provided are a seamless bent pipe constituted by a bent section and straight pipe sections on both ends of the bent section, with the inside diameter at each pipe end portion being larger than the inside diameter of the bent section, and a welded component comprising a seamless bent pipe and a seamless straight pipe at one or each end of the seamless bent pipe, with the end of the seamless straight pipe to be welded to one or each end of the seamless bent pipe having the same inside diameter as the inside diameter of the seamless bent pipe, as well as methods of manufacturing them. As a result, elements suited for use in pipelines can be obtained, without unnecessarily increasing the wall thickness of the seamless bent pipe and without internal machining of the pipe end portions of the seamless bent pipe after the manufacturing thereof.
US09364867B1
A cleaning apparatus includes a supporting element, at least one button unit and a cleaning unit. The supporting element includes a space. The button unit is formed on the supporting element by making a U-shaped slit in the supporting element. The U-shaped slit is in communication with the space. The cleaning unit includes a shell, bristle and at least one hook. The shell includes a first end and a second end. The bristle is connected to an internal side of the shell via the first end. The hook extends from the second end of the shell. The hook is inserted in the space of the supporting element and the U-shaped slit of the button unit to engage the cleaning unit with the supporting element. The button unit is operable to move the hook out of the U-shaped slit to allow disengagement of the cleaning unit from the supporting element.
US09364861B2
A tube-shaped assembly, a tube-shaped part and an associated method of manufacturing the same are provided. In regards to a method, a glass or plastic tube is provided that has a maskant positioned upon an interior region of the tube to define a window. The method also includes coating an interior surface of the tube with a tinted anti-splinter material having a dye or pigment mixed therein. The method also includes curing the tinted anti-splinter material and removing the maskant such that the interior region is free of the tinted anti-splinter material. A tube-shaped part is also provided that includes a glass or plastic tube and a maskant positioned upon an interior region of the tube to define a window. The tube-shaped part also includes a tinted anti-splinter material having a dye or pigment mixed therein.
US09364860B2
A decorated resin molded article that can secure a high durability and can represent a sufficiently realistic metal texture in appearance is provided as follows. A metal thin film is directly formed on a design surface of a substrate by either a physical vapor deposition method or a chemical vapor deposition method to provide a metallic decoration. Additionally, a topcoat layer is formed with a thickness of 10 to 40 μm on the metal thin film. The topcoat layer comprises a transparent coating film having an adhesive property to both of the substrate and the metal thin film.
US09364859B2
The present invention relates to a surface of a substrate, or the substrate itself, exhibiting superhydrophobic characteristics when treated with a formulation comprising a hydrophobic component, nano-structured particles and water. The superhydrophobicity can be applied either over the entire surface, patterned throughout or on the substrate material, and/or directly penetrated through the z-directional thickness of the substrate material.
US09364856B2
A method of coating a workpiece is provided. In the method, a coating device is provided. The coating device includes a transparent covering plate and an ultraviolet light source device. The workpiece is placed in the coating device. Coating material is injected into the coating device to coat the workpiece. The coating material is ultraviolet light curable material. The ultraviolet light source device emits ultraviolet light and the ultraviolet light passes through the transparent covering plate to cure the coating material on the workpiece. The workpiece is taken out of the coating device.
US09364854B2
A printing method according to the present invention includes an applying step of applying a curable resin-containing ink onto a transfer sheet (10), a heating and thickening step of heating the ink on the transfer sheet (10) to increase viscosity of the ink, a transfer step of transferring the ink on the transfer sheet (10) to a printing target (15), and a curing step of curing the ink on the printing target (15).
US09364852B2
A painting kit includes one or more paint pads and a paint tray. The paint tray includes a reservoir for holding a supply of paint, and means for transferring paint to a paint pad. In one embodiment the paint tray includes a rotating cylinder to transfer paint from the paint reservoir to one or more paint pads. In another embodiment, one or more paint pedestal surfaces are coated with paint from the reservoir in order to transfer paint to paint pads. Each of the paint pads and the trays includes features to selectively apply paint to the paint pad and to avoid applying paint to selected longitudinal edges of the paint pad. The lack of paint along the longitudinal edges helps to prevent paint from dripping or being forced from the longitudinal edge onto adjacent dry surfaces, and thereby enables a user to paint uniformly near edges while avoiding adjacent areas.
US09364842B2
A fluid dispenser pump including a first piston, a second piston, and a dispenser head with a dispenser orifice, for actuating the pump, a shutter arranged upstream from the dispenser orifice, the shutter movable between closed and open positions. The second piston is formed outside a hollow part and is slidable inside the dispenser head. The first piston is slidable inside the hollow part, the hollow part including an axial opening defined by a radial edge through which passes a stem portion of the shutter. The stem portion is between a proximal radial shoulder and a distal radial shoulder of the shutter, the shutter being moved from its closed position to its open position by the radial edge of the hollow part co-operating with the distal radial shoulder, and being moved from its open position to its closed position by the radial edge co-operating with the proximal radial shoulder.
US09364841B2
An inhaler including a pre-inserted cartridge (100) is proposed. The cartridge contains liquid (103) which is preferably pressurized to a low pressure. The cartridge is connected via an aerosol valve (106) with the inhaler. The liquid is further pressurized by a pump (117) of the inhaler to a high pressure and atomized.
US09364840B2
A powder distribution device comprises a distribution chamber having a cylindrical shape, a powder introduction pipe extending along a central axis of the distribution chamber and adapted to introduce powder to an inside of the distribution chamber through an introduction port facing the distribution chamber, swirling gas flow generating unit that generates a swirling gas flow flowing about the central axis of the distribution chamber in the distribution chamber, a plurality of powder distribution paths communicating with an outer peripheral surface of the distribution chamber, and a slit formed at a communicating portion between each of the plurality of powder distribution paths and the distribution chamber.
US09364839B2
An applicator for spraying an elastomeric material comprises an applicator body having an internal bore and a fluid inlet for receiving a supply of the elastomeric material. A nozzle is coupled to the applicator body and has a discharge end with a spray outlet in fluid communication with the fluid inlet via a fluid passageway. A needle valve is slidably mounted within the internal bore for movement between a closed position for closing the fluid passageway, and an open position for opening the fluid passageway so as to spray the elastomeric material. An air cap is coupled to the applicator body adjacent the nozzle for providing an atomizing airflow and a fan control airflow. The needle valve has a tip portion shaped to extend through the nozzle so as to be substantially flush with the discharge end of the nozzle when the needle valve is in the closed position.
US09364836B2
A method and apparatus for removing metallic material from a circulating well fluid stream provides a treatment vessel that is divided into first and second sections. Each of the sections includes a magnetic field that can be in the form of one or more magnets. In one embodiment, multiple magnets are provided in each of the sections. Manifolds attach to an influent and to an effluent of the treatment vessel. Each manifold enables selective transfer of fluid to either of the selected sections. Similarly, discharge of circulating fluid can be from either of the sections via a discharge manifold. The treatment vessel enables continuous treatment by valving fluid flow so that only one section need be used at a time in order that the other section could be serviced for removing collected metallic material from the magnetic field or from the magnets.
US09364832B2
A device for passing a biopolymer molecule includes a nanochannel formed between a surface relief structure, a patterned layer forming sidewalls of the nanochannel and a sealing layer formed over the patterned layer to encapsulate the nanochannel. The surface relief structure includes a three-dimensionally rounded surface that reduces a channel dimension of the nanochannel at a portion of nanochannel and gradually increases the dimension along the nanochannel toward an opening position, which is configured to receive a biopolymer.
US09364823B2
In a process for activating a hydroalkylation catalyst, a catalyst precursor comprising a solid acid component and a compound of a hydrogenation metal is heated at a heating rate of less than 50° C./hour in the presence of hydrogen to an activation temperature in a range from 100° C. to 260° C. and then the heated catalyst precursor is treated with hydrogen for a duration effective to reduce at least a portion of the metal compound to an elemental form.
US09364811B2
An ozone generating apparatus includes a base container for holder water and a head assembly connected to the upper edge of the base container, the head assembly containing ozone generating cells, each having a dielectric tube and an electrode assembly coaxially disposed with the associated dielectric tube. The dielectric tubes and electrode assemblies are disposed and connected such that the tube and/or electrode assembly of each ozone generating cell can be accessed and replaced independently of all other ozone generating cells, and such that the possibility of cascade failure of all remaining ozone generating cells upon failure of a single cell is substantially eliminated.
US09364808B2
The present disclosure relates to an apparatus for a reduction reaction of carbon dioxide using solar energy and a reducing method of carbon dioxide for reacting carbon dioxide gas and hydrogen gas with each other by using solar energy.
US09364806B2
A bottle mixer including a housing that contains a motor, a battery, a controller, controls, and a thermometer all operatively connected to a controller. Threads are provided on a top side of the housing that are adapted to connect to a standard baby bottle. The motor inside the housing is connected to a blade outside the housing that protrudes into attached baby bottle. Selecting a first control spins the blade inside the bottle for a predetermined time. Selecting the second control spins the blade until a predetermined temperature of the bottle contents is reached.
US09364803B2
The invention generally relates to methods for forming mixed droplets. In certain embodiments, methods of the invention involve forming a droplet, and contacting the droplet with a fluid stream, wherein a portion of the fluid stream integrates with the droplet to form a mixed droplet.
US09364795B2
A device for separating and concentrating particles present in a fluid, including: a first microchannel, having at least one first aperture; and at least one second microchannel, having at least one second aperture, and an end is disclosed. The first microchannel surrounds part or all of the second microchannel at the end. The first microchannel and the second microchannel are connected, at the end, by at least one nanochannel, the nanochannel(s) forming a restriction between the first microchannel and the second microchannel. A cap bounds the first microchannel, the second microchannel and the nanochannel at the end. The first microchannel and the second microchannel are made in a first substrate. The first aperture and the second aperture open into a same face of this substrate. The device may be used for separating and concentrating particles of biological samples, such as viruses, DNA or synthesic molecules.
US09364793B2
An exhaust gas-purifying catalyst includes a substrate, and a catalytic layer facing the substrate and including a precious metal, alumina, an oxygen storage material, and a sulfate of an alkaline-earth metal having an average particle diameter falling within a range of 0.01 to 0.70 μm, the average particle diameter being obtained by observation using a scanning electron microscope. Another exhaust gas-purifying catalyst includes a substrate, and a catalytic layer formed on the substrate using slurry containing a precious metal, alumina, an oxygen storage material, and a sulfate of an alkaline-earth metal having an average particle diameter falling within a range of 0.01 to 0.70 μm, the average particle diameter being obtained by observation using a scanning electron microscope.
US09364792B2
A catalyst having superior heat resistance and being capable of efficiently removing a nitrogen oxide, a removing method using the same, an apparatus including the catalyst described above, and the like are provided. A complex metal oxide containing tungsten, zirconium, and cerium has superior heat resistance and is capable of efficiently removing a nitrogen oxide in the presence of ammonia, the content of cerium oxide and the content of tungsten oxide being 10 to 30 percent by weight and 5 to 14 percent by weight, respectively. Hence, a catalyst which includes a complex metal oxide containing tungsten oxide, zirconium oxide, and cerium oxide, in which the content of the cerium oxide and the content of the tungsten oxide are 10 to 30 percent by weight and 5 to 14 percent by weight, respectively, is effectively used to remove a nitrogen oxide.
US09364754B1
Affiliated players in an online game often coordinate activity and communication in the online game. Affiliated players may want to coordinate activities and/or communicate with each even when one or more affiliated players may not be logged into the online game. Further, persons of higher status in an affiliation may want to control the extent to which other players in the affiliation are sent messages external to the game. As such, one aspect of the disclosure relates to facilitating communication to a group of related players of an online game outside of communication mediums available via the game, where the ability to communicate and the type of communication may depend upon permissions associated with a player in a group of affiliated players.
US09364749B2
An operation element has an operation body displaced according to pressing operation, a detection body that is pressed according to displacement of the operation body and detects the displacement of this operation body, and an interposed body interposed between the operation body and the detection body. Of these, the interposed body has an enclosing body in which a dilatant fluid is enclosed. The enclosing body has flexibility.
US09364748B2
An example system and method is provided for detecting a moment of impact and/or strength of a swing based on moving a hand-held device including an accelerometer arrangement. A moment and a magnitude of simulated striking of the object are determined based on one or more accelerometer arrangement outputs resulting from the moving of the hand-held device. Using one or more of aural, visual and tactile outputs, the striking of the object is simulated in accordance with the determined moment of simulated striking and the determined magnitude of the simulated striking.
US09364735B2
Apparatuses and methods that assist a user in utilizing an exercise machine. An exercise support device enables a user to exercise without having to hold on to the exercise machine while exercising. The exercise support device has a belt that can be worn by a user. In embodiments, the belt is connected to arm assemblies, which can be coupled to the side rails of an exercise machine. The exercise support device provides balance for a user of an exercise machine, which can enhance the quality of a user's exercise.
US09364730B2
A racket assembly may include a racket, and at least one sensor operatively coupled to the racket. The at least one sensor may be configured to generate a signal indicative of at least one parameter related to use of the racket. The racket assembly may also include a processor configured to receive the signal as an input and generate an output based on the signal.
US09364728B1
A golf club head comprising a slidable weight for adjusting the location of the golf club head center of gravity, as well as the golf club head bias, is disclosed herein. In particular, the golf club head, which may be a wood or iron-type head, comprises a pair of rails extending along at least one surface, such as a rear surface of an iron type head or a channel disposed in a wood-type head, and a slidable weight comprising a pair of grooves sized to receive the rails. In some embodiments, an applique or one or more clips are applied over or to the rails to prevent the weight from disengaging from the golf club head.
US09364726B2
A method of constructing a golf club head, comprising affixing a hosel to a shell, wherein said shell comprises a striking face, a sole extending aftward from a lower edge of said ball striking face, and a crown extending aftward from an upper edge of said ball striking face, wherein said shell defines a golf club head interior within said shell, wherein said hosel is configured to receive a golf club shaft, wherein said hosel comprises an internal portion within said golf club head interior and an external portion extending outside said shell, wherein said golf club head comprises a hosel rib affixed to said internal portion of said hosel, manipulating the orientation of said hosel relative to said shell after affixing said hosel to said shell, and affixing said hosel rib to said shell after manipulating the orientation of said hosel.
US09364719B2
A multi-piece golf ball comprising at least one component made of a polybutadiene rubber/ionomer resin blend is provided. The ball preferably contains a dual-core comprising an inner core and surrounding outer core layer. Preferably, the polybutadiene rubber/ionomer resin blend is used to form the outer core layer. The center hardness of the inner core is preferably greater than the outer surface hardness of the outer cover layer. The resulting ball has high resiliency and good impact durability.
