US10882980B2
The present invention relates to a process for the production of water and solvent-free hydrogenated nitrile rubber polymers, to the hydrogenated nitrile rubbers and the use thereof.
US10882979B2
A golf ball includes a core and a cover. The core is formed of a material molded under heat from a rubber composition. The rubber composition includes components (A) through (C). The components (A) through (C) are (A) a base rubber, (B) an organic peroxide, and (C) a water providing agent. The water providing agent releases water at a vulcanization temperature at which the rubber composition is vulcanized. The dissociation rate of water of the water providing agent in the case of heating the water providing agent up to the vulcanization temperature of the rubber composition is 60% by mass or more.
US10882973B2
In order to provide a polyurethane yarn having exceptional performance in terms of resistance to chlorine embrittlement essentially without the use of zinc, which is a heavy metal, and having advantageous application particularly in swimwear; as well as a fabric and article of swimwear using the polyurethane yarn, the present invention is a polyurethane yarn characterized in containing a partially hindered phenol compound having at least one partially hindered hydroxyphenyl group and a molecular weight of 300 or more, and a synthetic carbonate comprising one metal selected from the group consisting of alkali metals and alkaline-earth metals. The polyurethane yarn and other fibers are combined to yield a fabric and article of swimwear.
US10882969B2
A method of producing a rubber molded article, involving utilizing a compound different from a compound that has been used as a crosslinking agent. The method of producing a rubber molded article includes a crosslinking step of crosslinking a rubber component by decomposing a compound to be used as a crosslinking agent for the rubber component, the compound including a structure represented by the following formula (I), in a rubber composition containing the rubber component and the compound, the rubber composition including a sulfur content of 2.0 wt % or less: α-β-γ . . . (I) (in the formula (I), α represents a monovalent organic group, β represents —N═N—, and γ represents hydrogen or a monovalent organic group).
US10882961B2
Provided herein is a process of preparing a semi-random graft co-polymer, the product of which is difficult to fully characterize chemically. The product of the present disclosure has unique and useful properties of 1) binding to a peptide and 2) upon co-administration of the product and the peptide into animals the product prolongs the blood circulation time and elevates the level of the peptide, compared to the peptide alone without the product of the disclosure.
US10882959B2
A method for forming a polyarylene sulfide is described. The method can include a multi-step cooling and precipitation process in which the cooling rate of the solution that carries the polymer is decreased during a portion of the overall cooling. This slower cooling period can encompass at least a portion of the period during which the polymer precipitates from the solution. The precipitation process can form polyarylene sulfide particles with good particle integrity and a narrow particle size distribution, which can reduce fines and improve downstream processing and final product characteristics.
US10882952B2
A process of forming a side-chain-functionalized polyhydroxyalkanoate (PHA) material is disclosed. The process includes forming a PHA material having a hydroxyl-terminated side-chain. The process also includes utilizing the PHA material having the hydroxyl-terminated side-chain to form a side-chain-functionalized PHA material having a side-chain with a terminal cross-linkable functional group, for example, sulfhydryl group, in order to form reversibly cross-linked PHA material.
US10882951B2
A thermoset material containing β-hydroxyesters wherein said thermoset material is subject to a mechano-chemical process to regenerate an epoxide and a carboxylic acid functionality. A curative for epoxidized plant-based oils and epoxidized natural rubber is created from the reaction between a naturally occurring polyfunctional acid and an epoxidized plant-based oil is disclosed. The curative may be used to produce porosity-free castable resins and vulcanize rubber formulations based on epoxidized natural rubber. Materials made from disclosed materials may be advantageously used as leather substitutes.
US10882939B2
The present invention relates to a method for preparing a modified conjugated diene-based polymer, and more particularly, provides a method for preparing a modified conjugated diene-based polymer including a step of polymerizing a conjugated diene-based monomer in the presence of an organometal compound in a hydrocarbon solvent to prepare an active polymer which is coupled with an organometal (S1); and a step of reacting or coupling the active polymer prepared in step (S1) with a modifier (S2), wherein step (S1) is continuously performed in two or more polymerization reactors, and a polymerization conversion ratio in a first reactor among the polymerization reactors is 50% or less.
US10882935B2
The invention pertains to a method for manufacturing a fluoroelastomer (A), wherein fluoroelastomer (A) is a (per)fluoroelastomer, where such method includes (a): polymerizing in an aqueous emulsion in the presence of a surfactant by feeding the following ingredients into a first reactor: (i) a monomer mixture (M1) comprising at least one monomer (F), wherein monomer (F) is a fluoromonomer, (ii) at least one iodinated and/or brominated chain-transfer agent(s), (iii) at least one branching agent possessing at least two ethylenic unsaturations; and (iv) at least one radical initiator, so as to obtain a pre-polymer latex (P); (b): recovering latex (P) from the first reactor and storing the recovered latex (P) in a storage tank; (c): feeding the recovered latex (P) from the storage tank into a second reactor; (d): polymerizing in the second reactor at least a second monomer mixture (M2) comprising at least one monomer (F) in the presence of a radical initiator, so as to obtain a final latex (F); and (d): recovering (per)fluoroelastomer from latex (F).
US10882934B2
The present invention relates to nucleated propylene-butylene copolymers comprising propylene and butylene monomer units, wherein the nucleated propylene-butylene copolymer has improved stiffness, better impact behaviour and optical properties such as low haze and improved optomechanical ability.
US10882929B2
The present invention relates to a procatalyst comprising the compound represented by formula A as an internal electron donor (Formula A), wherein R is hydrogen or a methyl group, N is nitrogen atom; O is oxygen atom; and C is carbon atom. The present invention also relates to a process for preparing said polymerization procatalyst and to a polymerization catalyst system comprising said procatalyst, a co-catalyst and optionally an external electron donor. Furthermore, the present invention relates to a polyolefin obtainable by the process according to the present invention and to the use of the compound of formula A as in internal electron donor in catalysts for polymerization of olefins.
US10882924B2
The present invention relates to a procatalyst comprising the compound represented by formula A as an internal electron donor, Formula A wherein R is hydrogen or a methyl group, N is nitrogen atom; O is oxygen atom; and C is carbon atom. The present invention also relates to a process for preparing said polymerization procatalyst and to a polymerization catalyst system comprising said procatalyst, a co-catalyst and optionally an external electron donor. Furthermore, the present invention relates to a polyolefin obtainable by the process according to the present invention and to the use of the compound of formula A as in internal electron donor in catalysts for polymerization of olefins.
US10882917B2
The present invention relates to anti-tumor agents that target certain tumor-associated macrophages. Also disclosed are methods of using such agents in treatment of cancer.
US10882912B2
An object of the present invention is to effectively induce cancer cell apoptosis using the anti-TRAIL-R1 antibody(ies) and the anti-TRAIL-R2 antibody(ies) and to reduce the toxicity imposed on normal cells. The present invention relates to recombinant obligate anaerobic Gram-positive bacteria that include a nucleic acid encoding a fusion protein having 3 or more anti-TRAIL-R1 single-chain antibodies and/or 3 or more anti-TRAIL-R2 single-chain antibodies, in an expressible state.
US10882907B2
Multispecific antibodies (e.g., bispecific antibodies) that bind to HIV gp120 and CD3 are disclosed. Also disclosed are methods of using such antibodies to treat or prevent HIV infection.
US10882900B2
The present invention provides a monoclonal antibody that specifically binds to human-derived procalcitonin and application thereof. The present invention also provides a hybridoma cell line secreting the monoclonal antibody and having an accession number of CGMCC No. 10417, and a method for preparing an antibody against procalcitonin by using a procalcitonin mutant antigen as the immunogen.
US10882899B2
An isolated monoclonal antibody or antigen-binding fragment thereof binds to F. tularensis lipopolysaccharide (Ft LPS). The antibody preferably lacks an Fc region or has an impaired Fc-region. The antibody may be formulated into a pharmaceutical composition along with a pharmaceutically acceptable carrier, excipient or diluent. It may be provided in a kit with means for detection of the antibody and instructions for use. A therapeutically effective amount of such an antibody can be used for prophylaxis, treatment or amelioration of Ft infection and for inhibiting Ft uptake by cells in a subject. The antibody can also be used to detect Ft infection. Also disclosed is an isolated nucleic acid molecule encoding the antibody, an expression vector having the isolated nucleic acid molecule, and a host cell transfected with such an expression vector.
US10882897B2
Binding molecules, including bispecific antibodies that include at least two anti-influenza binding domains are disclosed, including binding molecules having a first binding domain that specifically binds influenza A virus and a second binding domain that specifically binds influenza B virus.
US10882896B2
A hybridoma cell strain secreting a nifursol residue marker monoclonal antibody prepared in the following way: BALB/c mice are subjected to the first immunization with a complete Freund's adjuvant, subjected to booster immunization with an incomplete Freund's adjuvant for four times, and subjected to rush immunization once with nifursol residue marker complete antigen without a Freund's adjuvant so that the BALB/c mice are immunized; the spleen cells of the immunized mice with high titer and low IC50 were fused with mouse myeloma cells by a PEG method, and the fused cells are screened through indirect competitive ELISA and subcloned three times. The monoclonal antibody secreted by this cell strain has good specificity and detection sensitivity (IC50 value of 2 μg/L) to the nifursol residue marker and can be used for residue detection of the nifursol residual marker in food.
US10882894B2
The present invention provides peptidic TGF-β antagonists capable of inhibiting TGF-β signaling and disrupting the biochemical events that promote fibrosis and the epithelial-mesenchymal transition. The peptidic TGF-β antagonist may contain from 11 to 28 amino acid residues (for instance, may consist of from 12 to 16 amino acid residues) and may have the following structure (II): NH2′ ETWIWLDTNMG-Xaa1-Y′COOH (II) wherein Xaa1 is any amino acid and Y is a peptide having from 0 to 9 amino acids. The peptidic TGF-β antagonists can advantageously be used for the prevention, treatment, and/or alleviation of the symptoms of a condition associated with an increase in TGF-β activity, including fibrosis (such as fibrosis of the skin, liver, lungs, and heart, among others) and cancer (including various carcinomas, such as squamous cell carcinoma, sarcomas, and metastatic cancers).
US10882891B2
The present invention contemplates dendritic cell compositions. The dentritic cell compositions employ MHC class-II targeting signals fused to an antigen or fragment thereof to obtain MHC II presentation of the antigen or fragment thereof. In particular, the invention refers to a dendritic cell vaccine comprising dendritic cells expressing a MHC class-II targeting signal fused to an antigen or fragment thereof. Dendritic cell vaccines for the stimulation of an immune response against melanoma-associated antigen are also described.
US10882888B2
It relates to a method for preparation of four kinds of 2′, 3′-cNMPs (2′, 3′-cAMP, 2′, 3′-cGMP, 2′, 3′-cCMP and 2′, 3′-cUMP), comprising steps of: (1) extract genomic DNA and amplify gene If3; (2) ligate If3 gene to expression plasmid to construct a recombinant vector, and transfer the recombinant vector to E. coli to obtain a recombinant strain. Cultivate the recombinant strain and collect the fermentation broth; (3) collect the cells form the fermentation broth and disrupt the cells, and then purify the recombinant protein IF3 from the cell extract by Ni2+-nitrilotriacetic acid resin. Incubate the recombinant protein IF3 solution at 0° C. for 3 days to release 2′, 3′-cNMPs from IF3, and centrifuge the solution; (4) Ultrafiltrate the supernatant to remove proteins, and prepare four kinds of 2′, 3′-cNMPs by high-performance liquid chromatographic (HPLC) on a C18 reversed-phase column.
US10882881B2
Hsp90 C-terminal inhibitors and pharmaceutical compositions containing such compounds are provided. The compounds of the disclosure are useful for the treatment and/or prevention of neurodegenerative disorders such as diabetic peripheral neuropathy.