US09364716B2
An exercise board with interchangeable center and lateral exercise accessories. The center modules include several different types of devices, each designed to be used for different exercises. The center modules can include a bounce ball, a base that makes the deck unstable, for core workout, and a flat unit that is flush with the deck. The side accessories can include handgrips, skateboard trucks, foot straps, or flat units.
US09364706B2
A treadmill includes a base, a platform, a universal joint, two elevators and two telescopic elements. The universal joint is used to connect a rear portion of the base to a rear portion of the platform. Each of the elevators includes a post supported on a front portion of the base and a carriage movably supported on the post. Each of the telescopic elements includes an end connected to a front portion of the platform and another end connected to the carriage of a corresponding one of the elevators.
US09364705B2
An abdominal workout assist device is disclosed. An elongated member and an attachment means are provided, and a support member is attached therebetween. The attachment means connects to the base of a door with the elongated member connected in parallel to the support member. In operation, the user inserts the device under a door and can perform standard abdominal exercises with the elongated member holding the user's feet on the ground. Additional exercises such as legs lifts can be done with the user holding the handles of the device while laying on their back and their arms extended back.
US09364699B2
An inflatable recreation device is formed of a plurality of inflatable donut-shaped tubular members secured in stacked configuration and having an opening extending therethrough. With a first end of the plurality of stacked members facing upwardly, a rebound surface secured to the first end extends over a first end of the opening to form a rebound surface upon which a user can jump. When the device is turned over, the rebound surface faces downwardly to form a bottom of the opening and a second end of the plurality of stacked members and the opening face upwardly whereby users can sit around the second end of the stacked members with feet extending into the opening, or can walk around the second end as a balance beam. Further, the stacked members can be turned on their side and rolled with users inside the opening.
US09364698B2
The invention relates to an inerting system as well as an inerting method for reducing oxygen in which an oxygen content which is predefinable and reduced in comparison to normal ambient air is set and maintained in the spatial atmosphere of an enclosed room (2). To this end, the inerting system (1) comprises a compressor system (3) for compressing an initial gas mixture as well as a gas separation system (10) connected to the compressor system (3). At least a portion of the oxygen contained within the compressed initial gas mixture is separated in the gas separation system (10). The gas separation system (10) is designed to be selectively operated in either a VPSA mode or a PSA mode.
US09364690B2
A cosmetic composition in the form of an emulsion comprising at least one aqueous phase and at least one fatty phase, at least one superabsorbent polymer and at least one surfactant of formula (I): Wherein: R1 and R3 denote, independently of each other, an alkyl radical containing from 1 to 25 carbon atoms; R2 denotes a spacer formed from a linear or branched alkylene chain containing from 1 to 12 carbon atoms; X and Y denote, independently of each other, a group —(C2H4O)a—(C3H6O)bZ, in which Z denotes a hydrogen atom or a radical —CH2—COOM, —SO3M, —P(O)(OM)2, —C2H4—SO3M, —C3H6—SO3M or —CH2(CHOH)4CH2OH, in which M, M′ represent H or an alkali metal, alkaline-earth metal, ammonium or alkanolammonium ion, a ranges from 0 to 15, b ranges from 0 to 10, and the sum of a+b ranges from 1 to 25; and n ranges from 1 to 10 is provided.
US09364688B2
The invention is related to a method for monitoring a range of a particle beam in a target. The method is using gamma detectors for detecting prompt gammas produced in the target. The time differences between the time of detecting a gamma quantum and a time of emission of a particle or a bunch of particles from the radiation device are determined. A statistical distribution of those time difference is used to deduce information related to the range of the beam. The invention is also related to an apparatus for monitoring a range based on measured time profiles of detected prompt gammas.
US09364685B2
The invention relates to a method for identifying the location at least one treatment channel from a group of a plurality of treatment channels as wells as a system for effecting radiation treatment on a pre-selected anatomical portion of an animal body.According to the invention the identifying method being characterized by the steps of A selecting at least one of said plurality of treatment channels; B reconstructing the actual location of said selected treatment channel relative to said animal body; and C comparing said reconstructed location said pre-planned plurality of locations. Furthermore the system according to the invention is characterized in that identifying means are present for identifying the location of at least one treatment channel from said group of said plurality of inserted treatment channels and comparing said identified location with one or more of said pre-planned locations present in said treatment plan.
US09364683B2
The portable electronic device includes radiation elements (104A, 104B) for directing optical radiation energy non-invasively at intracranial nerve tissue of a user through an external auditory canal of the user of the portable electronic device to stimulate the user's intracranial nerve tissue. Stimulation may have a metabolic and/or nervous response, which appears as a change in alertness, diurnal rhythm and in concentrations of several hormones and brain transmitters.
US09364682B2
In embodiments, an emergency external defibrillator system is configured for use by a local rescuer in cooperation with a remote rescuer to assist a patient. The external defibrillator system includes a sensor to generate a patient value that represents a physiological parameter of the patient. The system also includes a communication module to transmit the patient value to another device of a remote rescuer, and to receive in response an incoming message that contains an encoded sound. For the local rescuer, the system also includes a screen to display the patient value, and a speaker to play the sound concurrently with the screen displaying the patient value. An advantage is that the local rescuer can receive guidance from the remote rescuer.
US09364679B2
Systems and methods are described for adjusting the operation of implantable stimulation devices used to provide medical monitoring and treatment. Several hierarchical algorithms are described which operate according to conditionally obtaining a patient response to an alert signal. In one such strategy semi-automatic therapy adjustment occurs by automatically issuing patient alert messages when selected operations are to occur, and using a patient's response to the alert message that is provided within a selected time limit in order to contingently adjust therapy. Methods are also described for resolving conflicts which may occur when time information and sensed data information each indicate different patient states are occurring. Although treatment of neural and cardiac disorders is emphasized, the techniques can be applied to the monitoring and treatment of any medical disorder with an implanted device.
US09364677B2
Methods and devices for sensing vector analysis in an implantable cardiac stimulus system. In an illustrative example, a first sensing vector is analyzed to determine whether it is suitable, within given threshold conditions, for use in cardiac event detection and analysis. If so, the first vector may be selected for detection and analysis. Otherwise, one or more additional vectors are analyzed. A detailed example illustrates methods for analyzing sensing vectors by the use of a scoring system. Devices adapted to perform these methods are also discussed, including implantable medical devices adapted to perform these methods, and systems comprising implantable medical devices and programmers adapted to communicate with implantable medical devices, the systems also being adapted to perform these methods. Another example includes a programmer configured to perform these methods including certain steps of directing operation of an associated implanted or implantable medical device.
US09364671B2
One aspect of the present disclosure relates to a method for treating a menopause-related condition in a subject. One step of the method can include inserting a therapy delivery device into a vessel of the subject. Next, the therapy delivery device can be advanced to a point substantially adjacent a target site of the sympathetic nervous system (SNS) that is associated with the menopause-related condition. The therapy delivery device can then be activated to deliver a therapy signal to the target site of the SNS in an amount and for a time sufficient to effect a change in sympathetic activity in the subject and thereby treat the menopause-related condition.
US09364663B2
An implantable medical device (IMD) including a power supply, a sensing device and/or a stimulation device, a control unit, a magnetic resonance (MR) detection unit, and at least two magnetic field sensors. The power supply is connected to one or more of the sensing device, the stimulation device, the control unit, the MR detection unit and the magnetic field sensors. The control unit is connected to the sensing device and/or stimulation device, to the MR detection unit, and to the at least two magnetic field sensors. The at least two magnetic field sensors are arranged spatially separately from one another and the MR detection unit determines a spatial and/or temporal gradient of magnetic field strengths detected by the at least two magnetic field sensors and transmitted to the MR detection unit. The MR detection unit detects an MR field and transmits an MR signal to the control unit.
US09364652B2
A connector for coupling to a base of medical device equipped with a circular hub having a circumferential recess. The connector includes a cap having a top surface, a bottom surface, a central region, and a circumferential region. The cap defines at least two pairs of slots extending from the circumferential region towards the central region dividing the cap into at least two fixed lobes and at least two resilient lobes. Each resilient lobe has an outward projecting lift tab, an inward projecting catch, and at least a resilient region. Positioning the connector on the circular hub and pressing the connector engage the catches with the circumferential recess of the circular hub so the connector can rotate completely about the circular hub. Lifting at least one lift tab to reversibly displace the resilient lobe and its respective catch radially to disengage from the circumferential recess decouples the connector.
US09364649B2
A skin cosmetic container includes an opening/closing unit capable of discharging contents introduced into a cylinder provided within a first body in which the contents are stored to the outside of the first body as a pressure is applied to a push button provided on a pump body mounted to an upper portion of the first, body and including a discharge hole for discharging the contents flowing along a guide passage in the pump body to the outside of the first body to selectively open and close a content passage, the skin cosmetic container including: a second body mounted to a lower portion of the first body and having a temperature controller therein; a power source mounted within the second body; and a heater mounted to an end of the second body to emit heat by using electric power applied from the power source and including a heat emitting portion whose heat emitting temperature is controlled by the temperature controller.
US09364646B2
Tools for determining and adjusting the setting of an adjustable valve are disclosed. These tools allow a medical professional to locate and non-invasively determine the setting of an implanted valve. After the valve has been located and the setting of the valve determined, the valve may be re-adjusted non-invasively. There are three tools: a locator tool, an indicator tool and an adjustment tool. The locator tool allows the physician to locate the adjustable valve of interest and align the locator tool with a specific orientation of the valve. The indicator tool indicates the current setting of the adjustable valve and confirms new settings of the valve after the new settings have been implemented. The adjustment tool interacts magnetically with the implanted adjustable valve to couple with a movable internal element to change the setting of the valve. The indicator tool and the adjustment tool physically cooperate with the locator tool to accomplish the respective functions of the tools.
US09364645B2
A balloon catheter includes a proximal shaft, a distal shaft, an intermediate shaft positioned between the proximal shaft and the distal shaft, lumens that penetrate through the proximal shaft, the intermediate shaft, and the distal shaft and introduce and discharge a dilation fluid for a balloon, an inner tube shaft having a guide wire opening arranged at a boundary between the intermediate shaft and the distal shaft and through which the lumen extends, and a reinforcement member arranged in the lumen so as to suppress an occurrence of a kink. The reinforcement member has a tapered proximal portion fixed to the proximal shaft and arranged inside the lumen positioned in the intermediate shaft, a tapered distal portion arranged inside the lumen positioned in the distal shaft, and a straight transition portion positioned between the proximal portion and the distal portion. The transition portion is aligned with the guide wire opening.
US09364643B2
Some systems and methods for operating a vessel occlusion catheter may include a control and inflation device to control the filling of the balloon in such a manner that the vessel wall will not be overstressed while the safe occlusion of the blood vessel is achieved.
US09364624B2
This disclosure describes systems and methods for providing novel adaptive base flow scheduling during ventilation of a patient to optimize the accuracy of estimated exhaled tidal volume. Further, this disclosure describes systems and methods for providing novel adaptive inspiratory trigger threshold scheduling during the novel adaptive base flow scheduling.
US09364622B2
A collapsible inhalation device for use with a metered dose inhaler (MDI) dispenser includes an outlet end member, an inlet end member and a tubular, pliable, collapsible sleeve member attached at either end to the inlet and outlet members. The outlet end member includes a mouthpiece. The inlet end member includes an inlet port and an MDI dispenser mount structure configured to receive and engage the MDI dispenser. The inhalation device is positionable in each of an open position, wherein the sleeve member defines a chamber, and a closed position, wherein the sleeve member is collapsed and enveloped by the outlet end member and the inlet end member.
US09364620B2
Devices for intranasally delivering therapeutic gases to a patient. The devices may include a measurement chamber, a combination pressure regulators and a sequencing mechanism that controls valves associated with the pressure regulators. When implemented in a hand-held dispenser, the hand-held dispenser may reliably deliver consistent doses of gas regardless of the unknown state and pressure of the therapeutic gas in the measurement chamber.
US09364614B2
The invention relates to a drug delivery device, comprising: a case for retaining drug container, the drug container defining a cavity for containing a drug, wherein a stopper is slidably disposed within the container so as to displace the drug through a discharge nozzle on translation in a distal direction, an inner magnet disposable within the drug container for abutting the stopper, at least one outer magnet disposed within the case coaxially with the container and slidable in an axial direction, a trigger arrangement for advancing the outer magnet in a distal direction on actuation, wherein the outer magnet and inner magnet are arranged for magnetically interacting through the drug container wall such the outer magnet advances the inner magnet on trigger actuation.
US09364612B2
A housing may have a needle, plunger, and bias mechanism supported within the housing by a tab configured to retain the plunger in position and to allow the plunger to move under bias force imparted by the bias mechanism to move the needle to an insert position when the tab is removed. A base and a structure may be configured for relative movement there between and may be adapted to be secured to a user with a cannula extending through a body of the structure into the user during use of a medical device. A housing may be adapted to be secured to a user to support a medical device operable with an insertion needle, the housing having a magnifying material for increasing visibility of an injection site.
US09364609B2
An electronic controller for an insulin infusion device includes a processor architecture and at least one memory element. The memory element stores executable instructions that, when executed by the processor architecture, provide an insulin on board (IOB) compensation module to estimate a current IOB value that indicates an amount of active insulin in the body of the user, calculate an IOB rate based at least in part on the estimated current IOB value, determine an adjusted insulin infusion rate based at least in part on the calculated IOB rate and an uncompensated insulin infusion rate, select a final insulin infusion rate for the device, and provide the selected final insulin infusion rate to regulate delivery of insulin by the device.
US09364605B2
The invention relates to a hand piece for a disposable flushing nozzle unit for cleansing and/or irrigating surgical wounds, comprising a housing with one first connecting unit for holding the disposable flushing nozzle unit, a drive mechanism and an electric motor interacting with said drive mechanism. In an especially advantageous embodiment the hand piece comprises a second connecting unit for connecting an external electric power supply.
US09364604B2
A user interface for a machine for extracorporeal blood treatment comprises a touch screen and a controller programmed to display on a screen (16) a display in which two distinct areas are arranged, one of which (161) exhibits a series of touch keys (17). Activation of any one touch key (17) causes visualization of an image in a second area (162) of the screen. The images are displayed alternatively and are at least partly different one from another. Each touch key (17) is associated to an instruction, or to a group of instructions, all concerned with readying the machine for use. Each image is a pictograph of a configuration of the machine, correlated with an instruction associated to the touch key (17) selected. The operator is aided in making the machine ready for treatment.
US09364602B2
A method for priming a hemodialysis treatment includes: providing a sorbent cartridge for cleaning spent dialysate fluid returning from a dialyzer; preparing a batch of dialysate in a quantity commensurate with being recycled through the sorbent cartridge multiple times; priming a dialysate circuit in fluid communication with the dialyzer using the batch of dialysate; and priming a blood circuit in fluid communication with the dialyzer using the batch of dialysate.
US09364599B2
A portable hemodialysis system is provided including a disposable cartridge and a reused dialysis machine. The disposable cartridge includes a dialyzer, and a dialysate flow path and a blood flow path which flow in opposing directions through the dialyzer. The disposable cartridge includes a filter for removing waste products from the dialysate, and pressure and fluid flow sensors for measuring the pressure and fluid flow in the dialysate flow path and blood flow path. In addition, the disposable cartridge possesses pump actuators (but not pump motors) for pumping dialysate and blood through their respective flow paths. The reused dialysis machine possesses a reservoir for dialysate, a level sensor, a blood leak sensor, an ammonia sensor, a venous blood line pressure sensor, a venous blood line bubble detector, pump motors, and a processor connected to the motors and sensors for controlling and monitoring hemodialysis treatment.
US09364593B2
An impeller includes a hub and a blade supported by the hub. The impeller has a stored configuration in which the blade is compressed so that its distal end moves towards the hub, and a deployed configuration in which the blade extends away from the hub. The impeller may be part of a pump for pumping fluids, such as blood, and may include a cannula having a proximal portion with a fixed diameter, and a distal portion with an expandable diameter. The impeller may reside in the expandable portion of the cannula. The cannula may have a compressed diameter which allows it to be inserted percutaneously into a patient. Once at a desired location, the expandable portion of the cannula may be expanded and the impeller expanded to the deployed configuration. A flexible drive shaft may extend through the cannula for rotationally driving the impeller within the patient.
US09364589B2
In a method for making a wire guide, a fluoropolymer coating is removed from a distal section of an FP coated core wire to expose a metallic portion. A polymer coating is applied to a proximal section of the FP coated core wire such that the polymer coating overlays at least a portion of the FP coating, and to the distal section of the FP coated core wire including the exposed metal portion. The polymer coating is removed from the FP coating to form the wire guide having a proximal portion with the FP coating and a distal portion with the polymer coating. A hydrophilic coating may be applied to the distal portion over the polymer coating.
US09364586B2
Methods for more uniformly delivering drugs or other treatment agents locally to the vasculature of a mammal are disclosed. These methods use one or more strategies to facilitate rapid mixing with the blood flowing past a device or otherwise improve the uniformity of drug delivery. Some of these strategies employ medical devices with diffusion members.
US09364585B2
An innovative method of collecting cord blood stem cells from an isolated mammalian non-exsanguinated or partially exsanguinated placenta by placental perfusion is described and also an easy method for safe long duration cold storage of the placenta. Placental perfusion can include perfusing the isolated placenta with a pulsatile flow of perfusion solution, for example, using a pulsatile or peristaltic pump or device. The stem cells can then be isolated from the perfusate. Significantly increased amounts of CD133+ stem cells can be collected from the perfusate. The perfusion solution can include an anticoagulant. The isolated mammalian placenta need not be treated with an anticoagulant prior to perfusing. The isolated placenta can be free from an anticoagulant prior to perfusing.
US09364584B2
The present invention provides a cancellous bone scaffold to use in the replacement or repair of connective tissue such as ligaments and tendons. The cancellous bone scaffold has a fully demineralized segment with at least one adjacent mineralized end segment.
US09364582B2
Described are malleable medical compositions such as pastes or putties that include solids combined with a liquid carrier. The solids can include particulate collagen and particulate demineralized bone matrix. The liquid carrier includes an aqueous medium comprising one or more polysaccharides. Also described are methods for making and using such medical compositions.
US09364575B2
An aroma scent dispersing assembly which selectively meters the fragrance emittance output, varying the concentration of aroma vapor in the discharge air flow is disclosed. The dispersing assembly includes a house having interconnected base members, selectively removable cover, opposite side walls, front and end walls defining an inner compartment with at least the end wall having access openings therethrough. A motor driven forced air fan assembly is arranged in the compartment and includes controls for selectively generating a flow of air from the front wall to discharge through the access openings of the end wall. An aroma dispensing cartridge assembly is arranged in the compartment and has apertures therethrough to expose the interior to the flow of air. A scented vapor emitting source, such as one or more wafers is supported by the aroma dispensing cartridge and is exposed to the flow of air. The aroma dispensing cartridge assembly is constructed for being selectively movable to meter and vary the amount of exposure of the vapor emitting source to the flow of air.
US09364574B2
Wearable devices for dispensing insect repellents, fragrances, and/or other chemicals along the outside of the clothing of a human are disclosed. They are of the type that are clipped onto a belt or the like, and use a powered fan to dispense active. They are configured with fan rotor arrangements to minimize power use while still achieving acceptable air flow rates. These changes permit use of smaller batteries and more compact arrangements for battery positioning. This in turn permits a much more compact and lightweight construction to achieve the desired results. The devices are also provided with a rotatable clip structure to render use of the device more comfortable when the user is seated and to provide greater control over the direction of the dispensing. Further, they are provided with modified lids to facilitate active refill replacement.
US09364572B2
Static fluid disinfecting system and related methods. Implementations of a method of disinfecting a fluid include statically contacting a fluid included in in a container with an open-celled foam where the open-celled foam is coated with a quaternary organosilane coating produced from a quaternary ammonium organosilane reagent where the fluid contains one or more microorganisms.
US09364569B2
Method for preparing a lyophilized matrix and, upon reconstitution of the same, a respective injectable contrast agent comprising a liquid aqueous suspension of gas-filled microbubbles stabilized predominantly by a phospholipid. The method comprises preparing an emulsion from an aqueous medium, a phospholipid and a water immiscible organic solvent. The emulsion is then freeze-dried and subsequently reconstituted in an aqueous suspension of gas-filled microbubbles. The method allows to obtain suspensions comprising microbubbles having a relatively small diameter and a narrow size distribution.
US09364567B2
Provided are fragments of human p97 (melanotransferrin) polypeptides having blood-brain barrier (BBB) transport activity, including variants and combinations thereof, conjugates comprising the p97 fragments, and related methods of use thereof, for instance, to facilitate delivery of therapeutic or diagnostic agents across the BBB.
US09364560B2
Compositions including at least one Omega-3 fatty acid ester and at least one surface active agent are provided; wherein the compositions form micelles when in contact with an aqueous medium. Also provided is a method of administering to a subject such a composition, wherein the at least one Omega-3 fatty acid ester forms micelles when in contact with an aqueous medium, and the bioavailability of the at least one Omega-3 fatty acid ester is substantially independent of a food effect. The compositions are useful for treating cardiovascular conditions or disorders in a subject and for reducing side effects associated with the ingestion of Omega-3 fatty acid esters. Further provided are also various dosage forms for administering the compositions and use of the compositions in functional foods. Provided herein are also kits with instructions on how to administer the compositions.
US09364553B2
The synergistic biomolecule-polymer conjugates are the long-acting, in vivo controlled continuous-release and hybrid synergy systems of biomolecules that provide increased biological activities and enhanced pharmacological properties for achieving greater therapeutic efficacies.
US09364550B2
The present invention relates to a bioactive carbon nanotube composite functionalized with a β-sheet polypeptide block copolymer by combination self-assembly, which shows excellent water dispersion, and has biological activity so as to be used as stimulus-responsive and adaptable biomaterials or in the manufacture of CNT-based electronic biosensor devices. In addition, the bioactive carbon nanotube composite can be used as a composition for delivery of a biological active material into cells. Further, the application of the interaction between a β-sheet peptide and a carbon-based hydrophobic material is expected to be useful for designing and developing an inhibitor for diseases caused by the abnormal folding of a protein and by biomacromolecular interactions (protein-protein, protein-DNA, and protein-RNA interactions etc).
US09364541B2
The present application relates to a pharmaceutical granulate comprising Fesoterodine or a pharmaceutically acceptable salt or solvate thereof and a pharmaceutically acceptable stabilizer, which can be selected from the group consisting of sorbitol, xylitol, polydextrose, isomalt, dextrose, and combinations thereof, and is preferably a sugar alcohol selected from the group consisting of xylitol and sorbitol. The granulate is suitable for incorporation into pharmaceutical compositions comprising a gel matrix formed by at least one type of hydroxypropyl methylcellulose into which the Fesoterodine is embedded and, optionally, further excipients. In certain embodiments, the granulate is formed by a process of wet granulation.
US09364530B2
The present invention relates to novel virus-like particles (VLPs) comprising a matrix protein derived from a first plant enveloped virus and a surface polypeptide. The surface polypeptide comprises (a) a surface exposed portion derived from a target polypeptide (b) a transmembrane domain, and (c) a cytosolic tail derived from a transmembrane (e.g., glycoprotein) of a second plant enveloped virus. The target polypeptide may be antigenic or therapeutic. The first and the second plant enveloped viruses may be the same. Either plant enveloped virus may be a plant rhabdovirus. Also provided are methods of making and using the VLPs.
US09364525B2
The present invention relates to a novel lipoprotein particle, methods for preparing and purifying the same, its use in medicine, particularly in the prevention of malarial infections, compositions/vaccines containing the particle or antibodies against the protein particle such as monoclonal or polyclonal antibodies and use of the same, particularly in therapy. In particular it relates to an immunogenic protein particle comprising the following monomers: a. a fusion protein comprising sequences derived from a CS protein of P. vivax and the S antigen of Hepatitis B (CSV-S), and b. a fusion protein comprising sequences derived from CS protein of P. falciparum and S antigen of Hepatitis B (RTS), and c. optionally the S antigen derived from Hepatitis B.
US09364524B2
A pharmaceutical composition using natural gonadotropin—releasing hormone (GnRH), and/or some of its mimetic peptides, indistinctly bound by its amino or carboxyl extremes to a carrier molecule; in one case by its carboxyl extreme and in the other case by the amino terminal extreme, thus eliciting a faster and more potent immunological response against the endogenous GnRH hormone. This finally leads to the ablation of the GnRH and consequently of the rest of the involved hormones in the stream GnRH/LH-FSH/Testosterone-(estrogens). An advantage of this formulation consists on facilitating the exposition to the immune system of a greater number of epitopes of the GnRH or its mimetics, minimizing thus the steric hindrance produced by the carriers. This invention has a direct application in the castration of pets and animals of economic interest, in the control of human fertility as well as in the treatment of hormone-sensitive tumors, such as that of the prostate, the breast, ovary, the endometry, testicles, hypophysis, salivary glands and other kinds of human tumors.
US09364514B2
A chimeric peptide construct having a cell penetrating peptide linked to a pro-apoptotic peptide. The construct can be used for treating a tumor in combination with an anti-tumor agent. Also disclosed is a method for treating a tumor with the chimeric peptide construct and a chemotherapeutic agent.
US09364513B2
Compositions that include nanoscale structured materials or precursors thereof (e.g., self-assembling peptides) are described. The compositions can include other substances (e.g., a vasoconstrictor). Also described are methods for using the compositions to promote hemostasis, to protect the skin or wounds from contamination, to decontaminate a site upon removal of previously applied compositions that provided a protective coating, and to inhibit the movement of bodily substances other than blood. The compositions are also useful in isolating tissue, removing tissue, preserving tissue (for, e.g., subsequent transplantation or reattachment), and as bulking, stabilizing or hydrating agents. Medical devices that include the compositions (e.g., a stent or catheter), bandages or other wound dressings, sutures, and kits that include the compositions are also described.
US09364500B2
A method for treating cancer is described using combination therapies comprising the use of hyperbaric oxygen with histone deacetylase inhibitors, with and without glycolytic therapies. The patient is subjected to a hyperbaric environment of substantially pure oxygen. A predetermined dose of one or more HDACI substances is administered to the patient. In addition, glycolitic inhibitors may also be administered. Dosages, pressures, and durations are selected as described herein to have a therapeutic effect on the patient.
US09364496B2
The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma.
US09364491B2
The invention relates to products comprising an antibiotic agent and a second agent being a dispersant or an anti-adhesive agent, in particular a mucolytic dispersant or a mucolytic anti-adhesive agent, which are useful in relation to the prevention and treatment of bacterial infections.
US09364486B2
Disclosed is a method of remyelinating axons with 6-substituted estradiol compounds of the formula The methods can be used to treat a variety of demyelinating diseases.
US09364485B2
The application provides formulations for the topical administration of an active agent comprising at least one steroid, in the form of topical sprays that are propellant-free, and/or substantially non-foaming, and/or alcohol-free. The present application also provides processes for preparing such compositions and methods of using them in management of skin diseases or disorders such as psoriasis, dermatoses, and other associated skin diseases or disorders.
US09364482B2
The present invention relates to compounds of formula I that are useful as hepatitis C virus (HCV) NS5B polymerase inhibitors, the synthesis of such compounds, and the use of such compounds for inhibiting HCV NS5B polymerase activity, for treating or preventing HCV infections and for inhibiting HCV viral replication and/or viral production in a cell-based system. (I)
US09364475B2
The present invention is directed to compositions and methods that target the PI3K signaling pathway for the treatment or prevention of cancer. In one aspect, there is provided a pharmaceutical formulation comprising Polymorph E of N-(3-{[(2Z)-3-[(2-chloro-5-methoxyphenyl)amino]quinoxalin-2(1H)-ylidene]sulfamoyl}phenyl)-2-methylalaninamide.
US09364464B2
There is disclosed herein a composition for treating extracellular parasitic infections, the composition comprising one or more of the following combinations: at least one quinolone or fluoroquinolone together with at least one tetracycline, iodoquinol, an azole or imidazole; or at least two agents selected from the group consisting of iodoquinol, thiazolidones, tetracycline, nitroimidazoles, cotrimoxazole and diloxanide furoate. There is also disclosed herein a method for treating extracellular parasitic infections in a vertebrate in need of said treatment, wherein said treatment comprises administering to said vertebrate a therapeutically effective amount of (i) a composition comprising a quinolone or fluoroquinolone together with a pharmaceutically acceptable carrier or (ii) a composition of the invention or (iii) a combination of at least one quinolone or fluoroquinolone optionally together with at least one tetracycline, iodoquinol, an azole or imidazole; or (iv) a combination of at least two agents selected from the group consisting of iodoquinol, thiazolidones, tetracycline, nitroimidazoles, cotrimoxazole and diloxanide furoate.