US10882877B2
An organometallic compound represented by Formula 1: wherein in Formula 1, groups and variables are the same as described in the specification.
US10882871B2
This disclosure relates to novel compounds comprising a zwitterionic trifluoroborate prosthetic group which target prostate-specific membrane antigen (PSMA), e.g. in prostate cancer. The compounds have Formula I, wherein each R1 is an anionic group, L is a linker and R2B-F3 is —N(R3)2CH2BF3, a pyridinium group substituted with BF3 or methyl BF3, or an azole group substituted with methyl BF3. Methods and uses of imaging and treating PSMA-expressing cancers are also disclosed.
US10882868B2
The present invention provides compounds of formula (I) wherein A, R1, R2 and R3 are as described herein, as well as pharmaceutically acceptable salts thereof. Further the present invention is concerned with the manufacture of the compounds of formula (I), pharmaceutical compositions comprising them and their use as medicaments.
US10882862B2
The invention relates to stable, isotopically labeled compounds for use in mass spectrometry analysis for quantifying methotrexate in a sample. Exemplary compounds include isotopically labeled variants of methotrexate.
US10882858B2
The specification generally relates to compounds of Formula (I): and pharmaceutically acceptable salts thereof, where R1, R2, R3, R4 and R5 have any of the meanings defined herein. The specification also relates to the use of compounds of Formula (I) and salts thereof to treat or prevent ATM mediated disease, including cancer. The specification further relates to pharmaceutical compositions comprising to substituted imidazo[4,5-c]quinolin-2-one compounds and pharmaceutically acceptable salts thereof; kits comprising such compounds and salts; methods of manufacture of such compounds and salts; and intermediates useful in such manufacture.
US10882857B2
The invention provides novel compounds having the general formula (I) wherein R1, R2, Y, W, A, X, m and n are as defined herein, compositions including the compounds and methods of using the compounds.
US10882854B2
Heterocyclic compounds of Formula (I) shown herein. Also disclosed is a pharmaceutical composition containing one of the heterocyclic compounds. Further disclosed are methods of using one of the heterocyclic compounds for mobilizing hematopoietic stem cells and endothelial progenitor cells into the peripheral circulation, and for treating tissue injury, cancer, inflammatory disease, and autoimmune disease.
US10882846B2
The present invention relates to nitro-vinyl-pyrazole compounds of formula (B) wherein ring A, RB2 and RB3 are as defined in claim 1, as well as the manufacture of such compounds and their subsequent use in the production of agrochemicals and/or pharmaceuticals.
US10882843B2
The present application discloses novel 5-aminopyrazole carboxamide compounds as shown in formula (I), and stereoisomers, pharmaceutically acceptable salts, solvates, or prodrugs thereof. In addition, the present application further discloses a method for the preparation of the compounds, a pharmaceutical composition comprising a compound of the invention and the use of the compounds.
US10882841B2
Compounds and compositions are provided as inhibitors of the Wnt/β-catenin pathway for the treatment of diseases that implicate the same.
US10882836B1
A method for purifying a crude 2,5-furandicarboxylic acid composition including 2,5-furandicarboxylic acid and 2-furoic acid is disclosed. The method includes the steps of: (a) mixing the crude 2,5-furandicarboxylic acid composition with a solvent solution that includes alcohol so as to obtain a mixture; (b) heating the mixture to permit full dissolution of the crude 2,5-furandicarboxylic acid composition in the solvent solution; and (c) cooling the mixture to permit recrystallization of the 2,5-furandicarboxylic acid from the mixture so as to obtain purified 2,5-furandicarboxylic acid.
US10882832B2
The present invention relates compounds of Formula (A), as well as their preparation and uses, and further relates pharmaceutical compositions comprising these compounds and their uses as modulators of dysfunctional glutamate transmission. The present invention also relates to uses of the compounds or pharmaceutical compositions in treating or preventing certain neurological and psychiatric disorders and diseases as well as cancer in humans.
US10882827B2
The present invention relates to methods and compounds for regulating or enhancing erythropoiesis and iron metabolism, and for treating or preventing iron deficiency and anemia of chronic disease.
US10882825B2
The invention relates to non-solvated crystals A, B and C of N-(2-aminophenyl)-6-(7-methoxyquinoline-4-oxy)-1-naphthamide and preparation methods thereof. The invention also relates to pharmaceutical compositions containing the crystals, and a use of the crystals in preparation of a medicament for the treatment of a disease associated with abnormal protein kinase activity or abnormal histone deacetylase activity.
US10882823B2
2-(phenylalkyloxyalkyl)pyridine derivative or a 2-(phenylalkylthioalkyl)pyridine derivative imparts, when added to food and drink or cosmetics as an active ingredient, a flavor of natural impression thereto; and in particular, when added to food and drink, the compound imparts an umami imparting or enhancing, a saltiness enhancing a sweetness enhancing, and in particular, when added to a milk or dairy product, a food or drink product containing a milk or dairy product, or a dairy replacement product, the compound provides a milk richness enhancing.
US10882821B1
Aspects of the present disclosure include methods of reducing the deleterious impact of a target gene in a cell, such as the deleterious activity of a mutant extended nucleotide repeat (NR) containing target gene in a cell, by contacting the cell with an effective amount of an enantiomeric tetrahydrocarbazolamine compound. The deleterious activity (e.g., toxicity and/or dis-functionality of products encoded thereby) of a mutant extended NR containing target gene may be reduced, e.g., by reducing (and in some instances differentially, including selectively, reducing) the production or activity of toxic expression products (e.g., RNA or protein) encoded by the target gene. Kits and compositions for practicing the subject methods are also provided.
US10882819B2
The present invention relates to novel intermediate(s), which are useful for the preparation of Rivastigmine compound of formula (I) and its pharmaceutically acceptable salts. The present invention further relates to the processes for the preparation of such novel intermediate(s) and preparation of Rivastigmine using such novel intermediate(s).
US10882813B2
The present invention relates to an improved method for the synthesis of Ferric Citrate and also to provide an amorphous form of Ferric Citrate having an active surface area less than 14 sq.m/g.
US10882800B2
Aspects of the invention relate to improvements in the flexibility with which oxygen and hydrogen, for example from electrolysis, may be supplied to processes having both gasification and methanation steps, as well as improvements in how such processes may be operated in response to variations in carbonaceous feeds. Offsets, between the ideal quantity of hydrogen and the quantity available from a given source may be compensated for by adjusting one or more operations of the process, and in particular such operation(s) that ultimately impact the quantity of CO and/or CO2 available downstream of the gasifier for conversion to methane in an RNG product stream.
US10882798B2
A process for fast humification and non-fermentative bio-stabilization of solid and/or liquid, vegetal and/or animal organic material, comprising the following phases: an initial phase of preparation and pre-treatment of said organic material, for preparing activated and mixed material brought to a substantially neutral pH; a next phase wherein said activated and mixed material at a substantially neutral pH is treated in a reactor, in which it is re-mixed and irradiated with radio frequencies conveyed by waveguides for a given time; a final phase of post-processing the material treated in the reactor, adapted for producing a biostabilized organic product.
US10882796B2
A ceramic porous body comprising: skeleton portions including an aggregate and at least one binding material; and pore portions formed between the skeleton portions, the pore portions being capable of allowing a fluid to flow therethrough. In the ceramic porous body, the pore portions have a pore volume ratio of pores having a pore diameter of from 1 to 10 μm, of 45% or more, and a ratio of a contact area between the aggregate and the binding material to a surface area of the binding material of from 20 to 60%.
US10882795B2
A process for manufacturing a composite part includes introducing an adhesion promoter into the pores of a fibrous preform formed by threads covered with a coating having —OH groups on its surface, the adhesion promoter including an electron-withdrawing group G1 that is reactive according to a reaction of substitution or of nucleophilic addition with the —OH groups, and a reactive group G2; grafting the adhesion promoter to the surface of the coating by a reaction of substitution or nucleophilic addition of the —OH groups on the group G1; introducing a ceramic precursor resin into the pores of the fibrous preform; polymerizing the resin introduced and bonding the grafted adhesion promoter to the resin by chemical reaction between these two compounds at the level of the group G2, and forming a ceramic matrix phase in the pores of the fibrous preform by pyrolysis of the polymerized resin.
US10882789B2
The present invention relates to a blend of reinforcement fibers for use in a variety of applications. In particular, the blend of reinforcement fibers can be used in cementitious compositions, such as Portland cement concrete and asphalt cement concrete compositions to reduce or preclude voids and/or cracks formed in the cement concrete upon placement. The blend of reinforcement fibers includes a plurality of first fibers and a plurality of different second fibers. The first and second fibers can be different based on coarseness/fineness, melting temperature, denier and specific chemical or material composition. In certain embodiments, one of the plurality of first fibers and the plurality of different second fibers has a melting temperature that is lower than the temperature of an asphalt cement concrete composition such that the plurality of first or different second fibers serves as a carrier/buffer to improve distribution and dispersion of the fibers in the Portland or asphalt cement concrete composition.
US10882780B2
A glazing comprises a glass substrate having an enamel layer adhered to at least a first surface portion, the enamel comprising 20 to 80 wt % frit and 10 to 50 wt % inorganic pigment. The thickness of the enamel layer is 2 μm to 50 μm, and the inorganic pigment has an infra-red reflectance such that the infra-red reflectance of the first portion of the glass substrate surface is 37% or higher over a region in the wavelength range 800 nm to 2250 nm. The glazing may be laminated, and may be a vehicle windscreen. A process for producing the glazing involves applying ink to a glass substrate, curing the ink thereby producing an enamel adhered to the glass substrate, and shaping the glass substrate by heating to a temperature above 570° C. The preferred inorganic pigments are of the Fe and/or Cr type in spinel, haematite or corundum crystal form.
US10882775B2
A glass substrate comprising a rectangular glass sheet having a first main surface and a second main surface opposite the first main surface, the glass substrate having a first side and a second side which are adjacent to each other in a view along a thickness direction of the glass sheet, in which a thickness tolerance is less than 6.26 μm in a first cross section which is a cross section in the thickness direction of the glass sheet along a straight line parallel to the first side, the thickness tolerance being a difference between the maximum value and the minimum value of the thickness of the glass sheet.
US10882773B1
A mobile water purification system having a trailer, a pretreatment subsystem having a cyclonic separator, a filtering subsystem fluidly connected with the pretreatment subsystem, the filtering subsystem having at least one bedded filter; a reverse osmosis subsystem fluidly connected with the filtering subsystem, the reverse osmosis subsystem having a waste output and a product output; a collection tank fluidly connected with and downstream of the reverse osmosis subsystem; a distribution subsystem fluidly connected with and downstream of the collection tank; a source water inlet mounted to the exterior and fluidly connected to the pretreatment inlet, the source water inlet outside of the at-least partially enclosed space; and a discharge water outlet mounted to the plurality of sidewalls and fluidly connected to the pressure tank, the discharge water outlet having an outlet opening outside of the at least partially-enclosed space.
US10882772B1
A stormwater collection, treatment, and aquifer replenishment installation includes a stormwater drain for receiving surface stormwater, a dry well downwardly extending underground to an outlet proximate to a water table over an aquifer, a tank structure at least partially disposed underground and coupled with the stormwater drain and the dry well in stormwater communication, a stormwater treatment system enclosed within the tank structure between the stormwater drain and the dry well for converting surface stormwater into treated stormwater, the tank structure for conducting surface stormwater to the stormwater treatment system between the stormwater drain and the dry well, and the dry well for receiving and gravity feeding treated stormwater from stormwater treatment system to the outlet.