US09364457B2
The present invention discloses a composition for lowering blood lipid and elevating high-density lipoprotein and a method for manufacturing the same; the composition comprises monascin or ankaflavin, or a combination thereof; the manufacturing method comprises the steps of: treating a Monascus fermented product with acetone for three times; elevating the concentration of the Monascus fermented product by a process of decompress concentration; and extracting the monascin and the ankaflavin from the Monascus fermented product with a silica gel column chromatography, a Sephadex LH-20 column chromatography, the silica gel column chromatography, and a preparative high performance liquid chromatography sequentially.
US09364452B2
There is provided a novel use of ramalin for preventing or treating liver diseases, and more specifically, a pharmaceutical composition for preventing or treating hepatic fibrosis or cirrhosis containing ramalin or a pharmaceutically acceptable salt thereof, and a functional food containing the same. It was confirmed that at the time of applying ramalin, which is a compound derived from Ramalina terebrata according to the present invention, to animal models, ramalin may remarkably suppress hepatic fibrosis and lower liver cirrhosis levels as compared to silymarin known as a liver cell protecting ingredient without cytotoxicity to normal liver cells, such that ramalin may be effectively used for preventing or treating hepatic fibrosis and liver cirrhosis.
US09364445B2
A stabilized bioadhesive composition containing an alkaline labile drug and a method for its preparation are provided. In one aspect, the composition is a hot-melt extruded (HME) composition comprising a preformed excipient mixture comprising an acidic component and an alkaline thermoplastic matrix-forming material, e.g. polymer. The excipient mixture is formed before blending with an alkaline labile drug. The blend is then hot-melt extruded to form the HME composition. By so doing, the acidic component is able to neutralize or render moderately acidic the excipient mixture. This particular process has been shown to substantially reduce the degradation of an alkaline labile drug during hot-melt extrusion. The excipient mixture softens or melts during hot-melt extrusion. It can dissolve or not dissolve drug-containing particles during extrusion. Various functional excipients can be included in the carrier system to improve process performance and/or improve the chemical or physical properties of the HME composition.
US09364441B2
A rotary die system that includes first and second axially aligned, coacting rotary dies positioned adjacent one another. Each die includes a working surface having a plurality of recesses defined therein. The recesses in the first die are each configured to align with a recess in the second die to form a product cavity upon coaction of the first and second dies. The product cavity is configured to receive a product. Each recess in at least one of the first or second dies includes a pin therein that is configured to puncture a film that at least partially surrounds the product.
US09364434B2
Nanolipidic Particles (NLPs) having average mean diameters of 1 nm to 20 nm are made from a precursor solution. NLPs can be loaded with a desired passenger molecule. Assemblies of these particles, called NLP assemblies, result in a vehicle population of a desired size. Single application or multifunction NLP assemblies are made from the loaded NLPs and range in size from about 30 nm to about 200 nm. A method of using preloaded NLPs to make larger carrier vehicles or a mixed population provides increased encapsulation efficiency. NLPs have application in the cosmetics, pharmaceutical, and food and beverage industries.
US09364433B2
There may be provided compositions of lipophilic pharmaceutical agents with improved solubility and stability. For example, there may be provided a non-aqueous composition that comprises a lipophilic pharmaceutical agent, and an amphiphilic polymeric solvent such as PEG400 but essentially free of organic solvents and non-solubilized particles. The composition may be further diluted with a desired aqueous diluent such as an infusion fluid for parenteral administration to a subject such as a human. The compositions may be useful for the treatment for diseases or conditions that are sensitive to lipophilic agents, such as infectious diseases, malignant or autoimmune diseases.
US09364428B2
A Chinese herbal medical composition in the form of jelly, wherein a Chinese herbal medicine is contained in a base containing at least one substance selected from the group consisting of carrageenan, carob bean gum and xanthan gum and not containing phosphate buffer. The Chinese herbal medical composition hardly causes syneresis, is superior in the preservative stability, is broadly applicable to a Chinese herbal medicine and is orally taken without taking care of the bitter of a Chinese herbal medicine.
US09364425B2
Compositions and methods are provided herein for regenerating and repairing damaged or aged tissue or organs using nonviable lethally irradiated or lyophilized pluripotent stem cells. In one aspect, the compositions and methods described herein provide anti-aging benefits to the skin by increasing the hydration reducing fine lines, wrinkles, and pores of the skin. Compositions and methods are also provided for promoting wound healing using lyophilized pluripotent stem cell powder. A method is provided for inducing cardiac muscle regeneration in a primate comprising delivering nonviable lethally irradiated pluripotent stem cells to damaged or aged areas of the heart. The compositions and methods include nonviable lethally irradiated or lyophilized pluripotent stem cells. In one aspect, the compositions and methods utilize nonviable pluripotent stem cells in the form of a powder, such as lyophilized stem cells.
US09364419B2
A oral care composition comprising 20% to 75% of water by weight of the composition; 25% to 60% of a calcium-containing abrasive by weight of the composition; 0.1% to 15%, of a polyethylene glycol (PEG) by weight of the composition; and 0.001% to 5% of a flavorant composition by weight of the oral care composition.
US09364418B2
The present invention relates to the use of copolymers comprising N-vinylpyrrolidone and a hydrophobically modified acrylic acid derivative as agents for improving the water resistance of a cosmetic formulation, and to the use of these copolymers in sunscreen compositions for increasing the sun protection factor, and furthermore the present invention relates to cosmetic formulations comprising these copolymers.
US09364406B2
The invention provides compounds of formula I; or a salt thereof as described herein. The invention also provides dermatological compositions comprising a compound of formula I or mixtures of one or more compounds of formula I, processes for preparing compounds of formula I, intermediates useful for preparing compounds of formula I and therapeutic methods for protecting skin or DNA from photodamage or repairing photodamaged skin or DNA.
US09364405B2
The compositions and methods of described herein comprise novel ingredients effective to reduce unwanted pigmentation, such as skin discoloration, freckles, age spots, liver spots, sun damage, tans, pigmented acne marks, scars, pigmented birthmarks, hyperpigmentation, post-inflammatory hyperpigmentation, post-injury hyperpigmentation, melasma, cholasma, after-burn scar, nail stain, yellowing of skin, dark circles under eyes, and the like. The composition may include additional ingredients accordingly for a colored cosmetic, moisturizer, cleanser, toner, and the like.
US09364404B2
The invention relates to a meta-phenylenediamine compound of formula (I) below, the addition salts thereof with an acid and the solvates thereof: in which: R represents a hydrogen or halogen atom; a C1-C4 alkyl radical; a carboxyl radical or a (C1-C4) alkoxycarbonyl radical, R1 represents a linear C1-C10 alkyl radical substituted with a cationic radical, said alkyl radical being optionally interrupted with one or more oxygen atoms and/or with one or more NR6 groups, said cationic radical being optionally substituted with one or more radicals chosen from C1-C4 alkoxy or C1-C4 (hydroxy)alkyl; R6 represents a hydrogen atom or a linear or branched C1-C4 alkyl radical; An− represents an anion or a mixture of anions which are organic or inorganic and cosmetically acceptable.
US09364403B2
A coloring composition comprising: (i) at least 0.0001 wt % of a water-soluble dye compound containing one or more sulfonate and/or carboxylate groups; (ii) at least 0.1 wt % urea; (iii) from 0.1 to 2.5 wt % of a thiol; (iv) less than 0.5 wt % ammonia; and (v) less than 0.5 wt % sulfite ions.
US09364398B1
Briefly, a feeding device embodying features of the present invention approximately conforms to the shape of a human breast and includes at least one housing for storing fluid coupled to a dispensing portion having an apertured dispensing tip for delivering the fluid to an infant.
US09364395B2
A cartridge syringe has a housing with an opening for inserting the cartridge having a cylinder filled with a medication and closed at its ends by a piercing membrane and a stopper having a blind hole. A ram is provided for pressing the stopper for injecting the medication in the cylinder after piercing the membrane. The ram has an actuating element and can be attached in the blind hole of the stopper for aspiration. The ram has an outer sleeve with a core. The outer sleeve is displaceably guided in a rotatable manner and the core in a rotationally fixed manner. A front end of the outer sleeve is provided with at least one fixing hook which is spring-loaded inwardly A cam is engageable with the fixing hook such that, upon rotation of the outer sleeve, the fixing hook is movable either to the fixing position or to the unlocked position.
US09364391B2
An apparatus for displaying acupuncture points according to the present invention recognizes a curved surface of a human body via 3D scanning, and then sets acupuncture points corresponding to the body surface that has been recognized to project them onto the body. More specifically, the apparatus for displaying acupuncture points comprises: a 3D scanner for performing 3D scanning; a control unit for setting acupuncture points by using the data that has been scanned by the 3D scanner; and a projection unit for projecting the acupuncture points that have been set by the control unit onto the body. Accordingly, the present invention allows accurate selection of acupuncture points on a highly curved surface of a human body.
US09364386B2
A support surface system provides alternating pressure therapy and low air loss therapy simultaneously using a single pump. The system includes a plurality of cells. Each cell has a foam-filled lower chamber and an upper chamber. Fluid communication between the lower and upper chambers is controlled by a normally closed valve that opens if the pressure within the lower chamber exceeds a predetermined threshold pressure. Pressurized air is alternatingly supplied to the lower chambers of a first subset of cells and the lower chambers of a second subset of cells, thereby providing alternating pressure therapy. When the pressure in the lower chamber exceeds the threshold, the valve opens to allow air from the lower chamber to flow into the upper chamber. Air is expelled from the upper chamber through perforations therein, to remove moisture and humidity and possibly reducing the temperature of the micro-climate beneath a patient.
US09364376B2
A simple, adjustable lift system to load a cot bearing a patient into and out of an ambulance and a method of transferring a load on a transport into a vehicle is provided. More specifically, the lift system provides a pair of rails that may be adjusted to accommodate any cot currently in use by an ambulance. The rail system is extendable and is operated by a linear actuator to couple to a cot or other transport and lift the cot or other transport to a height from which the cot may be laterally inserted into the ambulance without undue strain on the EMT, firefighter, or other user.
US09364372B2
Safety glasses verification methods and devices are described herein. One method in accordance with the present disclosure includes capturing an RGB image of an individual, capturing an infrared (IR) image of the individual, and verifying safety glasses are being worn by the individual based on the RGB image and the IR image.
US09364362B2
An implantable device system is disclosed. The implantable device system includes, a first energy transceiver system, a second energy transceiver system at least partially implanted within an organic tissue and capable of communication with the first energy transceiver system, and a sensing system capable of communication with the second energy transceiver system. An implantable device system array is also disclosed. A method of monitoring a physical parameter is also disclosed.
US09364356B2
A system for treating a bifurcation includes first and second delivery catheters. The first catheter has a first shaft, a first expandable member adjacent the distal end of the first shaft, an auxiliary expandable member disposed under the first expandable member, and a first radially expandable stent disposed over both the first expandable member and the auxiliary expandable member. The second delivery catheter has a second shaft, and a second expandable member adjacent the distal end of the second shaft. A portion of the second catheter is disposed under a portion of the first stent, and a portion of the second delivery catheter passes through a side hole in the first stent. The first stent is crimped over the first and second catheters such that the first stent remains attached to the first and the second catheters during advancement of the catheters through a blood vessel.
US09364354B2
A flow reducing implant for reducing blood flow in a blood vessel having a cross sectional dimension, the flow reducing implant comprising a hollow element adapted for placement in the blood vessel defining a flow passage therethrough, said flow passage comprising at least two sections, one with a larger diameter and one with a smaller diameter, wherein said smaller diameter is smaller than a cross section of the blood vessel. A plurality of tabs anchor, generally parallel to the blood vessel wall, are provided in some embodiments of the invention.
US09364353B2
A stent is described, which includes a plurality of stenting rings, each stenting ring including a plurality of struts and points of inflection, each point of inflection connecting adjacent struts, the points of inflection of adjacent stenting rings facing each other along an axis parallel to a longitudinal axis of the stent in a radially expanded stenting disposition while the stent is in an unbent configuration. Adjacent stenting rings are connected by connectors extending from a point of inflection on one stenting ring to a facing point of inflection on another stenting ring, the connectors being linear along an entire length thereof and parallel to the longitudinal axis of the stent, each of the connectors having a length shorter than a length of each of the struts.
US09364344B2
An expandable implant device (100) for insertion between two vertebrae (400) is disclosed. The device (100) has an upper body (20), a lower body (40) and an external retainer band (60). The external retainer band (60) holds the upper body (20) and lower body (40) and has an inner surface having a plurality or set of upper ratchet teeth (80U) sloped for allowing upward movement and a plurality or set of lower ratchet teeth (80L) for allowing downward movement. The ratchet teeth (80) of the upper body (20) are mated or fitted to the upper teeth (80) of the retainer band (60) and the ratchet teeth (82) of the lower body (40) are mated or fitted to the lower ratchet teeth (82) of the retainer band (60). The height of the device (100) is increased by upward movement of the upper body (20) and downward movement of the lower body (40).
US09364342B2
A modular anchor bone fusion cage is provided. The cage includes a spacer configured to fit into a space between the faces of two bones that are to be fused together. A fusion plate having at least a main body portion is coupled to the spacer. Fasteners extend through the fusion plate to engage the bone. At least some of the fasteners also extend through the spacer to engage the opposed faces of the bone. A cover plate is coupled to the fusion plate to inhibit the fasteners from backing out prior to fusion of the bones.
US09364340B2
The present application generally relates to orthopedic systems, and in particular, to systems including independent plates and spacers. A plating system can include a spacer and a plate that is independent from the spacer. A number of locking mechanisms can be provided to secure the plate to the spacer. In some cases, the spacer includes a pair of notches that extend on an outer surface of the spacer. The plate can include a pair of lateral extensions that can engage the notches to secure the plate to the spacer. In other cases, the spacer includes an opening including a pair of inlets. The plate can include an enclosed posterior extension that can be received in the pair of inlets to secure the plate to the spacer.
US09364338B2
A modular nucleus pulposus prosthesis having at least two hingedly connected tear drop shaped disc bodies which combined to form a discoid endoprosthetic disc. The complimentary segments are substantially identical including outer circumferential walls roughly equal to a semi-circle aligned along concave-convex inner wall inner walls forming a common “s” shaped border and are positioned to form a generally symmetrical discoid congruent structure which can be placed within the annulus of a spinal disc section. Disc segments may define structures to support, position and secure the segments to one another intradiscally.