US10882767B2
A method for removing ammonia nitrogen in an aqueous solution is provided in the present invention. The method includes performing an electrolysis reaction using an electrolysis device, such that the ammonia nitrogen is converted into nitrogen gas, nitrate or nitrite. The electrolysis device includes an anode including metal nickel, nickel hydroxide or nickel oxyhydroxide, and a cathode including metal copper. The method has high selectivity of converting the ammonia nitrogen into the nitrogen gas.
US10882760B1
A system for reducing water pump cycling and TDS creep when producing purified water is disclosed. The system includes a central control unit for receiving signals from a processing reservoir water level sensor and controlling a purified water valve and a waste water valve. The purified water valve is configured to divert at least a purified water flow through a purified water conduit to the processing reservoir and the waste water valve is configured to divert waste water flow through a waste water conduit to the processing reservoir to maintain the pump in a pumping condition such that the amount of processing water is at least as great as a processing water threshold thereby reducing cycling of the pump and TDS creep.
US10882756B2
A method of regenerating an etch solution comprising a metastable complex of manganese(III) ions in a strong acid is described in which at least a portion of the manganese(III) ions in the metastable complex have been destabilized, causing them to disproportionate into manganese dioxide and manganese(II) ions. The method includes the steps of i) adding an effective amount of a reducing agent to the solution; ii) allowing the reducing agent to react with the solution to cause manganese dioxide to dissolve; and (iii) applying an electrical current to regenerate manganese(III) ions in the solution.
US10882753B2
The invention relates to a method for exchanging interlayer anions of a layered double hydroxide (LDH) with other anions whose affinity for the LDH is lower than the one of the starting interlayer anions, which comprises the successive steps of: (1) exchanging the starting interlayer anions of a layered double hydroxide with polyoxometalate anions in order to obtain a layered double hydroxide with polyoxometalate anions as interlayer anions, and (2) exchanging the polyoxometalate anions of the layered double hydroxide obtained in step (1) with other anions whose affinity for the LDH is lower than the one of the starting interlayer anions in order to obtain a layered double hydroxide with other anions as interlayer anions.
US10882750B2
In the present invention are provided a method for preparing a silica aerogel-containing blanket, and a blanket which includes a silica aerogel and is manufactured using the same, wherein the method includes a step for preparing a reaction solution by reacting a silazane-based surface modification agent with an alcohol-based compound, a step for preparing a silica gel-base material composite by adding a silica precursor, water, and a polar organic solvent to the reaction solution to prepare a silica sol, and then immersing a base material for a blanket in the prepared silica sol to gelate the silica sol, and a step for drying the silica gel-base material composite.
US10882738B2
A MEMS device package comprising a first die of semiconductor material including a contact pad and a second die of semiconductor material stacked on the first die. The second die is smaller than the first die. The second die includes a contact pad, and a conductive wire is coupled between the contact pad of the first die and a contact pad of the second die. A mold compound is on the second die and the first die. A vertical connection structure is on the contact pad of the second die. The vertical connection structure extends through the mold compound.
US10882737B2
A through silicon interposer wafer and method of manufacturing the same. A through silicon interposer wafer having at least one cavity formed therein for MEMS applications and a method of manufacturing the same are provided. The through silicon interposer wafer includes one or more filled silicon vias formed sufficiently proximate to the at least one cavity to provide support for walls of the at least one cavity during subsequent processing of the interposer wafer.
US10882735B2
Capped microelectromechanical systems (MEMS) devices are described. In at least some situations, the MEMS device includes one or more masses which move. The cap may include a stopper which damps motion of the one or more movable masses. In at least some situations, the stopper damps motion of one of the masses but not another mass.
US10882731B2
A handling system for a filling system for filling containers and circuits of vehicles with different operating materials on assembly lines of the automobile industry is disclosed. The filling system has a base unit, a controller, a console, and an adapter. The adapter is operatively connected to a hose packet for supplying the respective operating materials which is movably supported on the console. The handling system handles the hose packets which are operated with a medium other than a pneumatic system. The drive of the movable hose packets and the drive system of a lifting unit equipped with a tray for the adapter are each designed as an electromotive drive. The disclosure further provides the sequences of movement of the adapter and lifting unit.
US10882727B2
A water purifier includes a cooling water tank, a partition member mounted inside the cooling water tank and partitioning an inner space of the cooling water tank into an upper space and a lower space, a cold water pipe accommodated in the lower space; an evaporator accommodated in the upper space, and an agitator penetrating the partition member and disposed in the lower space. The partition member includes a bottom portion on which the evaporator is mounted and that defines a plurality of cooling water through-holes, and an outer wall portion extending upward along an edge of the bottom portion to define an evaporator accommodating portion. The outer wall portion is spaced apart from an inner wall of the cooling water tank to prevent ice formed in the evaporator accommodating portion from contacting the inner wall of the cooling water tank.
US10882726B2
The present invention discloses a beer spear with a pressure relief valve, which comprises a beer spear seat, a pressure relief valve, an inner tube fixing sleeve, an inner tube fixing spring and an inner tube assembly; the pressure relief valve is arranged on the outer side of the beer spear seat and the pressure inlet of the pressure relief valve communicates with a gas storage chamber; a head movable hole matching the head of a dispenser is opened at the top of the beer spear seat. The present invention is more convenient to assemble and disassemble a draft beer keg, and also the space for the draft beer keg is saved and the problems such as gas leakage and draft beer spoiling caused by damages of the gas tube are avoided.
US10882721B2
A lockable safety hook such as used for lifting loads and the like wherein the locking mechanism features a double locking function by way of a lock securing device arranged to prevent movement or unintentional activation of the locking mechanism by “locking the lock”.
US10882707B2
There is provided a feed apparatus including a support unit having a support surface, a feed roller, a first arm to support the feed roller, a recess portion on the support surface, a second arm swingable, with a side of the one end as a swing shaft, between a first position at which the other end of the second arm is in the recess portion and a second position at which the other end is outside the recess portion; and a biasing member. In a case that the second arm is the first position, a guide surface of the second arm is positioned on an upstream side of the feed roller in the feed direction and in a case that the second arm is the second position, the other end of the second arm is positioned on a downstream side of the feed roller in the feed direction.
US10882702B2
The invention relates to a method and apparatus (10) for handling piece goods (2) for forming a palletizable layer or partial layer, with the piece goods (2) being moved in at least two parallel rows (1) and the layer comprising a plurality of piece goods (2). At least two piece goods (2) that are transported beside each other in parallel rows (1) are seized in a clamping and/or force-locking and/or form-locking manner, are then spatially separated from the at least two parallel rows (1) and are then brought into a specified relative target position (P1, P2) and/or target alignment in relation to subsequent piece goods (2). The apparatus (10) comprises at least one manipulator (5) for piece goods (2), and at least one transport device (3), where the piece goods (2) arranged in at least two parallel rows (1).
US10882701B2
Provided is a method for detecting faults in the context of transport of objects, wherein by a transport device, a plurality of objects are transported in a predetermined alignment of these objects along a predetermined transport path, wherein the objects are transported while at least partially in contact with each other, and wherein the objects are located on a movable surface of the transport device, wherein, by at least one image capturing device, at least one first region is captured in which a plurality of these containers is located and at least one sub-region of this region is identified in which no object is located in the predetermined orientation, wherein furthermore a distinction is then made as to whether an object with an alignment deviating from the predetermined alignment or an empty space is located in this region.
US10882700B1
The present invention discloses an embedded scraper rotation angle detection device for a scraper conveyor and a detection method. The detection device includes two extensible detection devices, two signal detection units and a remote processing unit. The two extensible detection devices and the two signal detection units are disposed at two ends of a scraper respectively. The signal detection units detect movement displacements of the extensible detection devices in real time and send out signals through wireless transmission modules, the wireless transmission modules and a wireless receiving module are used for data transmission, and a signal display processing module is used to calculate a rotation angle value of the scraper in real time, output and display the rotation angle value simultaneously, compare the rotation angle value measured in real time with a set safety threshold, and send out an alarm indication when the rotation angle value exceeds the safety threshold.
US10882699B1
The present application discloses an interactive rotary machine, comprising a first conveyor assembly, a first blocker assembly, a second conveyor assembly and a second blocker assembly. The first blocker assembly is coupled to the first conveyor assembly, wherein the first blocker assembly forms a plurality of first sections at the first conveyor assembly. The second blocker assembly is coupled to the second conveyor assembly, wherein the second blocker assembly forms a plurality of second sections at the second conveyor assembly, wherein the first blocker assembly and the second blocker assembly are unblocked when the plurality of first sections and the plurality of second sections are matched. Another interactive rotary machine is also disclosed, comprising a first conveyor assembly, a second conveyor assembly and a blocker assembly.
US10882695B2
A load handling system and method of handling a load includes a load handling device with a load support that is configured for engaging a load and a first drive is adapted to drive said load support with respect to a load. A conveyor is moveable along the load support and a second drive is adapted to propel the conveyor with respect to the load support. The first and second drives are operated to handle a load. The load support may be a pair of forks or a platen or the like.
US10882694B2
A remotely operated vehicle assembly for picking up storage bins from a storage system and a method for change of vehicle direction. The vehicle assembly has a vehicle body with a cavity suitable for receiving a storage bin stored within the storage system, a lifting device for lifting the containers into the cavity and a displacement arrangement including a motor for lifting one of two sets of wheels in or out of engagement with an underlying track for changing vehicle direction. The displacement arrangement includes a displacement plate and a vertically displaceable bar arranged in a lateral plane above the cavity.
US10882692B1
Described is a system and method for assisting users in properly placing and/or positioning items at inventory locations within a materials handling facility. In one example, a placement location may be distinguished for the user through use of illumination or other techniques to assist the user in quickly identifying the proper location at which to place the item. Likewise, a proper position of the item may be presented to the user to assist the user in properly positioning the item at the placement location.
US10882691B2
In some examples, a system includes a communication interface, and at least one processor configured to cause sending, to a sensor device attached to a cargo transportation unit (CTU), parameter information through the communication interface, the parameter information controlling detection of a condition associated with the CTU by the sensor device.
US10882690B2
A conveying system for conveying a conveyable material from a hopper where the system includes a fluid port located below the hopper outlet and in a vertical flow path into hopper outlet that can be momentarily opened for an on the go release of a charge of compressed air directly upward into the hopper outlet and into the underside of the bridge in the hopper to either disintegrate or unlock the bridged particles from each other thereby causing the bridged material to fall into the hopper outlet and into the conveying system where the material can be transported to a remote location or to remove any material that may be adhering to the wall during an emptying phase.
US10882685B2
A combination food pad container and dispenser includes an elongated flexible film container sized and shaped to slidably surround a plurality of horizontally stacked food pads that have at least one planar surface. The container has a surrounding wall, a closed top and a closed bottom. The surrounding wall has at least one perforation in the front wall orthogonal to the planar surface. A rigid member is located inside the container and supports it in a free-standing vertical orientation. The container may have one or more mounting apertures located adjacent the top. The container may have means for attaching the container to a surface such as hooks, posts, mounting spikes, prongs, chords and ties. The container may be used in conjunction with a wall mounting bracket having at least one protrusion sized and shaped to fit slidably within said at least one mounting aperture.
US10882683B2
A method of forming a shipping container includes mixing paper fibers with a binder fiber to form a mixture; disposing the mixture onto a surface to form a layer of the mixture; applying heat to form a paper fiber batt from the mixture having a fixed width and fixed length; and inserting the paper fiber batt within an interior of a corrugated box.
US10882678B2
The present invention provides a reinforcement ring (10) for capsules for obtaining beverages, for example espresso coffee, comprising a side wall (1) and a flat surface, preferably having a uniform thickness (2), protruding from the side wall (1), wherein the side wall (1) and the protruding flat surface (2) are made in a single body and wherein the side wall (1) comprises reduced thickness areas (3), so as to reduce the total amount of material used for the production of the ring. A capsule for obtaining beverages comprising such a reinforcement ring (10) is also provided.
US10882675B2
A methodology and product or system configurations are provided which allow food to be directly irradiated for cooking applications which involve the impingement of direct radiant energy on food or comestible items. Cooking vessels or cook-packs are used that are optically transmissive in visible or infrared narrow wavelength bands emitted in suitable narrowband cooking or heating systems.
US10882666B2
Containers with closures are disclosed. A closure may include at least a polymer orifice reducer configured to be permanently secured to a rim of an opening of a container and a flexible tamper evident seal disposed on the topside of the orifice reducer. The flexible tamper evident seal, optionally foil, covers one or more openings in the orifice reducer. Processes for permanently securing a closure to a container, optionally by forming a heat seal between the orifice reducer and container rim, are also disclosed.
US10882665B1
A plastic slider zipper is disclosed which includes a pair of plastic zipper strips with ends melted together to form an end piece with a predetermined thickness, a slider slidably engaging the pair of plastic zipper strips with two side walls and a plow, a first gap between the two side walls near a first end of the slider being small enough to squeeze the zipper strips into an interlocking position, the plow located between the two side walls being able to separate the interlocked zipper strips, a top of the slider having an opening near a second end of the slider, the second end being opposite to the first end, and a fork-like part removably inserted in the opening, the fork-like part having two columns with a space therebetween approximately matching the predetermined thickness for the two columns to straddle the end piece.
US10882662B2
A foldable liquid container includes a foldable supporting frame, a foldable container body arranged on the foldable supporting frame, and a switch device arranged on the foldable supporting frame to be operated to transform the foldable supporting frame between an unfolded mode and a folded mode in a single puling operation. The foldable container body is able to be folded with the folding of the foldable supporting frame. The foldable supporting frame is supported and secured in the unfolded mode by means of the switch device, wherein the switch device can be operated to release the engagement of the foldable supporting frame while transforming from the unfolded mode to the folded mode.
US10882659B2
An apparatus for forming monolithic compressed wood pallets with increased load capacity includes a storage component having a chamber for collecting the mixture, inside which a first conveyor belt is accommodated for feeding a uniform layer of mixture toward an outlet. The first belt is wound around at least one motorized roller and entrained by it with a feed speed. The apparatus also includes a pressing component with a lower mold part and an upper mold part between which a receptacle for forming a pallet is provided. A second conveyor belt is interposed between the storage component and the pressing component. The apparatus further includes a component for modulating at least one among feed speed, the advancement speed, and the translation speed so as to obtain adjustment of quantity of mixture loaded/unloaded on/from upper portion of the second belt along an extension of the mat.
US10882653B2
A packaging machine that may include a protective cover and a token fastening capsule arranged on the protective cover. The protective cover may include a receptacle that is configured for receiving a token. The receptacle may have a first contact surface. The fastening capsule may include a cap for covering an opening of the receptacle and that includes a second contact surface. The first contact surface and the second contact surface may be in contact with each other when the cap covers the opening of the receptacle. In one embodiment, the receptacle and/or the cap is provided with a knurl, the knurl being provided on the first or the second contact surface. Further, a method of fastening a token on a protective cover is presented wherein the receptacle may be cold welded to the cap in view of the structure provided above.
US10882652B2
A method for producing packaging, in particular tubular bags, by means of a packaging machine (1) having a PLC control (20). The packaging machine (1) includes several electronic drive units (3, 6) capable of being controlled independently of each other by the PLC control (20) and which can drive the different functional elements (8) of the packaging machine (1) in a manner synchronous to a clock cycle when trailing predefined movement trajectories, and several setting parameters of the production process, in particular the number of objects to be packed per time unit, the packaging dimensions, the sealing times, being predefined, the capturing of the setting parameters at the PLC control (20), which controls the drive units (3, 6) of the packaging machine (1), being followed by the transfer of the setting parameters from the PLC control (20) to a PC control (23).
US10882649B2
A drive unit for a strapping device strapping an item to be packed with a plastic tape which is laid around it includes a motorized tensioning device and a motorized welding device for the plastic tape. The tensioning and welding device can be driven by the same electric motor which can be brought alternatively into an operative connection with the devices with freewheels connected therebetween. A problem has occurred in drive units of this type that they are relatively complicated to assembly and have problematic operational reliability under certain boundary conditions. To bypass these problems, the electric motor includes at least one shell extension which protrudes beyond it at one axial end with the result that the drive elements which have up to now been mounted separately in the housing of a strapping device can be supported directly on the electric motor which then acts as a drive unit.
US10882645B2
The Guideless Resilient Androgynous Serial Port (GRASP) mechanism provides an androgynous mechanical and electrical interface that can be tailored to the meet the requirements of a given application. Each mechanism is equipped with physical connections (spring pins) for both power and data transmission between modules.
US10882638B2
Provided are technologically improved adaptive ground safety lighting systems and related methods. The method includes receiving cockpit data providing a weight on wheels (WOW) indicator, an off-runway indicator, an engine off indicator, and an engine temperature, and receiving, from a connected-light assembly comprising a plurality of connected lighting edge nodes, a respective temperature measurement and wind measurement. Upon determining that there is a concurrent occurrence of (a) WOW indicator asserted, (b) off-runway indicator asserted, and (c) engine off indicator asserted, an environmental map around the aircraft is constructed, and a dissipation timer is started. A caution volume surrounding the engine is generated based on the heat dissipation factor of the engine and other received data, and the plurality of lighting edge nodes are illuminated in accordance with the caution volume.
US10882629B2
An aircraft propulsor that includes a load bearing moveable panel is described herein. In one example, the moveable panel can be coupled to a propulsor structure to receive loads from the propulsor structure. Such loads can include roll and/or torque loads generated by rotation of a core engine of the aircraft propulsor. The moveable panel can be coupled to the propulsor structure through a plurality of coupling portions on one or both of the moveable panel and the propulsor structure.
US10882621B2
An air gasper (air) for a vehicle includes an air inlet (26), a first housing (24) disposable through a panel in the vehicle (12), the first housing (24) being connected to the air inlet (26), a second housing (70) disposed within the first housing (24), an air outlet (72) disposed within the second housing (70), downstream of the air inlet (26), and a first mechanism (102, 70) connected between the first housing (24) and the second housing (70). The first mechanism (102, 70) permits the second housing (70) to be stowed within the first housing (24) in a stowed position and also permits the second housing (70) to extend outwardly from the first housing (24) in a deployed position.
US10882619B2
A cabin arrangement for a vehicle includes a first lateral segment module having a first main extension axis, a second lateral segment module having a second main extension axis, and an aisle. The main extension axes run parallel to each other, wherein the first lateral segment module and the second lateral segment module are distanced from each other in a direction perpendicular to the main extension axes and enclose the aisle between each other. The aisle runs parallel to the main extension axes, and the first lateral segment module has a receiving space that receives serving trolleys. The receiving space has an opening that faces into the aisle. The receiving space is designed to receive serving trolleys arranged transverse to the first main extension axis and staggered parallel to the first main extension axis.
US10882618B2
A multifunctional container system for producing a container for a cargo compartment of an aircraft includes a first lateral container component, which forms a first lateral surface of the container that is at least partially beveled, a first lower resting surface having first fastening devices and a first top side, a second lateral container component, which forms a second lateral surface of the container that is at least partially beveled, a second lower resting surface having second fastening devices and a second top side, and a floor cladding. The cladding is selectively positionable between the first resting surface and the second resting surface, which enclose a continuous gap to each other and comprise a predetermined distance to each other and to create a protrusion that faces away from the first and second top side. The protrusion extends into a recess of a floor in a cargo compartment.
US10882615B2
The present disclosure provides a multi-rotor Aerial Vehicle comprising at least five arms. Pairs of coaxial contra rotating rotors/propellers are configured on each arm defining a polygon. In the event of failure of any one of the rotors/propellers, a control system incorporating an autopilot, shuts off corresponding contra rotating rotor/propeller of the pair to maintain yaw stability thereby rendering the corresponding arm non-functional; and adjusts throttles of the coaxial contra rotating rotors/propellers of remaining functional arms to maintain tilt and lift stability of the Aerial Vehicle.
US10882614B2
A transport drone includes: a drone body; a transport unit for carrying an object to be transported; a balancing unit comprising a balancing frame and a swinging device, wherein the balancing frame is connected to the transport unit; the swinging device is respectively connected to the balancing frame and the drone body; the swinging device has rotational freedom; a sensor placed on the balancing frame for detecting a tilt angle of the balancing frame; and a controller electrically connected to both the sensor and the swinging device, wherein the controller controls rotation of the swinging device according to the tilt angle detected by the sensor, so as to adjust the tilt angle of the balancing frame and keep the transport unit in a horizontal state. The transport drone ensures that the items to be transported are in a horizontal state, effectively preventing dumping or damage of the items.
US10882613B2
A device can include an unmanned aerial vehicle (UAV) frame physically connected to a UAV, two or more support arms connected to and extending from the frame, a first servomotor coupled to a first support arm and providing rotatable movement of the first support arm in a first plane; a second servomotor coupled to a second support arm and providing rotatable movement of the second support arm in a second plane, a second frame connected to the support arms, and an end effector connected to the second frame.
US10882610B2
A braking system for a rotorcraft having a rotor hub assembly includes a generator having an armature mechanically coupled to the rotor hub assembly such that the armature is rotatable in response to rotation of the rotor hub assembly and a braking unit in selective electrical communication with the generator. The braking unit is adapted to apply an electrical resistance to rotation of the armature, thereby reducing a rotational speed of the rotor hub assembly.
US10882606B2
An aerodynamic device for enhancing lift and reducing drag on a body, comprising a plurality of raised members, each having a symmetric profile and including a central portion having an elongated profile, and first and second outer portions having elongated profiles and arranged substantially parallel to and on opposing sides of the central portion, wherein the plurality of raised members are situated adjacent one another to form a continuous structure on or defining at least a portion of a surface of the body and oriented such that the raised members are substantially aligned with a direction of localized flow on the body. An aerodynamic device for enhancing lift and reducing drag of a flying disc, wherein the plurality of raised members are situated adjacent one another to form a continuous structure and the raised members are oriented in a substantially circumferential direction on the surface of the flying disc.
US10882605B2
The present invention provides a riblet structure that further reduces drag, which is a sum of turbulent friction drag and pressure drag, and an object including such a riblet structure. An object such as an aircraft, plant, and pipeline includes a wavelike riblet pattern on a surface. The wavelike riblet pattern includes a large number of wavelike riblets. Each of the large number of wave riblets includes a wavelike ridge line, and a height thereof changes cyclically with respect to a fluid flow direction. With such a configuration, drag, which is a sum of turbulent friction drag and pressure drag, can be further reduced.
US10882602B2
A fairing is provided in one example embodiment and may include a first edge portion to provide a first clearance distance between the fairing and rotor flight controls of a rotorcraft; a second edge portion to provide a second clearance distance between the fairing and the rotor flight controls of the aircraft, wherein the second clearance distance is greater than the first clearance distance; and a support structure attached to the fairing below the second edge portion. A rotorcraft is provided in another example embodiment and may include a fairing in which the fairing can include a handhold portion along an edge of the fairing. The handhold portion can include a handhold clearance distance between the handhold portion and rotor flight controls of the rotorcraft; and a support structure attached to the fairing below the handhold portion.
US10882593B1
A peller device with a flap is an apparatus used to enhance the capabilities and efficiency of water circulation and aeration systems. The apparatus is configured to act as both a propeller and an impeller as necessary for a particular water circulation requirement. A flap is an addition to the blade tip which propels a fluid by pushing against the fluid, thus enabling the peller to function as a propeller. In addition, the flap facilitates the generation of a sucking force so the peller can also function efficiently as an impeller. The peller assembly can be encased in circular housings having a vertical axis in which the peller assembly is mounted for rotation on the central axis of the housing. The peller assembly is formed with a hub and a plurality of blades symmetrically positioned around the hub. The flap of the apparatus is attached to the base of the peller assembly.