US09364336B2
A prosthetic intervertebral disc and methods for using the same are provided. The subject prosthetic discs are characterized by including top and bottom endplates separated by a fibrous compressible element that includes an annular region and a nuclear region. The two plates are held together at least one fiber wound around at least one region of the top endplate and at least one region of the bottom endplate. The subject discs may be employed with separate vertebral body fixation elements, or they may include integrated vertebral body fixation elements. Also provided are kits and systems that include the subject prosthetic discs.
US09364332B2
The present invention provides a PS-type artificial knee joint implant, with which the gap balance can be adjusted in order to realize a stable deep flexion movement, the burden on a surgeon and a patient can be reduced, and the patient can perform a natural flexion movement. An artificial knee joint implant 1 includes femoral components, one of which is selected and attached to a distal portion of a femur of the patient, and tibial inserts, one of which is selected and attached to a proximal portion of a tibia of the patient. The femoral components have a cam portion that is disposed between posterior portions of two femoral joint faces, respectively. The tibial inserts have posts that can be brought into contact with the cam portion. The posts have different antero-posterior positions.
US09364331B2
A reconfigurable orthopedic implant trial comprising: (a) a first orthopedic component; (b) a second orthopedic component that includes a second sensor on a second articulating surface thereof, the second orthopedic component configured to removably mount to the first orthopedic component; (c) a third orthopedic component that includes a third sensor on a third articulating; surface thereof, the third orthopedic component configured to removably mount to the first orthopedic component, where the second sensor and the third sensor are configured to generate kinematic data.
US09364330B2
The present invention relates to orthopaedic implants having a fenestrated hollow shell and a biologic core. These design features provide an improved interface between the implant and the surrounding tissue, aiding fixation, and provide a vehicle for applying new bone healing and enhancing modalities, such as gene therapy, tissue engineering, and growth factors.
US09364313B2
The invention relates to a medical device for supporting an implant or prosthesis, formed by two parts including one part forming an upper ring (1) which is made from a rigid or semi-rigid solid biocompatible material and another part forming a lower ring (2) which is made from a rigid or semi-rigid, integrable or porous biocompatible material, said device being intended to receive an implant or a removable prosthesis at the upper ring and to be installed in situ by means of the lower ring.
US09364306B2
A medical device having a valve member and a securing member is provided. The valve member is configured to be positioned inside a bodily passageway. The valve member includes a plurality of flaps configured to move from a first position to a second position at a predetermined pressure or in response to being exposed to a predetermined pressure. The securing member is configured to be positioned outside the bodily passageway. The securing member is configured to help retain the valve member in place within the bodily passageway.
US09364303B2
A cleaning section for an electric oral hygiene device is disclosed. The cleaning section includes at least a first carrier mounted for driven rotation or oscillating rotation around a rotation axis; and at least a plurality of first cleaning elements mounted on the first carrier with their bases arranged on the vertices of a first star-shaped polygon around the rotation axis. All of the first cleaning elements are inclined in a circumferential direction such that the free end of each of the first cleaning elements is farther away in the circumferential direction than the base of the respective first cleaning element; and wherein at least one cleaning element property alternates between adjacent first cleaning elements or between clusters of first cleaning elements.
US09364297B2
Method and system for detecting and correcting deviation during an orthodontic treatment plan is provided. The method includes the steps of receiving an un-segmented current teeth image representing a patient's teeth after an orthodontic treatment plan has begun and before the plan ends for the patient; matching a previously segmented teeth model with the current teeth image; and generating at least one corrective stage to define an intermediate tooth arrangement, wherein the at least one corrective stage repositions a digital teeth image so that a prescribed tooth arrangement of the previously segmented teeth model can be used.
US09364296B2
The present disclosure provides computing device implemented methods, computing device readable medium, and molds for filling undercut areas of teeth relative to an axis of placement. Filling undercut areas of teeth relative to an axis of placement can include calculating an undercut area of a tooth relative to an axis of placement of part of a dental appliance over a number of teeth and a height of contour that is defined based on the axis of placement. Filling undercut areas of teeth relative to an axis of placement can also include filling in a part of the undercut area of the tooth with a virtual filler wherein the undercut is filled to within a threshold distance from the tooth that is defined relative to the axis of placement and the height of contour.
US09364295B2
A clamping device for a dental tool in a dental turbine handpiece having at least one clamping lever that is supported in a fulcrum and that extends along the axis of a tool shank to be clamped, wherein the clamping lever is designed and arranged such that the tool shank can be clamped using the clamping lever and that on rotation of the clamping device, through the effect of the centrifugal force, the clamping lever is radially deflected about the virtual fulcrum, so as to increase the clamping force acting on the tool shank.
US09364294B2
Presented herein are methods, systems, devices, and computer-readable media for image management in image-guided medical procedures. Some embodiments herein allow a physician to use multiple instruments for a surgery and simultaneously provide image-guidance data for those instruments. Various embodiments disclosed herein provide information to physicians about procedures they are performing, the devices (such as ablation needles, ultrasound transducers or probes, scalpels, cauterizers, etc.) they are using during the procedure, the relative emplacements or poses of these devices, prediction information for those devices, and other information. Some embodiments provide useful information about 3D data sets and allow the operator to control the presentation of regions of interest. Additionally, some embodiments provide for quick calibration of surgical instruments or attachments for surgical instruments.
US09364291B2
Described are computer-based methods and apparatuses, including computer program products, for implant planning using areas representing cartilage. A predetermined number of control points for generating a predetermined number of areas representing cartilage are determined, wherein the predetermined number of control points are based on an implant component. Measurements corresponding to a plurality of measured cartilage points are received, wherein each cartilage point is based on an associated control point from the predetermined number of control points. A plurality of areas representing cartilage are generated, wherein each area representing cartilage is larger than and projects to an associated control point from the plurality of control points. A representation of the implant component is positioned based on a representation of a bone, the representation of the bone comprising representations of the plurality of areas representing cartilage.
US09364288B2
An apparatus for delivering electrical power to an electrically powered medical device includes a battery, a first compartment, and a second compartment where the second compartment can hold the first compartment and the first compartment can hold the battery. A sterile space is defined between the first compartment and the second compartment. The first compartment and the battery may be selectively electrically coupled with the electrically powered medical device such that the first compartment does not compromise the sterility of the electrically powered medical device.
US09364278B2
A surgical instrument includes a reusable component and a limited-use component releasably engagable with the reusable component. The limited-use component is configured for one or more uses and includes a clocking mechanism configured to count each engagement of the reusable component and the limited-use component to one another. The clocking mechanism is incrementally transitionable upon each successive count from one or more uses state, wherein the clocking mechanism permits both mechanical engagement and electrical coupling of the reusable component and the limited-use component to one another, to a spent state, wherein the clocking mechanism inhibits both mechanical engagement and electrical coupling of the limited-use component and the reusable component to one another.
US09364269B2
Interspinous process implants are disclosed. Also disclosed are systems and kits including such implants, methods of inserting such implants, and methods of alleviating pain or discomfort associated with the spinal column.
US09364261B2
A new and useful apparatus and method are provided for removing a foreign object from a rectal cavity. An anoscope is configured for insertion through the anus into a rectal cavity. The anoscope has a base and introducer with guides that route flexible members and a flexible sheath that are carried by actions of the operator through the anoscope beyond the guide and further into a rectal cavity and to expand about a foreign object in the rectal cavity. The anoscope also carries a noose that is manipulatable from outside the patient's rectal cavity to tighten and stricture the flexible sheath above the foreign object and capture the foreign object within the flexible sheath, so that the foreign object can be manipulated by the noose and the flexible sheath to remove the foreign object from the rectal cavity once the anoscope and flexible ribs are removed from the anus.
US09364243B2
An angular adjustment mechanism for a surgical instrument is described. The mechanism comprises an adjustment member (102) configured for rotation about a longitudinal axis (122), the adjustment member comprising a plurality of pairs of facets (134) arranged about the longitudinal axis. Each of the plurality of pairs of facets defines a respective angled axis (148B,148C) at an angle (150B,150C) relative to the longitudinal axis. A pivoting member (104) is arranged to pivot about a pivot axis perpendicular to the longitudinal axis and comprises a recess (128) for receiving the adjustment member and engaging one pair of the plurality of pairs of facets. This provides an angular adjustment mechanism in which facets on the outside of the adjustment member engage corresponding surfaces in a recess on a pivoting member. The use of facets provides a secure connection while allowing a greater degree of angular adjustment and providing a further benefit of simple operation.
US09364240B2
An apparatus for application of surgical clips to body tissue has a handle portion; a body extending distally from the handle portion; a plurality of surgical clips disposed within the body; and a jaw assembly mounted adjacent a distal end portion of the body. The jaw assembly includes first and second jaw portions movable between a spaced-apart and an approximated position. The apparatus also has a wedge plate longitudinally movable between the first and the second jaw portions, a clip pusher configured to individually distally advance a surgical clip to the jaw assembly while the jaw portions are in the spaced apart position; an actuator at least partially disposed within the body and longitudinally movable in response to actuation of the handle portion; and a jaw closure member positioned adjacent the first and second jaw portions to move the jaw portions to the approximated position.
US09364235B2
A surgical instrument including a power assist device, and its method of use for deploying surgical fasteners, is disclosed. The surgical instrument may include a handle, an elongated shaft extending from the handle, and a surgical fastener deployment system including a driveshaft. The driveshaft is actuatable between at least a first proximal position and a second distal position. A striker is movable relative to the driveshaft and an impact surface is associated with the driveshaft. The impact surface is constructed and arranged to be struck by the striker member to displace the driveshaft to the second distal position and deploy the surgical fastener.
US09364233B2
Tissue thickness compensators for use with circular surgical staplers. Various tissue thickness compensators are disclosed for deployment between a stapler head of a surgical circular stapler and an anvil attached thereto to accommodate variances in tissue thickness during stapling. Some tissue thickness compensator arrangements include means and configurations for deploying healing agents for enhancing the healing process.
US09364218B2
A surgical device is disclosed which includes a handle assembly, an elongated member and a disposable loading unit. The handle assembly includes a mode selection mechanism configured to alternate the surgical device between a first grasping mode of operation and a second clamping mode of operation. The handle assembly includes a rotation control member and an articulation lever. The rotation control member is configured to facilitate rotation of the elongated member with respect to the handle assembly. The articulation lever is configured to facilitate articulation of the tool assembly about an axis substantially perpendicular to the longitudinal axis of elongated member. In one embodiment, the tool assembly includes a cartridge assembly having a plurality of staples and an anvil assembly configured to clamp and staple tissue in the second clamping mode of operation of the device.
US09364214B2
A surgical instrument for manipulating suture within a patient. The surgical instrument includes a short cannulated handle and a cannulated shaft having a curved configuration. A Nitinol loop is inserted through the cannulation of the instrument for passing and shuttling suture through tissue. The curved shaped of the instrument allows it to be introduced into the shoulder for rotator cuff repair, for example, using the Neviaser Portal.
US09364190B2
A mammograph is provided. The mammograph includes a source of X-rays; a detector of X-rays, the source being configured to emit at least one beam of X-rays to the detector; and an optic control device configured to control the direction of X-rays emitted by the source such that the X-rays emitted by the source are substantially parallel to one another.
US09364188B2
With an X-ray apparatus for round visit of this invention, when a brake operation is carried out, a CPU performs deceleration control (braking current control at c and short brake control at e) of a movable carriage instead of immediately driving electromagnetic brakes, and drives the electromagnetic brakes at time f. Therefore, a great shock does not occur to the apparatus, and there is no possibility of the operator colliding with the apparatus. Since the deceleration control of the movable carriage is carried out in advance, the apparatus does not stop suddenly and does not impair the floor. As a result, the X-ray apparatus for round visit is realized, in which no great shock occurs to the apparatus at times of deceleration, and which is also safe for the operator.
US09364187B2
A CT system includes a gantry having an opening for receiving an object to be scanned, an x-ray tube attached to the gantry, and a detector assembly. The detector assembly is positioned to receive x-rays that pass through the object and includes a light-sealed enclosure formed by at least first and second rails, a back support, and a light seal structure, and a plurality of liquid-cooled modules positioned in the enclosure. Each module includes a digital cable that passes from inside the enclosure, and each module is configured to convert the x-rays to a digital signal and output the signal via a digital cable.
US09364180B2
Automated methods provide hypopnea detection for determining a hypopnea event and/or a severity of a hypopnea event. In some embodiments, a calculated short-term variance of a measured respiratory flow signal are compared to first and second proportions of a calculated long-term variance of the measured flow signal. A detection of the hypopnea may be indicated if the first measure falls below and does not exceed a range of the first and second proportions during a first time period. In some embodiments, a hypopnea severity measure is determined by automated measuring of an area bounded by first and second crossings of a short-term measure of ventilation and a proportion of a long-term measure. The detection methodologies may be implemented for data analysis by a specific purpose computer, a detection device that measures a respiratory airflow or a respiratory treatment apparatus that provides a respiratory treatment regime based on the detected hypopneas.
US09364179B2
Provided is a non-invasive system and method for determining a target glycogen score value for a target muscle and potentially at least one indicator muscle. The method includes receiving an ultrasound scan of a target muscle; evaluating at least a portion of the ultrasound scan to determine glycogen store value within the target muscle; recording the determined glycogen store value for the muscle as an element of a glycogen value data set for the muscle; evaluating the glycogen value data set to determine a value range; and in response to the range being at least above a pre-determined threshold, establishing a target score for the muscle as based on an upper portion of the value range. The method may be repeated to identify ranges for a plurality of muscles, the muscle with the greatest range being identified as an indicator muscle. An associated system is also disclosed.
US09364175B2
A method and apparatus for non-invasively determining a blood oxygen saturation level within an organ of a subject using direct application of a near infrared spectrophotometric sensor is provided. The method includes the steps of: a) transmitting a light signal directly into the subject's organ using the sensor; b) sensing a first intensity of the light signal and a second intensity of the light signal, after the light signal travels a predetermined distance through the organ of the subject; c) determining an attenuation of the light signal along multiple different wavelengths using the sensed first intensity and sensed second intensity; d) determining a difference in attenuation of the light signal between wavelengths; and e) determining the blood oxygen saturation level within the subject's organ using the difference in attenuation between wavelengths.
US09364173B2
Systems and methods for dynamically and intelligently estimating analyte data from a continuous analyte sensor, including receiving a data stream, selecting one of a plurality of algorithms, and employing the selected algorithm to estimate analyte values. Additional data processing includes evaluating the selected estimative algorithms, analyzing a variation of the estimated analyte values based on statistical, clinical, or physiological parameters, comparing the estimated analyte values with corresponding measure analyte values, and providing output to a user. Estimation can be used to compensate for time lag, match sensor data with corresponding reference data, warn of upcoming clinical risk, replace erroneous sensor data signals, and provide more timely analyte information encourage proactive behavior and preempt clinical risk.