US10882592B1
A low frequency underwater sound source for use in an autonomous underwater vehicle includes a cylindrical body having a front portion, a rear portion, a cylindrical piezo-ceramic ring transducer disposed therebetween, and a resonant pipe surrounding the transducer. A gap is formed between an inner surface of the pipe and an outer surface of the transducer. Alternatively, the sound source includes a cylindrical body, a front fairing disposed forward of the cylindrical body, a plurality of metal rods connecting the front of the cylindrical body and the rear of the fairing, a spherical piezo-ceramic transducer disposed between the cylindrical body and the fairing, and a resonant pipe mounted at the front end of the cylindrical body. The spherical transducer is disposed within a cavity within the resonant pipe. A cylindrical orifice is formed between the front end of the resonant pipe and the rear of the fairing.
US10882584B2
A hydraulic operating device comprises a base member, an operating member, and a piston. The base member includes a first end portion, a second end portion, a cylinder bore, a first hose-attachment hole, and a second hose-attachment hole. The second end portion is opposite to the first end portion. The first hose-attachment hole is configured to be in fluid communication with the cylinder bore. The second hose-attachment hole is configured to be in fluid communication with the cylinder bore. The operating member is pivotally coupled to the base member at the first end portion about a pivot axis. The first hose-attachment hole and the second hose-attachment hole are provided closer to the pivot axis than the second end portion.
US10882580B2
A bicycle component mounting device comprises a base member, a holding member, a movable member, and a guide structure. The base member includes a mounting portion. The holding member is movably mounted to the mounting portion. The movable member is movably mounted relative to the base member to push the holding member relative to the mounting portion. The guide structure is configured to guide the holding member relative to the mounting portion in a guide direction inclined relative to a longitudinal axis in response to a movement of the movable member. The guide structure includes a recess and a protrusion. The recess is provided at one of the mounting portion and the holding member. The protrusion is configured to be disposed in the recess and provided at the other of the mounting portion and the holding member.
US10882573B2
A towing device for an automatic guided vehicle that tows a carriage is disclosed. The towing device includes a connecting member, one end of which is connected to the automatic guided vehicle, and a hook member connected to the other end of the connecting member. One end of the connecting member is swivelably connected to the automatic guided vehicle. A swivel shaft axis line of the connecting member and a swivel shaft axis line of a drive unit of the automatic guided vehicle are configured to be coaxial.
US10882571B2
One embodiment comprises a fairing assembly adapted to couple to a vehicle, the assembly comprising: a support arm mountable to a frame rail of a vehicle and a fairing adapter adapted to mount a fairing to the support arm. The fairing adapter is rotatably coupled to the support arm and is rotatable from a first orientation corresponding to an aerodynamic position to a second orientation corresponding to a first access position. The fairing adapter may also be rotatable to a third orientation corresponding to a second access position. The assembly further comprises a manually releasable lock to lock the fairing adapter in the first orientation and releasable to allow the fairing adapter to rotate to the second orientation or the third orientation.
US10882566B2
A track work vehicle includes a track system including a drive wheel supported by an axle housing that drives a continuous ground-engaging track, a saddle assembly that guides the track about the drive wheel and an undercarriage frame that supports one or more idler wheels that guide the track along a ground surface. The track work vehicle further includes a fender assembly that includes at least one fender coupled to the axle housing to overlap a portion of the track.
US10882556B2
A bushing for an independent suspension assembly, said suspension assembly being adapted to pivot relative to a trailer or a vehicle frame, the bushing comprising: a sleeve body having a substantially cylindrical outer surface for engaging the suspension assembly; and an inner bore of the sleeve body extending along a first longitudinal axis, said first axis being eccentrically disposed with respect to a second longitudinal axis of the cylindrical outer surface; wherein during use the bore is adapted for engaging a spindle and allowing the suspension assembly to pivot relative to the spindle.
US10882552B2
A control method of a rear wheel steering system prevents a sudden change in a rear wheel steering control amount when an error occurs in a wheel speed sensor. The control method detects an error in wheel speed sensors based on output values of the wheel speed sensors. A vehicle speed is estimated by using output values of remaining normal wheel speed sensors except for an output value of an abnormal wheel speed sensor where an error is detected, when an error in the wheel speed sensor is detected. Rear wheels are steered and controlled based on the estimated vehicle speed.
US10882549B2
To provide a gear housing comprising a front housing having a structure which can make the front housing lightweight and which can increase the strength of a continuous section of a worm wheel housing portion and a support portion where stress tends to be concentrated. A front-side housing is made of synthetic resin, and includes a housing front plate portion which constitutes a worm wheel housing portion and a support portion integrated with the housing front plate portion. A reinforcing member made of a metal plate is provided at a corner portion between a front surface of the housing front plate portion and a lower surface of the support portion.
US10882545B2
Exemplary embodiments of an expedition cart are provided. The expedition cart includes a chassis configured and dimensioned to support a load. The expedition cart includes first and second gusset plates attached to the chassis. Each of the first and second gusset plates includes a central body portion and curved fastening edges on either side of the central body portion. The curved fastening edges can be configured and dimensioned to mate against at least a portion of the chassis. Exemplary embodiments of an expedition cart are also provided that include first and second hubs engaged with the chassis, the first and second hubs defining either a single part or a two part design.
US10882541B2
The invention relates to a height control mechanism for a rail vehicle comprising suspension units that are arranged between the body and the bogie of the rail vehicle and that each comprise a spring, a pneumatic or a hydraulic reciprocating piston element. In accordance with the invention, the reciprocating piston element is retracted so much in train operation that it does not bridge the spacing between the body and the bogie.
US10882537B2
Various technologies described herein pertain to causing presentation on a user interface of an immediate portion of a navigation route of an autonomous vehicle. A computing system of the autonomous vehicle determines whether an object detected by sensor(s) of the autonomous vehicle proximate to the immediate portion of the navigation route are of a type and relative position defined as one of consequential and inconsequential for a human passenger. In response to determining that an object has both a type and relative position defined as consequential, the computing system causes presentation on the user interface a representation of the object relative to the immediate portion of the navigation route to provide a confidence engendering indication that the autonomous vehicle has detected the object. Otherwise if inconsequential, presentation on the user interface of any representation of the object is not caused by the computing system to avoid creating a confusing presentation.
US10882536B2
An autonomous driving control apparatus that informs the driver of a departure of a front vehicle may include a front vehicle recognition device configured to recognize behavior information related to a front vehicle, a driver monitoring device configured to detect whether a driver is gazing at a front side thereof, and a processor configured to determine a time point of notification of a departure of the front vehicle in consideration of whether the driver is gazing at the front side thereof and the behavior of the front vehicle when recognizing the departure of the front vehicle through the front vehicle recognition device while a host vehicle and the front vehicle are stopped.
US10882525B2
Systems and methods for operating an engine with deactivating and non-deactivating valves are presented. In one example, an actual total number of deactivated cylinders may be adjusted to control driveline braking. The driveline braking may be controlled in a towing mode, a hill descent mode, and during normal driving conditions.
US10882516B2
Disclosed is a collision avoidance assisting apparatus which can execute an automatic braking process and an automatic steering process for avoiding collision with an obstacle. When the magnitude of a steering angle exceeds a predetermined threshold, the collision avoidance assisting apparatus determines that a driver has an intention of avoiding the collision by a steering operation and stops the automatic braking process and the automatic steering process. However, in such a case, the automatic braking process and the automatic steering process may be stopped when the steering angle exceeds the threshold as a result of execution of the automatic steering process. In view of this, when both the automatic braking process and the automatic steering process are being executed, the collision avoidance assisting apparatus continues the automatic braking process and the automatic steering process even when the magnitude of the steering angle is greater than the predetermined threshold.
US10882513B2
A hybrid vehicle is provided. A vehicle V has a gasoline particulate filter (GPF) provided on an exhaust passage to capture particulate matter (PM) included in exhaust, a generator motor connected to a crank shaft of an engine, an exhaust temperature sensor acquiring a filter temperature correlated with a temperature of the GPF, and an electronic control unit (ECU) performing motor drive control for rotating the crank shaft with the generator motor when a filter temperature is higher than or equal to a PM combustion start temperature and a PM combustion integration amount that is an integration amount of PM combusted in the GPF is less than a PM discharge integration amount.
US10882512B2
A drive system for a hybrid vehicle and a method of operation of the drive system are provided. The drive system includes an internal combustion engine having a shaft, a vehicle transmission having a transmission input shaft and an output shaft, a transmission clutch between the transmission input and output shafts, an inertia-mass drive unit arranged between the internal combustion engine shaft and the transmission input shaft, a first clutch between the internal combustion engine shaft and inertia-mass drive unit and a second clutch between the inertia-mass drive unit and the transmission input shaft; and an electrical machine torque-transmittingly connected to the transmission input shaft. The inertia-mass drive unit may include rotational oscillation reduction device. Operation of the first, second and transmission clutches in coordination with electric motor and engine operation provides multiple operating modes while minimizing operator disturbance during transitions between engine deactivated and activated states.
US10882507B2
A vehicle having a drive motor is provided. The vehicle includes a controller that changes the inclination of a drive motor torque command based on a demand torque of a driver or a temperature of a drive motor. A motor controller then operates the drive motor to change the motor torque changes based on the inclination of the motor torque command.
US10882505B1
A brake cable includes joining member including a hollow body having external threads, an externally extended rim at an end, and a channel through the body; a fastening member including an internal space having internal threads, a hollow extension extending out of a first end, a tunnel through the extension to communicate with the space, and an annular surface on a first end of the space adjacent to the extension; a sealing assembly urged against the annular surface; a cable assembly including a flexible sleeve having an outer annular flange; and an oil tube having a first end secured to the extension. The cable assembly is through the oil tube. Both the joining member and the fastening member are configured to compress the sealing assembly so as to urge the sealing assembly against the annular surface for preventing lubricant from leaking.
US10882500B2
A system for detecting aircraft brake failure using retract braking may comprise a landing gear including a wheel, a brake coupled to the wheel, and a wheel sensor coupled to the wheel. A brake controller may be coupled to the brake and the wheel sensor. The brake controller may be configured to receive a begin retract braking signal, command the brake to apply a braking force to the wheel, calculate a wheel speed characteristic using data from the wheel sensor, and determine whether the wheel speed characteristic indicates a failure of the brake.
US10882495B2
An aspect of the invention refers to a system for cleaning an external vehicle-mounted sensor surface. The system comprises an air nozzle arranged to discharge air onto a sensor surface; an air pump comprising a fluid inlet, an air outlet, an air-fluid interface and a variable volume compression chamber communicated with the air outlet; an air flow control device communicated with the air nozzle and the air outlet for controlling the flow of air therethrough; and a liquid pump communicated with the fluid inlet to supply a flow of pressurized liquid such that the volume of the compression chamber varies to generate a volume of pressurized air with an absolute pressure below 10 bar.
US10882493B2
A system provides a personalized and secure user experience to access a secured asset, such as a vehicle. A first communication is transmitted, and a second communication is received in response to the first communication. An approach vector is determined based on the first communication and the second communication. The approach vector is compared with a known approach vector, a request for authentication is transmitted based on the comparison. A response to the request for authentication is received, and access to an asset is granted based on the approach vector and the response to the request for authentication.
US10882490B2
A control method for an electric seatbelt retractor and an electric seatbelt retractor including a spindle (2) and a seatbelt (3) wound thereon, and an electric motor (4) driving the spindle (2) via a rotor (3) in pull-in or in pull-out direction when activated, and a sensor device (10) detecting the movement of the spindle (2), wherein a spring (11) is provided, which is arranged between the spindle (2) and the rotor (3) enabling a relative movement of the spindle (2) to the rotor (3) or to a retractor-fixed part, wherein the electric motor (4) is controlled by a signal of the sensor device (10) generated by the relative movement of the spindle (2) to the rotor (3) or a retractor-fixed part with torsional tensioning or expanding the spring (11).
US10882488B2
An autonomous robot vehicle includes a front side and an energy absorbing system. The front side includes a front bumper and a front face including a frame defining a cavity. The energy absorbing system includes an energy absorbing member mounted in the cavity of the frame, and an inflatable airbag. The energy absorbing member is configured to reduce impact on an object struck by the autonomous robot vehicle. The inflatable airbag is mounted on the front side of the autonomous robot vehicle such that when the inflatable airbag is deployed, the inflatable airbag is external to the autonomous robot vehicle.
US10882487B2
A vehicle including an instrument panel, a front seat rotatable between a forward-facing position and a rearward-facing position, and an airbag inflatable between the instrument panel and the front seat. The vehicle includes a controller including a processor and a memory storing processor-executable instructions wherein the processor is programmed to identify that the front seat is rearward-facing, inflate an airbag in response to a sensed frontal impact, and open an external vent in the airbag during inflation in response to identification that the front seat is rearward-facing.
US10882482B2
The inner side of the crush can 4 in the vehicle width direction extends forward relative to the outer side. The inner side of the crush can 4 in the vehicle width direction is formed with the cutout portions 70 to 73 by cutting off a part of a material.
US10882478B2
Devices, systems, and methodologies for providing a comfort system of a transportation vehicle include capturing and assessing movement data of a user. The movement data can include movement data captured upon the user's approach to the transportation vehicle.
US10882476B2
A vehicular circuit body includes a plurality of backbone control boxes, a backbone trunk line portion connecting the backbone trunk line portions to each other, and a branch line sub-harness. A trunk includes has a power source line and a communication line, and a control includes a trunk line connection portion and a branch line connection portion.
US10882471B2
Even when a positive/negative surge is applied to a power-supply line, occurrence of malfunction in a semiconductor device is lessened. In an in-vehicle semiconductor device, regulators convert an externally-supplied voltage to generate voltages. A voltage monitoring unit includes a voltage monitoring circuit and a switch, and monitors first to third voltages. An internal circuit has a processor operated by the voltage, and an oscillator operated by the voltage and generating a clock signal to be provided the processor. The voltage monitoring unit stops providing the clock signal to the processor when the voltage level of at least any one of the first to third voltages is below a set value. The voltage monitoring unit provides the clock signal to the processor when the voltage levels of all the first to third voltages exceed the set value.
US10882468B1
A composite panoramic vision system utilized onboard a work vehicle includes a display device, a vehicle-mounted camera array, and a controller. The vehicle-mounted camera array includes, in turn, first and second vehicle cameras having partially overlapping fields of view and positioned to capture first and second camera feeds, respectively, of the work vehicle's exterior environment from different first vantage points. During operation of the composite panoramic vision system, the controller receives the first and second camera feeds from the first and second cameras, respectively; generates a composite panoramic image of the work vehicle's exterior environment from at least the first and second camera feeds; and then presents the composite panoramic image on the display device for viewing by an operator of the work vehicle.
US10882460B2
Disclosed is an extension tube-type vehicle-mounted back support comprising a mounting rod and a mounting part mounted on the mounting rod and used for fixing a mobile terminal. The mounting rod comprises a connector and two connection tubes respectively connected to the left and right ends of the connector, wherein outer ends of the two connection tubes are both connected to a clamping part, an extension spring is provided inside at least one of the connection tubes, and the corresponding clamping part is arranged in a manner of shifting to the left and right relative to the connection tube with the action of the extension spring. The overall structure of the mounting rod is simple and compact and has good stability. By designing the mounting rod as an elastically extending structure, the mounting rod can be directly installed on a vehicle seat headrest metal rod.
US10882448B2
A method, a device and a computer-readable storage medium with instructions for identifying an exit side of a motor vehicle. In a first step, the existence of an exit situation is detected. If an exit situation exists, an exit side of the motor vehicle is ascertained. Finally, the opening of a door is simulated on the ascertained exit side. For example, a brightness can be increased on the ascertained exit side, outside sounds can be reproduced, or an air stream can be generated.
US10882444B2
A control system for controlling operation of a vehicle system is described. The control system includes a trim cover textile configured to cover at least a portion of a vehicle component and having an electrically conductive element configured to provide a capacitive touch functionality. In response to a user touch, the electrically conductive element generates a signal representative of a user command for the vehicle system. The system also includes a control unit adapted to be provided in electrical communication with the electrically conductive element of the trim cover. The control unit is configured to receive the user command signal and, in response, generate a control signal to effectuate control of the vehicle system.
US10882442B2
An illuminated spare tire cover, designed to enclose an externally mounted spare tire, has an outer covering with a plurality of grommeted openings therethrough. The openings form a pattern. An electric light is located within each opening, such that a lighted image is created through the pattern when the lights are illuminated. Strips of Velcro® hold the lights in place. The lights can be configured as various images, logos, symbols, lettering, etc. An internal layer made of non-flammable material fits over the interior surface of the outer covering to insulate and support the cover and reinforce the lights located within the interior surface of the outer covering. The cover is equipped with electrical wiring and an electrical connector plug. An extension cord is connected to the vehicle's electrical outlet and run under the vehicle's seats to be connected to the electric connector plug.
US10882438B2
A drive assembly utilized in combination with slide out includes a beam attached to a beam guide in an arcuate support rail that is attached to the slide out. The beam may have a first row of teeth and a second row of teeth thereon, where the first row of teeth and the second row of teeth extend parallel to each other on opposite sides of the beam. In addition, the teeth in the first row of teeth are offset relative to the teeth in the second row of teeth. The drive assembly further includes a drive gear having a first gear wheel that engages the first row of teeth and a second gear wheel that engages the second row of teeth, as well as an actuator coupled to the beam to selectively extend and retract the beam. The beam may deflect with respect to the arcuate support rail based on its location and the location of the beam guide to aid in leveling of the slide out.
US10882432B1
Apparatus and methods are provided for a modular vehicle seating system. In one embodiment the seating system has a universal center module that is mountable to a seating position in a vehicle and includes seat pan and seat back portions. The seating system may further include a matched pair of modular side bolsters selectable from an assortment of matched pairs of side bolsters, where each matched pair has a particular physical property defined by a unique value in a range of values of the physical property in the assortment. The side bolsters are detachably connectable to the to left and right sides of the universal center module with fasteners.
US10882427B2
Seat assemblies and methods for fabricating seat assemblies are provided. In one example, a seat assembly includes a seat base portion. A seat backrest portion is configured to extend substantially upright from the seat base portion. An armrest sub-assembly is configured to move between a stowed position that is one of substantially within and laterally adjacent to the seat backrest portion and an extended position that is generally forward of the seat backrest portion. At least a portion of the armrest sub-assembly translates along an incline relative to the seat base portion during movement from the stowed position towards the extended position.
US10882418B2
A method for classifying an occupant and providing the occupant classification for a safety device in a motor vehicle. The method includes reading in a first piece of information that indirectly describes the occupant; reading in a second piece of information that directly describes the occupant; classifying the occupant, taking the indirect and direct information into account; and providing the occupant classification to an interface to the safety device for the vehicle. A corresponding device is also described.
US10882416B2
An apparatus comprising an interface, a memory and a processor. The interface may be configured to receive (i) sensor data samples during operation of a vehicle and (ii) data from a telemetry system. The memory may be configured to store the sensor data samples over a number of points in time. The processor may be configured to (i) analyze the sensor data samples stored in the memory to determine (a) operational parameters of the vehicle and (b) information associated with a second vehicle and (ii) adjust the operational parameters in response to the information associated with the second vehicle. The data from the telemetry system and the information associated with the second vehicle may be used to determine an amount of space between the vehicle and the second vehicle. The operational parameters may be adjusted to keep the amount of space within a pre-determined range.
US10882412B2
A modular, integrated charging system and method for fast charging of a battery of an electric vehicle (EV) include an under-ground stationary battery storage system and an above-ground charging station, which is operatively connected to an AC grid and a solar panel. The EV's battery may be charged using little or no grid capacity by prioritizing and managing power production and use based on loading and pricing in real time.
US10882410B2
An example embodiment includes a landing pad having a housing and a power terminal configured to draw electric power from a power source. The landing pad further includes an electrically conductive landing terminal dorsal to the housing and configured such that, during a landing state of an aerial vehicle, the landing terminal makes contact with a plurality of electric contacts disposed ventrally to a fuselage of the aerial vehicle. The landing terminal is configured to transfer electric power drawn by the power terminal to the aerial vehicle via the electric contacts during the landing state of the aerial vehicle.
US10882409B2
An onboard charging system includes an onboard battery, a vehicle-side coupling unit, a heat exchanger, a controller, and a charger. The onboard battery that is configured to be mounted on a vehicle and used to drive the vehicle. The vehicle-side coupling unit that is configured to make a charging current path to an outside-vehicle power feeding apparatus by being coupled to an apparatus-side coupling unit of the outside-vehicle power feeding apparatus. The heat exchanger that is provided in the vehicle-side coupling unit and configured to perform heat exchange between the vehicle-side coupling unit and the apparatus-side coupling unit. The controller that is configured to perform ON/OFF control of a function of the heat exchange performed by the heat exchanger. The charger that is configured to charge the onboard battery by using the charging current path.
US10882403B2
Systems or methods for testing performance of an isolation monitor for a vehicle having a high voltage traction battery electrical system isolated from a low voltage electrical system include a device for connecting to an isolation/leakage monitor under test. The device includes a current leakage bus, a current leakage array, and a current leakage destination with associated switching elements automatically controlled by a programmed microprocessor to introduce various leakage impedances to a second voltage source or ground and to evaluate performance of the isolation/leakage monitor under test.
US10882392B2
A pipe of a fuel cell system includes a pipe, one end side of which is connected to a fuel cell stack, and another end side of which is positioned adjacent to a vehicle structural component, through which water, and discharge air of a product that contains water vapor, which are produced by the fuel cell stack, flow; and a spray portion that is provided on the other end side of the pipe, and that sprays the water and the discharge air flowing through the pipe onto the vehicle structural component.
US10882391B2
A modular CRFM upper bracket assembly providing a universal carrier operatively associating an isolator to a bracket. The isolator may be over-molded with the universal carrier or press-fit thereto. The bracket provides a carrier opening with interior threading, while universal carrier provides exterior threading dimensioned and adapted to engage the interior threading, whereby the elevation of the universal carrier, and thus isolator, relative to the bracket is adjustable through selective engagement of the threading. Thereby, the gap between the top of a vibratory object to be isolated and the bottom of isolator is also adjustable, which is advantageous for accommodating different frame tolerance variations and meeting system vibrational requirements.
US10882389B2
An axle assembly (200) includes a first axle housing (102), a second axle housing (104), a first wheel end (216), a second wheel end (218), and at least one drive shaft (150) extending through the first axle housing (102) and the second axle housing (104) and coupled to the first and second wheel ends (216, 218). The axle assembly (200) also includes a gearbox (210) having a body (240) with first and second portions (242, 244) defining a cavity (246) with the first axle housing (102) coupled to the first portion (242) and the second axle housing (104) coupled to the second portion (244). The axle housing (200) further includes an electric motor (122) coupled to the first portion (242) of the body (240). The gearbox (210) includes a gear train (153) having an input shaft (160) having one end coupled to the electric motor (122) and an output shaft (172) rotatably coupled to the input shaft (160). The gear train (153) further includes a clutch (174) having a shifting fork (178) movable between an engaged state and a disengaged state to couple the output shaft (172) to the drive shaft (150) such that the electric motor (122) drives the drive shaft (150) and to uncouple the output shaft (172) from the drive shaft (150) such that the drive shaft (150) is able to rotate independently from the electric motor (122).