US09364169B2
An apparatus for in-situ sensing of longitudinal and transverse strain in biological tissue (e.g. tendons and ligaments) includes a set of sensing electrodes that contact biological tissue and enable measurement of an electrical property of the biological tissue along two or more directions. The apparatus may also include a sensing module that senses the electrical property of the biological tissue along the two or more directions to provide multi-directional measurements that are captured by a logging module. The apparatus may also include a transmission module that transmits the captured measurements to a data analysis workstation or the like. The data analysis workstation may include a strain estimation module that receives the multi-directional measurement and estimates a longitudinal strain and a transverse strain therefrom. A corresponding system and method for in-situ sensing of longitudinal and transverse strain in biological tissue is also presented.
US09364168B2
A method of diagnosing an air leak in a lung compartment of a patient may include: advancing a diagnostic catheter into an airway leading to the lung compartment; inflating an occluding member on the catheter to form a seal with a wall of the airway and thus isolate the lung compartment; measuring air pressure within the lung compartment during multiple breaths, using the diagnostic catheter; displaying the measured air pressure as an air pressure value on a console coupled with the diagnostic catheter; and determining whether an air leak is present in the lung compartment based on the displayed air pressure value during the multiple breaths.
US09364163B2
Methods of analysis to extract and assess brain data collected from subject animals, including humans, to detect intentional and unintentional brain activity and other unexpected signals are disclosed. These signals are correlated to higher cognitive brain functions or unintended, potentially adverse events, such as a stroke or seizure, and to translation of those signals into defined trigger events or tasks.
US09364159B2
The invention relates to a material for the detection of biological electro-magnetic signals made of a epidermis of a living organism and a diagnostic device using the same, and more particularly, to a material for the detection of biological electro-magnetic signals made of a epidermis of a living organism, through drying is one stage, also selecting is another stage of production, and a diagnostic device using the same. The material of the invention has an effect of detecting biological electro-magnetic signals. Accordingly, the material for the detection of biological electro-magnetic signals of the invention can be used for manufacturing a diagnostic device for detecting biological electro-magnetic signals non-invasively as well as effectively used in diagnosis in cases where biological electro-magnetic signals are changed by cancer, inflammations due to immunodeficiency and so on.
US09364155B2
Physiological monitoring can be provided through a wearable monitor that includes two components, a flexible extended wear electrode patch and a removable reusable monitor recorder. The wearable monitor sits centrally (in the midline) on the patient's chest along the sternum oriented top-to-bottom. The placement of the wearable monitor in a location at the sternal midline (or immediately to either side of the sternum) benefits extended wear by removing the requirement that ECG electrodes be continually placed in the same spots on the skin throughout the monitoring period. Instead, the patient can place an electrode patch anywhere within the general region of the sternum. Power is provided through a battery provided on the electrode patch, which avoids having to open the monitor recorder's housing for battery replacement. The monitor further includes sensors for monitoring patient's air flow and respiratory measures contemporaneously with the ECG monitoring.
US09364154B2
This document discusses, among other things, a system comprising a sensor signal processor configured to receive a plurality of electrical sensor signals produced by a plurality of sensors and at least one sensor signal produced by an implantable sensor, a memory that includes information indicating a co-morbidity of a subject, a sensor signal selection circuit that selects a sensor signal to monitor from among the plurality of sensor signals, according to an indicated co-morbidity, a threshold adjustment circuit that adjusts a detection threshold of the selected sensor signal according to the indicated co-morbidity, and a decision circuit that applies the adjusted detection threshold to the selected sensor signal to determine whether an event associated with worsening heart failure (HF) occurred in the subject and outputs an indication of whether the event associated with worsening HF occurred to a user or process.
US09364153B2
Devices, systems, and methods for visually depicting a vessel and evaluating treatment options are disclosed. The methods can include obtaining pressure measurements from first and second instruments positioned within a vessel of a patient while the second instrument is moved longitudinally through the vessel from a first position to a second position and the first instrument remains stationary within the vessel; and outputting a visual representation of the pressure measurements obtained by the first and second instruments on a display, the output visual representation including a graphical display of a pressure ratio of the obtained pressure measurements and at least a portion of a pressure waveform of the obtained pressure measurements identifying a diagnostic period utilized in calculating the pressure ratio.
US09364148B2
Embodiments of the invention are generally directed to apparatus and methods for measuring a deformation characteristic of a deformable target surface. The measurement principles of the invention may be applied to a large variety of organic (e.g., human, animal or plant tissue) and inorganic materials having a surface that can be deformed by an applied non-contact force. The surface may be light diffusing and non-transparent or non-diffusing and transparent. An illustrative embodiment of the invention is directed to a device for measuring a deformation characteristic of a cornea. The device comprises a corneal topographer and a non-contact tonometer that is operationally integrated with the corneal topographer. In an aspect, the corneal topographer is a rasterstereography-based topographer. Use of the inventive device enables a method for measuring a deformation characteristic of the cornea. In addition to the measurable deformation characteristics listed above, dioptric power, intraocular pressure, corneal hysteresis, corneal elasticity, corneal viscosity and various known corneal topography characteristics can be measured.
US09364144B2
The eye is illuminated by a variable laser light source with a measurement range corresponding to the eye length, wherein the focus of the laser beam in the eye can be shifted laterally and/or axially by an adjustment mechanism, and the light fractions back-scattered from the sample are captured via an interferometer by a data acquisition unit and forwarded to a data processing unit. In the data processing unit, an OCT whole-eye scan is combined with at least one or several further overlapping tomographic part-eye or whole-eye scans. Reference information is used to register the first whole-eye scan with the further part-eye or whole-eye scans, and the combined whole-eye scan is evaluated and/or displayed on a user surface.
US09364137B2
Positioning precision between an image-acquisition device and an objective lens is enhanced by suppressing manufacturing errors. Provided is an endoscope image-acquisition unit equipped with an objective-lens-unit frame that holds an objective lens and an image-acquisition-device holding frame that is fitted to the objective-lens-unit frame and that holds an image-acquisition device, wherein the objective-lens-unit frame and the image-acquisition-device holding frame are attached and secured to each other by means of thermosetting resin that is applied to fitting portions therebetween and in which polar-molecule materials are mixed, and one of the objective-lens-unit frame and the image-acquisition-device holding frame, whichever one is positioned outside at the fitting portions, is formed of a material that allows microwaves to pass therethrough.
US09364136B2
A pole cleaning apparatus comprises an elongate handle portion engaged with a cleaning head. In certain embodiments, the cleaning head has a width shaped as a partial-tubular member and an opening extending along the longitudinal axis through which a pole is passed to engage the cleaning head with the pole to be cleaned. The cleaning head may include an inner arcuate surface configured to at least partially surround the pole. The apparatus also includes a mounting assembly designed to pivotably engage the cleaning head to the handle portion such that the handle portion is pivotable with respect to the cleaning head in at least one plane containing the longitudinal axis. Optionally, the apparatus may include a cleaning pad selectively engageable with the cleaning head.
US09364134B2
A dishwasher includes a cabinet; a washing tub provided at an inside of the cabinet; a sump provided at a lower side of the washing tub to store wash water; a heater to heat the wash water; a spray nozzle configured to spray the heated wash water that is pumped from the sump toward inside of the washing tub; and a door configured to open and close a front of the washing tub, the door including a drying device configured to cool high-temperature/high-humidity air from the washing tub and then to discharge the cooled air outside of the dishwasher. The drying device includes a condensation duct to condense the high-temperature/high-humidity air from the washing tub; a first fan to draw in air from the washing tub to the condensation duct; and a second fan to draw in external air to the condensation duct.
US09364119B2
The present disclosure is directed to an absorbent pad having an active agent to preserve food products or other perishable merchandise, that has a pad architecture, including the specific arrangement of the absorbent layers and active agents in the absorbent pad, that affects the availability and timing of release of the active agents to preserve the freshness of food products that are stored at home by a consumer in the consumer's own food storage containers.
US09364116B2
A modular beverage brewing apparatus comprising a removable hot water producing module, a removable pressurized hot water producing module, and a removable steam producing module all connected to a remote dispensing liquid beverage dispensing unit.
US09364113B2
A lighted inflatable display including a body made of flexible fabric that is semipermeable to the passage of air through the fabric, at least one divider panel that partitions an interior space within the body into a plurality of chambers, a pressurized air source configured to discharge pressurized air into the body, and a plurality of cooperatively controlled decorative lights disposed inside each chamber, wherein the at least one divider panel reduces light transmission between chambers and includes an aperture permitting passage of pressurized air and an electrical power cord sequentially from a base portion of the inflatable display to each of the chambers.
US09364112B2
This invention is a secure and portable apparatus and is of parcel bag-type receptacle that can be placed for a limited time, outside a front-door or place of access to a mail carrier. The apparatus can be securely connected to a pre-existing doorknob of the front door or pre-existing door handle on or near the front door for a mail carrier to deliver a package, lock up the parcel bag, so that only the resident or authorized recipient can access the parcel upon their return. The locking mechanism in the parcel bag is one-way, thereby, once locked; even the package delivery person will not be able to access the package. The secure storage system neither damages nor requires any permanent alterations to the property structures at or near the front-door. It is portable and can be carried along during one's travel.
US09364107B2
A liquid container includes a cup having a brim forming an opening into an interior region of the cup. The container also includes a lid configured to mount on the brim of the cup to close the opening.
US09364103B2
A shelving system attachable to a shelf to provide one or more storage areas on the shelf. The shelving system includes a shelf assembly configured for attachment to the shelf and one or more divider walls configured for attachment to both the shelf assembly and the shelf. Each of the divider walls is separated a distance from another of the divider walls to provide a storage area therebetween on the shelf. A variety of differently sized divider walls can be used with the shelving system.
US09364085B2
A wine rack for mounting on a wall or other surface, the wine rack including at least a first and second pair of support members. In one embodiment, the first pair of support members may support at least a first and a second wine bottle in a substantially parallel relation to the wall, wherein the second bottle is positionable proximate the wall, and wherein the label of the first wine bottle is visible to a person standing in front of the wine rack.
US09364083B2
An adjustable shelving assembly includes at least two support rails, at least one geared rack provided in each of the at least two support rails, and an actuating mechanism placed adjacent to the at least one geared rack. The actuating mechanism is configured to support at least one shelf and facilitates movement of the at least one shelf along the at least two support rails. The actuating mechanism includes a pinion mating with the at least one geared rack, a plurality of permanent magnets mounted coaxially inside the pinion, ferromagnetic disks provided on either ends of the pinion, and a shaft placed axially in the pinion, connecting the permanent magnets. The permanent magnets magnetize or demagnetize the ferromagnetic disks when the shaft is rotated for locking or unlocking the at least one shelf.
US09364079B2
A folding keyboard height extender with a top plate, a bottom plate, and a right and left side hinged side arrangements. Each hinged side arrangements has an upper plate and a lower plate that are hinged to each other and between the left and right side edges of the top and bottom plates. A folding shear lock plate is hingeably attached to an underside of the top plate. In a first extended state, the right and left side hinged side arrangements form tall and straight walls, and the shear lock plate is swung down perpendicular to the top bottom plates and to the right and side hinged side arrangements. In a second lowered state, the upper and lower plates of the right and left side hinged side arrangements fold out away from the top and bottom plates lay flat against each other, and the shear lock plate is folded up and is sandwiched between the top plate and bottom plate.
US09364077B2
Portable furniture items including a support structure and a top member selectively coupled to the support structure. The support structure includes first and second supports. The first support includes a leg having a ground end and a waist extending from the leg opposite the ground end. The waist has an upper end opposite the ground end and defines a first notch proximate the upper end. The second support includes a leg having a ground end and a waist extending from the leg opposite the ground end. The waist of the second support has an upper end opposite the ground end and a lower end opposite the upper end and defines a second notch proximate the lower end. The first notch and the second notch are complimentarily configured to enable the second support to matingly couple with the first support.
US09364072B2
A backpack and frame are disclosed. The backpack frame is designed to be at least partially internal and is of unitary construction, most advantageously of a resin-impregnated material, such as resin-impregnated carbon fiber sheets with selective reinforcement by interstitial layers. The frame has a mid-back portion that includes openings for independently positionable shoulder straps and a lower back portion that provides for a rotatable connection to a belt assembly. A pair of curved stay portions is contiguous with the mid-back portion of the frame and curves outwardly as the stay portions extend downwardly. The frame is preferably curved to match the curvature of the human back. The backpack frame is lightweight and by use of composite materials can provide strength as well as selective flexibility to suspend the load of the backpack and decouple it from the movements of the wearer.
US09364068B2
A hair-root applicator (10) of the present invention includes: a comb-teeth part (13) in which a plurality of comb teeth (12) are erected from a surface of a comb-teeth base (14); and a container (11) for containing a hair dye as a coating agent. This hair-root applicator is an applicator capable of applying, to hair-root sections of the hair, the hair dye supplied from the container (11) to the comb teeth (12). Each comb tooth (12) includes a comb-tooth body part (15) having a function of combing the hair, and a tip-end elastically deformable part (16) that is provided contiguously to the tip end of the comb-tooth body part (15) and that is made of a soft resin. A liquid introduction path (17) for the coating agent is provided inside the comb-tooth body part (15). A discharge port (17a) of the liquid introduction path (17) is opened so as to be arranged in the vicinity of the tip-end elastically deformable part (16).
US09364063B1
An electronically secured money belt has a pouch attached to an elongated waist band and an electronic control circuit. The elongated waist band includes a wire mesh circuit electrically coupled to the electronic control circuit whereby damaging one or more wire elements of the wire mesh circuit causes the electronic control circuit to activate an audible alarm. In some embodiments, pouch includes a closure, such as a snap, button, or zipper that doubles as an electronic switch electrically coupled to the electronic control circuit. The closure closes the electronic control circuit to activate the security system. A master switch is located on the waistband and is electrically coupled to the electronic control circuit. The master switch is operable to activate or deactivate said electronic control circuit and therefore the security system. A magnet-attachable accessory engages a magnet on the belt to provide an auxiliary means to activate the security system.
US09364061B2
An apparatus is disclosed, the apparatus including a primary storage cavity, an expandable and collapsible secondary storage cavity, and at least one pair of rigid reinforcing structures contained within the secondary storage cavity. In some embodiments, the apparatus is a handbag, purse, tote, or clutch. In addition, a handbag is disclosed, the handbag including a primary storage cavity, an expandable and collapsible secondary storage cavity, at least one pair of rigid reinforcing structures contained within the secondary storage cavity, and a fastening mechanism configured to fasten the materials defining the secondary storage cavity in a collapsed position.
US09364060B2
In one embodiment of the invention, a multiple mode portable wheeled backpack includes: a backpack section and an extended trailing section that is removably coupled to the backpack section, wherein the extended trailing section includes a plurality of wheels.
US09364048B2
A cutting die for cutting a plurality of parts of an article of footwear from a bulk material. The cutting die includes a first cutting member that cuts a first part of the article of footwear from the bulk material. The cutting die also includes a second cutting member that cuts a second part of the article of footwear from the bulk material. The second cutting member is fixed to the first cutting member to cut the first and second parts together with a single stroke of the cutting die relative to the bulk material. The first and second parts are separate and distinct from each other and have different shapes.
US09364047B2
A traction overshoe which enables a user to safely cover the footwear while sitting or standing. The traction overshoe has left side flaps, right side flaps and a tension cord system. The left side flaps and the right side flaps are contiguous with the front and back supports of the traction overshoe and a tension cord system is attached to the right side flaps and the left side flaps. In use, a user grips a bottom grip-bar and moves the left side flaps and the right side flaps into vertical positions. The user then slips the footwear into the device and moves the bottom grip-bar in an upward position to secure the left side flaps and the right side flaps against the footwear.
US09364035B1
An adjustable clothing garment is provided. A clothing item shaped to cover at least a portion of a wearer's body and having attached on a bottom edge, a series of snaps is provided. A connecting clothing item having a substantially circular shape with a series of snaps affixed on a top edge that correspond with the series of snaps on the clothing item is provided.
US09364031B2
A brassiere formed of an inner garment base, memory foam, a pair of under supports, and an outer fabric cover. The under support is preferably formed from a piece of plastic material having rigidity from the distal edge to the proximal edge, flexibility and varying width from a medial end to a lateral end, and differing radii to accommodate the bottom portion shape of a breast implant, which is not a perfect semi-circle. The under support is set on a coronal plane to cradle, support, and hold the implant. The set positioning of the under support is such that the foam will encapsulate the under support keeping the proximal edge in proximity with bottom portion of the implant and the ribs. The under support has its largest width, thereby the largest contact surface with the implant, closest to the lateral end causing the implant to be supported upward and medially.
US09364027B2
An electronic cigarette comprises nicotine without harmful tar. The cigarette includes a shell, a cell, nicotine solution, control circuit, and an electro-thermal vaporization nozzle installed in the air suction end of the shell. The advantages of the present invention are smoking without tar, reducing the risk of cancer, the user still gets a smoking experience, the cigarette is not lit, and there is no fire danger.
US09364020B2
A process for automated high-throughput fruit or vegetable calyx removal includes a material handling system, a vision system, and a cutting system. The material handling system is capable of transporting the fruit or vegetable through the automated process. The material handling system may also orient the fruits or vegetables along an axis of the fruit and or align the fruit or vegetables in a desired pattern, orientation, and/or configuration. The vision system identifies the calyx and determines calyx position data and optimal cutting angle for individual fruit. The cutting system uses data received from the vision system to automatically remove the calyx from the fruit or vegetables.
US09364015B2
Described herein are products comprising a xylose (e.g., D-xylose or L-xylose and another sweetener such as glucose). Exemplary products include the following: ice cream, ice milk, sorbet, sherbet, gelatin candies, baby food, animal food, e.g., dog, cat, canine, or equine food, seasonings, sauces, cosmetics, dietary supplements, lip stick, lip gloss, face and body preparations, pharmaceuticals, such as flu and cold preparations, nutraceuticals, surgical preparations, procedure preparations, imaging preparations, e.g., CT scan imaging preparations, pain relievers, nasal spray, cheese, vegetables, mayonnaise, mustard, salad dressings, nuts and nut mixes, cookies, pastries, fruit flavored snacks, pancakes, waffles, hot cocoa mix, caramel, shampoo, dental floss, donuts, egg noodles, lollypops, frozen pops, soda pop, chips, potato chips, tortilla chips, corn chips, sports drinks, rice cakes, oatmeals, teas, cereals, rice mixtures, flavored water, alcohol, alcohol mixers, soaps, energy drinks, coffee, coffee flavored drinks, coffee products, cake mixes, chili, chip dip, chip sauces, fibers, such as cellulosic and lignocellulosic fibers and fiber supplements, meats, e.g., deli meats, drink mixes, pasta, meals ready to eat, coconut water, candies, e.g., hard and soft candies, chocolate, candy bars, sports bars and energy bars. In embodiments, the xylose containing product is made using a method described herein. For example, the xylose is produced from a biomass described herein.
US09364009B2
The present invention relates to a method for skinning sausages or other food products, wherein an initial cut is made on a front end of said sausage, particularly in the region of an end-side tapering of the sausage, the skin is grabbed in the region of the initial cut at two points located at a distance from each other in the circumferential direction by means of two gripping elements, wherein the skin is particularly pulled onto a plane in a planar manner by a first working movement, particularly onto the contact surface of the sausage, the skin is cut parallel to the longitudinal extension of the sausage starting at the initial cut in the region between the gripping elements, the skin is lifted up away from the plane by a working movement of the gripping elements, and the sausage is conveyed parallel to the longitudinal extension thereof, particularly relative to the position of the gripping elements holding the sausage in a lifted position, and the skin is thus pulled off the sausage.
US09364004B2
A method of increasing the probability and rate of seed germination, increasing vegetative biomass, and increasing water uptake in seeds, in which a seed is introduced to an effective concentration of carbon nanomaterial. The effective concentration of carbon nanomaterial is 10-200 μg/mL.
US09364003B2
This invention relates generally to improved methods and herbicidal glyphosate compositions for use in controlling the growth of weeds and unwanted vegetation, and particularly for use in controlling weeds in a crop of transgenic glyphosate-tolerant cotton plants by over-the-top, foliar application of a herbicidal glyphosate formulation.
US09364002B2
The present invention provides compounds and compositions for attracting or repelling sap-sucking insects, such as whitefly, as well as methods for using such compositions.
US09364001B2
A quaternary fungicide mixture for controlling diseases of turfgrass and/or ornamentals.
US09363992B2
The present disclosure is directed to hydrazinyl lipidoids, formulations thereof further comprising at least one active agent, as well as methods of delivering the at least one active agent to a target organism.
US09363987B2
A line roller basically includes a bearing member and a guide member. The bearing member includes: an inner race having a cylindrical shape; an outer race having a cylindrical shape and a plurality of rotting elements. The outer race is disposed on an outer peripheral side of the inner race. The rolling elements are circumferentially aligned at intervals between the inner race and the outer race. The guide member is made of a material of the same kind as that of the outer race. Further, the guide member is a tubular member having a guide surface for guiding a fishing line on the outer peripheral surface thereof. The guide member is firmly fixed to the bearing member on the outer peripheral surface of the bearing member.
US09363983B2
A system (20) for measuring relative front (12, 13) and hind leg (16, 17) positions of a standing ungulate, the system including a sensing area within which an ungulate to be measured stands and which comprises a plurality of discrete linear sensor regions (30) spaced a known distance apart within the sensing area, each sensing region having a sensor operatively associated therewith, which sensor is responsive to the presence of the lower part of a leg within a sensing region and; a processor for receiving data from each sensor, identifying those sensor regions within which a lower part of a leg is present and based upon the distance between the identified sensor regions, determining the relative front and hind leg positions.
US09363966B2
The invention relates to the soybean variety designated 01051039. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01051039. Also provided by the invention are tissue cultures of the soybean variety 01051039 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01051039 with itself or another soybean variety and plants produced by such methods.
US09363965B2
The invention relates to the soybean variety designated 01051014. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01051014. Also provided by the invention are tissue cultures of the soybean variety 01051014 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01051014 with itself or another soybean variety and plants produced by such methods.
US09363961B1
A novel maize variety designated PH25M2 and seed, plants and plant parts thereof. Methods for producing a maize plant that comprise crossing maize variety PH25M2 with another maize plant. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into PH25M2 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby. Hybrid maize seed, plant or plant part produced by crossing the variety PH25M2 or a locus conversion of PH25M2 with another maize variety.
US09363954B2
The invention relates to an apparatus for transporting and dispersing solid particles into the earth's stratosphere, comprising a conduit connecting a substantially ground level location to an elevated location, a particle transport means, and a deagglomeration means coupled with a dispersal means, wherein the deagglomeration means and dispersal means are located at an elevated location, and to a method of transporting particles of high refractive index into the stratosphere as well as to an aircraft and to a cloud thus formed.
US09363952B2
Provided is a hangable container including a shell with a bottom portion and a top rim spaced from the bottom portion, the shell having an inner and an outer surface and defining a basin of the container. The container also including a hollow stem extending from the inner surface of the shell and having a first end associated with the bottom portion and a second, free end, remote from the bottom portion formed with an articulation member; and a catch provided at an inner portion of the hollow stem adjacent the first end, the catch being configured for engagement with an articulation member of a corresponding container.
US09363951B2
A plant-cultivating method is provided which comprises a red light irradiation step (A) and a blue light irradiation step (B), wherein the step (A) and the step (B) are independently carried out for a predetermined period of time under cultivation conditions such that a fertilizer is used at each of the step (A) and the step (B), of which at least the fertilizer used at the step (B) is applied in the form of a nutritious liquid containing fertilizer ingredients and further an increased amount of dissolved oxygen, which nutritious liquid is prepared by adding oxygen therein. Preferably, a nutritious liquid is applied at each of the step (A) and the step (B), and the nutritious liquid applied at the step (B) contains dissolved oxygen at a content higher than that in the nutritious liquid applied at the step (A).
US09363950B2
The invention relates to a comminuting device (1) for comminuting vegetable material (8, 18). The comminuting device has a frame (2) which can be coupled to a vehicle (4) by means of a coupling element (20), a rotor (5) which is rotatably suspended in the frame (2) and provided with treatment elements (6), and a stator (7) which is attached to the frame (2) and provided with counter elements (13). In an operating position, this stator (7) is situated near a part of the circumference of the rotor (5) so as to leave clear another part of the circumference of the rotor (5) to which organic material (8) to be comminuted can be supplied. The vegetable material (8) is comminuted by rotating the treatment elements (6) and the counter elements (13) with respect to one another. The invention also relates to methods for comminuting vegetable material (8, 18) which is aboveground and/or belowground.
US09363949B2
A grip for a backpack-type air blowing machine which performs a work by using air discharged from a distal end of an air blowing pipe that is coupled to a blower body driven by a power source while the air blowing pipe is manipulated by an operator with the power source and the blower body being carried on a back of the operator. The grip comprises a base section that constitutes an attachment section to the air blowing pipe, a vertical grip section that is provided with a proximal end portion provided continuously to the base section, and that extends in a direction away from the air blowing pipe, and a lateral grip section that extends backward along the air blowing pipe from a free end of the vertical grip section. The lateral grip section is located adjacent to a back of a hand of the operator holding the air blowing pipe.
US09363942B2
A run selection mechanism is provided for selectively directing the flow of particulate material from an air cart. The mechanism includes a chute for receiving metered particulate material. The chute has an output. A first primary conduit has an output communicating with a first pneumatic primary run and a second primary conduit has an output communicating with a second pneumatic primary run. A selector selectively directs the metered particulate material to one of the output of the chute, the first pneumatic primary run and the second pneumatic primary run.
US09370115B2
A PLC unit comprises a control unit that includes a first surface of a substantially rectangular shape, where a unit-side connector is provided on a second surface that is a back surface side of the first surface, a base that includes a fixing surface having a base-side connector connected to the unit-side connector provided thereon, where a plurality of the control units are fixed on the fixing surface side by side in a lateral direction of the first surface, and a duct that is provided along a side part of the control unit on a longitudinal direction side of the first surface so as to be closer to the base side, wherein at least a part of the first surface of the control unit is constituted by a cover which is rotatably supported about an axis substantially parallel to the lateral direction of the first surface, and is openable in an area opposite to the base.
US09370114B1
A low profile accessory attachment mechanism suitable for attaching an accessory to an electronic device is disclosed. A straight hook and a curved hook are configured to mechanically engage slots in an electronic device, joining the accessory to the electronic device. By moving one of the hooks or altering the configuration of a slot, the accessory and electronic device may be separated. Additionally, the hooks may carry electrical current.
US09370111B2
A ceramic multilayer substrate incorporating a chip-type ceramic component, in which, even if the chip-type ceramic component is mounted on the surface of the ceramic multilayer substrate, bonding strength between the chip-type ceramic component and an internal conductor or a surface electrode of the ceramic multilayer substrate is greatly improved and increased. The ceramic multilayer substrate includes a ceramic laminate in which a plurality of ceramic layers are stacked, an internal conductor disposed in the ceramic laminate, a surface electrode disposed on the upper surface of the ceramic laminate, and a chip-type ceramic component bonded to the internal conductor or the surface electrode through an external electrode. The internal conductor or the surface electrode is bonded to the external electrode through a connecting electrode, and the connecting electrode forms a solid solution with any of the internal conductor, the surface electrode, and the external electrode.
US09370107B2
An embedded component structure includes a wiring board, a component and an encapsulant. The wiring board has a front side, a reverse side opposite to the front side, an opening and an interconnection layer. The opening penetrates the wiring board and connects the front side and the reverse side of the wiring board. The interconnection layer is located on the front side of the wiring board and extends toward the opening. The component includes an active surface, a back side opposite to the active side, and a working area located on the active surface. The active surface is connected to the interconnection layer of the wiring board. The encapsulant is filled inside the opening and covers the component, which makes the working area of the component exposed. Besides, a method of the embedded component structure is also provided.
US09370106B2
A method for producing a package includes preparing a base substrate provided with a low-melting glass and a lid, defoaming the low-melting glass by heating the low-melting glass to a temperature equal to or higher than the pour point in a reduced pressure atmosphere, and joining the base substrate and the lid to each other by superimposing the base substrate and the lid on each other through the low-melting glass, and then heating the low-melting glass to a temperature equal to or higher than the pour point in a reduced pressure atmosphere.
US09370097B2
Some implementations provide a substrate that includes several traces, a solder resist layer covering the several traces, and a testing pad coupled to a trace from the several traces. The testing pad is at least partially exposed and at least partially free of the solder resist layer when a chip is coupled to the substrate. In some implementations, the several traces have a pitch that is 100 microns (μm) or less. In some implementations, the substrate is a package substrate. In some implementations, the package substrate is a package substrate on which a thermal compression flip chip is mounted during an assembly process. In some implementations, the testing pad is free of a direct connection with a bonding component of the chip when the chip is coupled to the substrate. In some implementations, the bonding component is one of a solder ball.