US10882385B2
The present invention relates to a cover apparatus for a truck cargo box, and more specifically to a cover apparatus for a truck cargo box, which enables stable opening and closing operations even when deformation occurs due to the deflection or warping of a truck cargo box and enables its covers to stably cover irregularly shaped loads, such as various types of wastes or scraps, thereby considerably improving transportation safety and the convenience of use. According to the present invention, there is provided the cover apparatus for a truck cargo box, which enables stable opening and closing operations via the hinges and the variable members, and enables its covers to stably cover irregularly shaped loads via the covers in each of which the plurality of blocks is connected to each other, thereby providing the effect of considerably improving transportation safety and the convenience of use.
US10882379B2
System and methods are provided for improving fuel economy, and providing optimized operating conditions associated with a vehicle's air-conditioning system when the vehicle is carrying a load, e.g., towing a trailer. Operating conditions including, for example, air-mix setting, coolant temperature, ambient temperature, vehicle speed, and whether or not the vehicle is carrying the aforementioned load, may be considered when determining whether or not to activate or deactivate a vehicle heating element, such as a positive temperature coefficient (PTC) heater, steering wheel heater, etc.
US10882374B2
An air suspension system, comprising a manifold, defining a first and second port, each port defining a receiving region at the second end, wherein the first and second ports are arranged in a common plane, a channel intersecting the first and second port, a cavity intersecting each port, and a pressure sensor port, positioned between the first and second port, defining a sensor insertion axis normal to the common plane, the pressure sensor port separated from the first port, the second port, and the channel by a thickness; a first and second solenoid valve, each solenoid valve arranged within the cavity and coaxially arranged with the first and second ports, each solenoid valve comprising a connector; a pressure sensor arranged within the pressure sensor port, the pressure sensor comprising a connector; and an electronics module arranged parallel the common plane, the electronics module configured to electrically couple to the connectors.
US10882368B2
This amphibious vehicle is provided with a body (11), a traveling device (12) that causes the body (11) to travel on land, a sailing device (13) that causes the body (11) to sail on water, a front flap (31) of which the distal end is inclined upward and the proximal end is rotatably supported by a horizontal shaft (34) on the front end of the body (11), a hydraulic damper (32) serving as a damping member that damps displacement of the front flap (31) relative to the body (11), and a compression coil spring (33) serving as a restoring member that restores the position of the front flap (31) relative to the body (11).
US10882366B2
A method for operating an electronic wheel unit disposed on a vehicle wheel of a vehicle includes providing the electronic wheel unit with a detecting device for detecting rotation angle positions of the vehicle wheel that are present at certain detection times, and a radio transmitter device for transmitting a sequence of individual electromagnetic signals which include data representative of the detected rotation angle positions and their associated detection times. The detecting device is further used to detect an amount of a wheel acceleration of the vehicle wheel and to set an interval of time between the detection times of the rotation angle positions to be shorter the greater the amount of wheel acceleration. A corresponding electronic wheel unit and a method and an apparatus for localizing respective installation positions of a plurality of such electronic wheel units on a vehicle are also provided.
US10882356B2
A tire includes a circumferential tread, a pair of beads, and a pair of sidewalls. The tire further includes a plurality of circumferential belts disposed below the circumferential tread and extending in an axial direction. The plurality of circumferential belts include a lower belt and an upper belt. The tire also includes at least one gum strip. The at least one gum strip has a first portion in contact with a top surface of the lower belt and a bottom surface of the upper belt. The at least one gum strip has a second portion disposed below the lower belt.
US10882353B2
A vehicle wheel has spokes, on which cover elements are provided for a space between the spokes. The cover elements deform according to the temperature in such a way that, at higher temperatures, a passage of air through a region of the space between the spokes is possible, which is covered by the cover element at lower temperatures. In this way, the cover elements do not entirely cover the respective spaces between the spokes, and a rigid cap element is provided per intermediate space in addition to a cover element deforming according to the temperature. Alternatively, two cover elements are provided in each space between the spokes, next to one another in the circumferential direction of the wheel, wherein in the deformed state, one of the cover elements is curved outwards and the other cover element is curved inwards towards the vehicle.
US10882346B2
An ink jet recording apparatus of a line-recording-head type includes one or more recording heads using the same ink and performs recording of an image by conveying a recording medium using multiple passes through a recording region of the recording head while the recording medium is repeatedly conveyed backward and forward to speed up recording and improve image quality. A recording head is controlled to provide that an amount of ink applied to a recording medium in a case where the recording medium is conveyed at a first speed is smaller than an amount of ink applied to the recording medium in a case where the recording medium is conveyed at a second speed higher than the first speed in both of a case where the recording medium is accelerated and a case where the recording medium is decelerated.
US10882342B2
The disclosure discloses a cutting apparatus including a movable blade and a guide device. The movable blade is configured to move along a sliding direction to a cutting position. The guide device includes an upper guide part including a contact part and a lower guide part including at least one guide surface. The contact part is disposed at a position separated from a first blade edge of the fixed blade by a first distance in the transport direction and by a second distance in an upper direction. The at least one guide surface that inclines in an inclination direction in which the at least one guide surface inclines downward at a predetermined angle toward a downstream in the transport direction and is disposed to have an interval of a third distance against the contact part in a direction orthogonal to the inclination direction.
US10882337B1
A printer includes a first printhead operatively connected to a source of ultraviolet (UV) curable ink having a first color, a first source of UV radiation following the first printhead in the process direction by a first predetermined distance, a second printhead operatively connected to the source of UV curable ink having the first color, and a second source of UV radiation following the second printhead in the process direction by a second predetermined distance that is greater than the firsts predetermined distance. The first predetermined distance enables the first source of UV radiation to fix the UV curable ink ejected by the first printhead before passing the second printhead and the second predetermined distance enables the ink ejected by the second printhead to flow over a portion of the substrate before the second source of UV radiation fixes the UV curable ink ejected by the second printhead.
US10882334B2
A method for printing a three-dimensional object includes printing a first color layer having a first color in a first region of a three-dimensional object, printing a second color layer having a second color in a second region of the three-dimensional object, printing a first structural layer directly onto the first color layer, the first structural layer having a first structural thickness which in combination with a first color thickness forms a first target thickness, and printing a second structural layer directly onto the second color layer, the second structural layer having a second structural thickness which in combination with a second color thickness forms the first target thickness. The first color thickness and the second color thickness are different, and the first structural thickness and the second structural thickness are different.
US10882329B2
A thermal head X1 according to the present disclosure includes a substrate, a heat generator, an electrode, and a protective layer. The heat generator is positioned on the substrate. The electrode is positioned on the substrate and connected to the heat generator. The protective layer covers the heat generator and part of the electrode. The protective layer contains titanium and nitrogen. The protective layer satisfies P2>P1 where P1 is the peak intensity of X-ray diffraction of the (111) plane, and P2 is the peak intensity of X-ray diffraction of the (200) plane.
US10882326B2
An inkjet receptive composition for use on glossy paper substrates may include a polymer binder, a multivalent salt, a pigment, a surfactant, a defoamer, and water. The polymer may be a polyurethane dispersion. The multivalent salt may be calcium chloride, and the water may be present in an amount greater than about 40 wt %. The inkjet receptive composition may have a viscosity in the range of about 3 and about 500 cP.
US10882325B2
A liquid supply unit includes a first chamber, a second chamber, an opening/closing member, a biasing member, a pressing member and a flexible film member. The first chamber communicates with a liquid storage container, and the second chamber communicates with a liquid injection head. The opening/closing member changes a posture between a closing posture for closing a communication opening and an opening posture for opening it. The biasing member biases the opening/closing member in a direction toward the closing posture. The pressing member presses the opening/closing member in a direction toward the opening posture. The flexible film member is displaced based on a negative pressure generated in the second chamber. When a pressure receiving portion of the pressing member receives the displacement force from the flexible film member, the pressing member rotates about a pivot point and presses the opening/closing member against a biasing force of the biasing member.
US10882320B2
An inkjet recording apparatus allows for cleaning. The inkjet recording apparatus includes an image forming section and a controller. The image forming section has a plurality of nozzles and forms an image on a recording medium by ejecting ink from the nozzles. The controller controls the image forming section. The nozzles eject the ink during the cleaning. The controller includes a determining section, and an adjusting section. The determining section determines whether or not the ink has been ejected from the nozzles. The adjusting section adjusts an ejection amount of the ink in a stepwise manner based on a determination result by the determining section.
US10882310B2
In one example in accordance with the present disclosure, a fluid ejection die is described. The die includes a number of actuators to manipulate fluid. The actuators are disposed on the fluid ejection die and are grouped as primitives on the fluid ejection die. The fluid ejection die also includes a number of actuators sensors disposed on the fluid ejection die. The nozzle sensors receive a sense voltage indicative of a state of corresponding actuators. Each actuator sensor is coupled to a respective actuator. The fluid ejection die also includes an actuator evaluation device per primitive, which actuator evaluation device is disposed on the fluid ejection die. The actuator evaluation device evaluates an actuator characteristic of any actuator within the primitive and generates an output indicative of a failing actuator of the fluid ejection die.
US10882299B2
A method for applying, in particular for evenly pressing across a surface, a component to a construction part by way of a manipulator, by receiving the component to be applied by means of a first vacuum pressure in a first interstice between a supporting member and the component, displacing the manipulator with the component towards the construction part, disposing the component at at least one partial surface of the construction part by way of the manipulator, where, during disposing, a second vacuum pressure is generated in a second interstice between the supporting member and the construction part, and mounting the component at the construction part by increasing the difference between the first and second vacuum pressures, where the manipulator continuously maintains the first vacuum pressure until completion of arrangement and at least partial attachment of the component at the construction part.
US10882295B2
An absorbent pad has: a first, outer layer comprising a permeable or non-permeable film; a second, outer layer comprising a permeable or non-permeable film, placed on a side of the pad opposite the first, outer layer; a third layer disposed between the first layer and the second layer, and comprising a tissue laminate comprising at least a first ply and a second ply, with at least one chemical agent or system fixed in the third layer and being either activated by contact with or soluble in an aqueous liquid, the at least one chemical agent or system being in a predetermined amount distributed substantially uniformly per unit area of the surface area between the at least first ply and second ply: and a fourth layer disposed between the first layer and the second layer and comprising fluff, with or without a chemical agent or system, the third layer being joined to the fourth layer to serve as a substrate for the fourth layer.
US10882292B2
A method comprising providing a polymeric substrate having a melting point of from about 130° C. to about 190° C., and locating a material layer onto the substrate, wherein the material layer comprises one or more polymeric materials that liquefy upon exposure to temperatures of at least about 100° C., to blend with a softened portion of the polymeric substrate. Upon exposure of one or more of the substrate and the material layer to a stimulus, the temperature is increased in a predetermined temperature zone of one or more of the substrate and material layer to cause blending of the one or more polymeric materials of the material layer with the softened portion of the polymeric substrate.
US10882285B2
A protective film for an electronic device is introduced. The protective film may comprises a deformable outer layer formed with a synthetic resin; a deformable modified material layer attached with a lower surface of the deformable outer layer, wherein the deformable modified layer is configured to be hardened responsive to receipt of an external stimuli; a deformable inner layer formed with a synthetic resin, attached with a lower surface of the deformable modified material layer; and an adhesive layer adhering to a lower surface of the deformable inner layer. Further, various embodiments can be implemented according to the present disclosure.