US09370095B2
In this conductive sheet and touch panel, a laminated conductive sheet is configured by laminating: a first conductive sheet having a first conductive pattern configured from a plurality of first sensor units; and a second conductive sheet having a second conductive pattern configured from a plurality of second sensor units. The first sensor units have: a band-shaped section extending in a direction approximately perpendicular to one direction; and a jutting section that juts from both sides of the band-shaped section in the one direction. The second sensor units are formed in a manner so as to approximately fill the regions demarcated by the band-shaped section and the jutting section.
US09370091B2
Since a protruding portion preventing a rotation during screw fastening of a connection member is disposed to engage with an end surface of a printed circuit board, a configuration can be achieved such that the protruding portion does not interfere with an earth member, a bracket, etc. disposed on the back side of the printed circuit board, and the earth member and the bracket can freely be designed.
US09370088B2
A method of operating a plasma arc torch is provided that includes directing a first portion of gas into a plasma chamber, directing a second portion of the gas to initiate a pilot arc in the plasma chamber, and redirecting the second portion of the gas to form a shield gas flow rather than venting the second portion to atmosphere. A plasma arc torch for this method includes a start cartridge disposed between an electrode and a tip for initiating the pilot arc. The start cartridge defines at least one redirect gas passageway in fluid communication with a shield gas passageway. The second portion of gas is redirected through the at least one redirect gas passageway and into the shield gas passageway.
US09370080B2
A system and method provide fail-safe operation of a lighting system. A lighting level detector is used to obtain a baseline lighting level for a low-intensity light. If the detector measures less than the baseline level when an occupancy sensor determines the space is unoccupied, a high-intensity light is energized and an indication is provided to a user that the low-intensity light has failed. A method provides daylighting operation of a lighting system. An occupancy sensor can have Wi-Fi functionality to enable remote configuration of the sensor. A line voltage occupancy sensor can include an interface with low voltage devices. An occupancy sensor can include an integral interface to enable an external control system to override the sensor's normal logic under emergency conditions. An occupancy sensor can include an active temperature compensation feature. An occupancy sensor can also incorporate an automatically adjustable coverage area.
US09370071B2
A light bulb assembly is described. The light bulb assembly includes a bridge rectifier to perform full wave rectification of an alternating current (AC) power source, a capacitor to smooth a voltage from the bridge rectifier, and a plurality of light emitting diodes (LEDs) arranged in series. A number of LEDs included in the light bulb assembly is selected by substantially balancing the voltage from the AC power source with a predefined voltage drop associated with each of the LEDs to consume the voltage entirely using the LEDs to generate light.
US09370066B2
A light emitting device includes a light emitting unit and a constant current controller. The light emitting unit includes at least one LED string. The constant current controller is connected to a cathode terminal of the LED string and controls a driving current flowing through the LED string. The constant current controller includes a transistor connected to the cathode terminal of the LED string. A switching unit and a sensing resistor are connected to the transistor. The switching unit connects and disconnects between the sensing resistor and the transistor.
US09370057B2
An interface circuit for a lighting device is described, the interface circuit comprising a single input terminal for receiving a input signal from a user interface; an output terminal for providing a control signal for controlling the lighting device, a detection circuit for receiving the input signal and identifying whether the input signal is either an analog 0-10V signal, a DALI protocol signal or a mains signal and a converter circuit for converting the input signal to the control signal based on the identification, and provide the control signal to the output terminal. The interface as described facilitates retrofitting existing lighting applications.
US09370052B2
A microwave system for heating a plurality of articles and a method of using the same is provided. The microwave heating system comprises at least three microwave launchers and at least three microwave allocation devices for dividing the microwave energy into at least three separate portions. Each allocation device is configured to divide the microwave energy passing therethrough according to a predetermined ratio, and at least one of the allocation devices is configured to divide the microwave energy according to a predetermined ratio that is not 1:1. The resulting energy portions can then be discharged into the microwave heating chamber via the launchers and used to heat a plurality of articles, including foodstuffs, medical fluids, or medical instruments, disposed within the heating chamber.
US09370051B2
An induction heating device and method are disclosed. The device may include a support plate and a coil assembly and a plurality of ferrite bars or the like interposed between the coil assembly and the support plate. Additionally, a central polymeric element may be directly in contact with and interposed between the coil assembly and the support plate. The central element may have a plurality of radial seats configured for engagement with at least one end of the ferrite bars, the seats are configured to locate the bars in a predetermined position.
US09370043B2
A method for voice/data hybrid mode within a user equipment (UE). The method includes detecting a first radio access technology (RAT) activity in response to a received first RAT suspend request for a second RAT tune-away. The method also includes adaptively performing the first RAT suspend request according to a predetermined priority of the detected first RAT activity and a second RAT tune-away activity. A receive chain is shared between a first RAT modem and a second RAT modem of the UE.
US09370036B2
Embodiments of the present invention relate to the field of communications, and provide a message transmitting method and device. The method includes: transmitting, by a user equipment UE, a radio resource control request to a base station, where the UE is in an enhanced uplink cell forward access channel CELL_FACH state and a system information block SIB5 includes an uplink interference value; when no radio resource control response message is received from the base station within a preset time and it is determined that the current number of times the radio resource control request is transmitted is smaller than a preset maximum number of transmissions, read an SIB7 periodically and obtain the uplink interference value; when determining, according to the uplink interference value, to transmit the radio resource control request message to the base station, transmit the radio resource control request message to the base station again.
US09370033B2
In an Access Point controlled wireless network, wherein one channel communication is ruled by an identifier associated with the Access Point, a method for direct communication between a first station and a second station, includes generating a second identifier by the first station, different from the identifier associated with the Access Point, and optionally choosing a different channel; sending, by the first station, an invitation message for direct communication carrying the second identifier and optionally the second channel to the second station; sending, by the second station, a response message acknowledging the invitation message; setting up direct communication between the first station and the second station using the second identifier and optionally the second channel.
US09370031B2
The present invention relates to a wireless network that operates in accordance with the IEEE 802.11n standards and comprises at least one router (2) by which the connections established with the other devices are routed via a wireless network (1), at least one access point (3) which serves as a data transmission point in the network, and at least one client device (4) that uses the network sources; and to a wireless network setup and configuration distribution method (100) which enables to easily configure the devices that connect to the said networks.
US09370023B2
A process for resolving call collisions in a digital conventional direct mode includes monitoring a direct mode communication channel for transmissions from other direct mode radios in the plurality of direct mode radios. In response to detecting a new call request: identifying a last radio to transmit on the direct mode channel, transmitting a new call request for receipt by the last direct mode radio to transmit, monitoring the direct mode channel for a response from the last radio to transmit, and if a call grant granting the new call request is received from the last radio to transmit, initiating the new direct mode call on the direct mode communication channel. If the call grant is not received, at least temporarily refraining from initiating the new direct mode call.
US09370017B2
The present disclosure is directed to a system and method for selecting a sub-group of user terminals (UTs) among a group of UTs served by a sector of a cellular network to schedule independent data streams for transmission to over the same time-frequency interval. In one embodiment, the sub-group of UTs is selected to limit inter-user interference among the sub-group of UTs. In another embodiment, the sub-group of UTs is selected to limit inter-user interference experienced by a UT that is at or near the boundary of the sector that serves the sub-group of UTs.
US09370015B2
An eNB1-1 employs frequency hopping that assigns a radio resource to a UE2-1 in response to switching of a frequency of an SRS from the UE2-1, and determines an MCS in a first radio resource block when a first downlink radio resource block is assigned to the UE2-1, on the basis of SINR acquired for a second downlink radio resource block having a frequency bandwidth equal to a frequency bandwidth of the first downlink radio resource and being assigned to the UE2-1 in the past.
US09370006B2
Provided are an information transmission device and method thereof allowing a wireless device intended to newly start an operation in a white space to efficiently perform its preparatory operation, the transmission device including: a first retainer retaining first information including at least a list of channels available in each of first-type partial areas obtained when dividing an area at a first fineness; a second retainer retaining second information including at least a list of channels available in each of second-type partial areas obtained when dividing the area at a second fineness finer than the first fineness; a generator generating multiplexed information including the first and the second information so that the first and the second information are repeated at equal frequencies, or the first information is repeated at a frequency higher than that of the second information in the time axis direction; and a transmitter wirelessly transmitting the multiplexed information.
US09370002B2
A method for beamforming in a communication network includes generating a plurality of beamforming training (BFT) units associated with a beamforming session between a pair of devices, where each of the plurality of BFT units corresponds to a different beamsteering vector, causing a first non-zero subset of the plurality of BFT units to be transmitted during a first timeslot, and causing a second non-zero subset of the plurality of BFT units to be transmitted during a second timeslot, where the first time timeslot and the second timeslot are not contiguous.
US09369998B2
A method for transmitting uplink control information in a wireless communication system according to one embodiment of the present invention comprises: detecting downlink control information from a downlink control channel; and transmitting uplink control information using a resource of an uplink control channel determined on the basis of a control channel element (CCE) index of the downlink control channel from which the downlink control information is detected, and a user equipment (UE)-specific offset value for determining a resource of an uplink control channel. The uplink control information for at least two downlink control channels having different first CCE indexes can be assigned in the resource of the same uplink control channel.
US09369997B2
Methods and arrangements in a control node, a base station and a UE, for achieving a UE up link transmit diversity mode adaptation, which is coordinated between a base station and a control node. The methods and arrangements involve the control node indicating a set of allowed up link transmit diversity modes to the base station. Further, an up link transmit diversity mode for the mobile terminal is selected in the base station, from amongst the currently allowed up link transmit diversity modes; where the selection is based on information concerning the mobile terminal which is available in the base station. The base station then indicates the selected up link transmit diversity mode to the mobile terminal, which changes to the up link transmit diversity mode indicated by the base station. The methods and arrangements enable a faster and more flexible UE up link transmit diversity mode adaptation.
US09369985B2
A method for determining a position of a wireless access point, a wireless access point, and a wireless access point combination are provided. The wireless access point and a plurality of electronic devices are disposed in a space. The wireless access point moves along a predetermined route. The wireless access point receives a plurality of wireless network signals of the plurality of electronic devices at a plurality of positions on the predetermined route. The wireless access point determines relative positions of the plurality of electronic devices in the space according to the plurality of wireless network signals of the plurality of electronic devices, and then determines a signal transmitting/receiving position of the wireless access point according to the relative positions of the plurality of electronic devices in the space.
US09369979B1
A cascaded distribution framework includes a global positioning system receiver in communication with optical line terminals. Each global positioning system receiver receives a signal from a corresponding global positioning system satellite. Each optical line terminal includes a management card for each global positioning system receiver in communication with the optical line terminal and a line card. The management card receives a global positioning system signal from a corresponding global positioning system receiver. The line card is collocated for each management card in the optical line terminal. Each line card receives a global positioning system signal from each management card in the optical line terminal, determines a signal quality score of each received signal based on a signal drift and a phase precision of the corresponding signal, and selects one of the received global positioning system signals having the highest signal quality score.
US09369968B2
A base station is provided which notifies a mobile station of transmission power information for an uplink RACH, the mobile station transmits transmission delay estimation information on the RACH to the base station over the RACH at a transmission power based on the transmission power information, and the base station changes the transmission power information according to the transmission delay estimation information and notifies the mobile station of the changed transmission power information. The mobile station retransmits data or a preamble if the mobile station does not receive a notification that the base station has received the data or the preamble correctly after a predetermined time. The base station transmits the transmission power information over a BCH and a CPICH transmitted to a plurality of mobile stations.
US09369964B2
A mobile device may manage the battery of the mobile device by controlling radio power usage. In one implementation, a mobile device may determine a target power usage associated with a radio of the mobile device, the radio implementing a radio link with a base station associated with a cellular wireless network. The mobile device may also determine an actual power usage associated with the radio of the mobile device and compare the actual power usage to the target power usage. The mobile device may communicate with the base station, and based on the comparison of the actual power usage to the target power usage, to cause the base station to reduce a bit rate associated with the radio link.
US09369959B2
An electronic device has first and second circuitry. A wireless trigger signal at the first circuitry causes the second circuitry to power up to receive a second wireless signal. The second signal is according to a radio access technology for which the trigger signal is incompatible. In various embodiments the first circuitry (a low power receiver) may autonomously power up upon expiration of a timer. One or more security checks can be performed at various steps, each step conditional on passing the previous security check. The first circuitry operates at a lower power than the second circuitry which comprises a broadband radio. For example, the first circuitry might be a Bluetooth low energy receiver, and a trigger signal there causes a WLAN receiver to power up in order to download software/firmware updates or user content while the device is enroute between the manufacturer and end user.
US09369951B2
Systems, methods, and devices for wireless communication are provided. In an embodiment, a method of wireless communication includes receiving, at an access point, a probe request from a wireless device, transmitting a probe response including shared access point state information, receiving an association request including an indication that the wireless device has stored the shared access point state information, and transmitting an association response conditionally including the shared access point state information based on the indication in the association request.
US09369947B2
Provided are a device discovery method and a communication device thereof. The method includes: transmitting a probe request frame; receiving a probe response frame including session information on a client connected to a group owner (GO), from the GO among source and sink devices belonging to the display group; and determining whether to associate with the display group by using the session information in the probe response frame.
US09369944B2
A method may be provided in a wireless terminal to modify access to a Radio Access Network. The method may include providing a barring rate at the wireless terminal and providing a barring rate modifier at the wireless terminal. A modified barring rate may be provided at the wireless terminal responsive to the barring rate and the barring rate modifier with the modified barring rate and the barring rate being different. A random number may be provided at the wireless terminal responsive to attempting to access the Radio Access Network, and access of the wireless terminal to the Radio Access Network may be blocked responsive to the random number failing to satisfy a threshold of the modified barring rate. Related wireless terminals, network nodes, and network operations are also discussed.
US09369937B1
A Long Term Evolution (LTE) network wirelessly exchanges data with User Equipment (UE) over multiple data bearers having a combination of Quality-of-Service Class Indicators (QCIs). The LTE network wirelessly receives radio measurement data from the UE for a voice communication network and for a data communication network. The LTE network determines at network-selection parameters based on the combination of the QCIs for the UE. The LTE network processes the radio measurement data based on the network-selection parameters to select the data communication network for the UE instead of the voice communication network.