US10882278B2
A composite membrane for hydrogen separation and purification, including: a modified and activated support, a Palladium (Pd) layer, and an interstice layer between the second surface-modifying layer and the Pd layer. The support includes a support substrate, a first surface-modifying layer on the support substrate, and a second surface-modifying layer on the first surface-modifying layer.
US10882277B2
There is disclosed in the disclosure a protective clad steel plate, comprising hard steel layers (1, 3, 5) and soft steel layers (2, 4) arranged alternately, wherein face layers of the protective clad steel plate are hard steel layers (1, 3, 5), wherein the hard steel layers (1, 3, 5) and soft steel layers (2, 4) are atomically bonded by rolling cladding; wherein the soft steel layers (2, 4) comprise chemical elements in percentage by mass of: C: 0.001-0.01%, 0
US10882269B1
A duplex liner for a shipping label. A method for making a liner for a shipping label comprises providing a first ply. The first is a clear plastic sheet. The method includes providing a second ply. The second ply comprises printable paper. The method comprises applying a copolymerized emulsion on an underside of the first ply, and using press rollers to press the first ply against the second ply to cause the copolymerized emulsion to fuse the first ply and the second ply.
US10882261B2
A tape-laying apparatus includes a material feeder configured to feed tapes, and a laying device configured for picking up and placing tapes onto a laying table. The laying device includes a transporter and a vacuum. The vacuum is connected to the transporter such that at least one tape is configured to be held on the transporter by a negative pressure generated by the vacuum. The transporter includes at least two endless transport belts, which circulate around deflection rollers. The transport belts run parallel to one another in a same transport plane.
US10882251B2
The present disclosure provides a system for printing a three-dimensional object. The system may comprise an open platform configured to hold a film of a viscous liquid comprising a photoactive resin. The open platform may comprise a print window. The system may comprise a deposition head comprising a nozzle in fluid communication with a source of the viscous liquid. The deposition head may be configured to move across the platform and deposit the film over the print window. The system may use multiple viscous liquids. The system may comprise an optical source that provides light through the print window for curing at least a portion of the film of the viscous liquid. The system may comprise a controller operatively coupled to direct movement of the deposition head and projection of the light, thereby printing at least a portion of the 3D object.
US10882245B2
A method of manufacturing a three-dimensional object includes imparting a first liquid having a first composition including a solvent and a curable material and a second liquid having a second composition to form a liquid film, curing the liquid film, and repeating the imparting and the curing to obtain the three-dimensional object, wherein the imparting position and the imparting amount of each of the first liquid and the second liquid are controlled in such a manner that the liquid film includes multiple areas where at least one of post-curing compression stress and post-curing modulus of elasticity is different.
US10882243B2
Disclosed herein is an apparatus for adjusting membrane height for hot drape forming. The apparatus includes a frame including an enclosable interior space and sidewalls defining a perimeter of the interior space. The apparatus further includes an adjustable collar within the interior space of the frame. The adjustable collar extends about the perimeter of the interior space and is configured to move translationally within the interior space of the frame along the sidewalls in a first direction. The apparatus further includes a membrane extending across the interior space in a second direction, perpendicular to the first direction, and co-movably coupled with the adjustable collar, wherein a position of the membrane within the interior space is adjustable in the first direction as the adjustable collar moves translationally within the interior space.
US10882241B2
A method and a device for producing blow-molded containers, which are sterile at least in some areas, in a blow-molding machine. A preform made of a thermoplastic material is first heated, then stretched by a stretching rod in a blowing station, and then supplied with a pressurized fluid via a blow nozzle, wherein a sterilization device is arranged in the blowing station. The sterilization device has at least one radiation source which emits a sterilizing radiation onto the stretching rod and/or onto the blow nozzle.
US10882232B2
An injection molded product is disclosed and includes a shingle resembling a cedar shingle tile formed from an amorphous or semi-crystalline thermoplastic and having a wood grain direction. The injection molded product also includes streaks in the shingle that are substantially parallel to the wood grain direction and the streaks extend through an interior of the shingle and appear as contrasting streaks on an exterior of the shingle to form a variegated wood grain appearance. The injection molded product further includes an injection molded vestige in the shingle. The injection molded vestige is located adjacent to a perimeter of the shingle and the injection molded vestige comprises a location at which material entered an injection mold through a gate.
US10882223B2
A daylighting device according to an aspect of the invention includes at least a daylighting film that includes a base having optical transparency and daylighting portions having optical transparency and provided on one surface of the base. Each of the daylighting portions has a reflective surface by which light incident on the daylighting portion is reflected and the light reflected by the reflective surface and output from a second surface of the base has a characteristic that the light travels toward a space on a side where the light is incident on the reflective surface, the space being one of two spaces divided by a virtual plane as a boundary which is vertical to the second surface of the first substrate and parallel to a direction of the daylighting portion extending, and intervals s between adjacent daylighting portions are set to various values.
US10882222B2
The invention relates to a production mold for a rotor blade of a wind turbine plant, having two mold half-shells (3, 4) which during a production method of the rotor blade are disposed so as to be at least temporarily beside one another, and having at least one inner walkway (2c, 2d) that runs along so as to be between the two mold half-shells (3, 4), characterized by at least one escape path (40) which runs along below at least one of the two mold half-shells (3, 4).
US10882219B2
An image displaying device includes a background layer and a display layer. The display layer includes an inner surface and an outer surface. The inner surface is substantially smooth, and the outer surface includes a plurality of raised areas and recessed areas. The display layer has a first zone with a first thickness measured between the inner surface and a raised area and a second zone with a second thickness measured between the inner surface and a recessed area. The display layer also includes a coloring agent having a higher concentration in the first zone as compared to the second zone. The display layer has increased light transmissivity through the recessed areas and decreased light transmissivity through the raised areas such that a contrast of light transmissivity between the raised and recessed areas generates an image.
US10882210B2
A system and method are provided for producing wood curls with reliable consistency and resiliency. Moisture content of wood blocks is determined and a plurality of cutting knives are installed on a disc of a curling machine and set to extend about 0.012 inches from the face of the disc. The wood blocks are fed through the curling machine and the feed rate is set based on the moisture content of the blocks and the sharpness of the cutting knives and readjusted based on the resiliency of previously cut curls in order to produce wood curls of a desired resilience.
US10882209B2
A non-flammable composition is formulated to include ceramic powder, graphite, mica and ZrO2. The non-flammable composition is capable of being applied to an external surface of an item, or may be incorporated into the substrate material used to form an item prior to the item's manufacture. The non-flammable composition provides both fire-resistance and fire-retardant properties to the items that are treated thereby.
US10882204B2
The invention relates to a Device (10) for separating a tubular web (11) in two flat webs (12, 13) with an adjustable blade (20) for cutting the tubular web (11) and with a pulling device (30) which impinges the blade (20) with a tensile force (K) on a folding edge (14) of the tubular web (11) wherein the pulling device (30) is configured in a way that the tensile force (K) is adjustable depending on the tubular properties of the tubular web (11) and that the tensile force (K) can be mainly kept constant with constant tubular properties independent from the tubular web (11).
US10882198B2
A hair cutting appliance, a blade set for a hair cutting appliance, and to a stationary blade for the blade set, the blade includes a first segment, a second segment, and an intermediate segment fixedly interconnected, forming a segmented stack, wherein the intermediate segment is disposed between the first segment and the second segment, jointly forming, at an end of the segmented stack, at least one toothed leading edge comprising a plurality of mutually spaced apart projections defining a plurality of teeth and respective tooth spaces wherein the intermediate segment comprises a cutout portion and wherein the cutout portion in the intermediate segment, the wall segment and the second segment define therebetween a guide slot for a movable blade.
US10882196B2
A glove box has an enclosure having a glass window top and gloves mounted to the front wall. The enclosure can be tilted to so that one or other, or both, of the work piece and the window can be placed at an angle such as may facilitate processing. The glove box has an environmental control system to both to permit flushing with inert or other desired gases, and to permit heating or cooling. The workstand may have cooling passages as well. Controls are mounted inside the enclosure chamber to permit the operator to change working parameters without removing his or her hands from the gloves. A parameter status display may be located outside the enclosure. The window may be provided with a movable smoked glass filter for use during welding. The workstand may be independently adjustable for angle within the enclosure. The glove box has electrical and cooling service penetrations to permit use of a welding electrode.
US10882194B2
An apparatus including a movable arm; a robot drive connected to the movable arm; and a heat transfer system. The robot drive includes a first drive configured to extend and retract the movable arm and a second drive configured to move the movable arm and the first drive along a linear path. The heat transfer system includes a first heat transfer member on the base and a second heat transfer member, where the heat transfer system is configured to transfer heat from the first drive to the first heat transfer member and then from the first heat transfer member to the second heat transfer member. The first heat transfer member travels with the base, and the first heat transfer member moves relative to the second heat transfer member as the base moves relative to the slide.
US10882184B2
The present disclosure provides a servo motion control method and apparatus, as well as a robot using the same. The method includes: obtaining position parameters of a plurality of control vertices of a servo in a constant speed motion; creating a first smooth trajectory equation of the servo to move from the starting point to the ending point based on the position parameters of the plurality of control vertices; and controlling the servo to move based on the first smooth trajectory equation. The present disclosure is capable of realizing the smooth control of the motion of the servo from a starting position to an ending position, and avoiding the severe impacts during starting and stopping which affect the stability of the servo while the servo is in a constant high-speed motion.
US10882179B2
The control system includes a master device control part controlling a master device with a certain number of control axes by using master information and a slave device control part controlling a slave device with a certain number of control axes by using slave information. The control system includes an abstracted master information creating part for creating abstracted master information having a fixed number of elements based on a predetermined manner for allocation and according to the number of elements of the received master information. The slave device control part extracts elements in a number in accordance with the number of elements of the slave information from the fixed number of elements included in the abstracted master information based on a predetermined manner for extraction and according to the number of elements of the slave information to create the slave information.
US10882171B2
Gas fixing tool, including at least one combustion chamber, a trigger, a device for injecting fuel into the at least one chamber, a member for actuating the device, and a bearing member intended to be brought to bear on a support material, characterized in that it further comprises a safety member configured to cooperate on the one hand with the actuating member and on the other hand with the trigger, so that the trigger is locked in its first position when the actuating member is in a first position.
US10882159B2
A control valve (100) comprises a conduit (102), a controller (104), a sensor unit (106; 146, 148), a cylindrical housing (112) and one or more regulating columns (124, 126). The conduit further comprises a hollow cylindrical body (114) and two smaller and shorter cylindrical extensions (116, 118) for the insertion of the regulating columns which are orthogonal to the hollow cylindrical body and provide a contactless means to control the flow of the medium (101) in the conduit.
US10882158B2
A method of treating a substrate of a turbomachine component includes applying a coating to a surface of the substrate of the turbomachine component and peening the substrate after applying the coating to the surface by directing a peening force onto the coating whereby the peening force on the coating is transferred through the coating to the substrate. A method of treating an internal surface of a turbomachine component includes directing a peening force at the internal surface within a cooling passage of the turbomachine component.
US10882156B2
In a spindle device, a cover member covers a surface of a flange portion on the front side of the spindle shaft, the flange portion projecting radially outward from the outer peripheral surface of the spindle housing, and the outer peripheral surface of the spindle housing extending from the surface of the flange portion toward the front of the spindle shaft. In the cover member, a flow path for allowing a coolant to flow therethrough is formed.
US10882149B2
It is an object of the invention to provide a new push bar type of index apparatus which can hold and machine the work exactly while the machining center machines the work having a predetermined length even if the work is long. An index apparatus comprises first and second index tables 4a and 4b configured to hold a work 1. The apparatus comprises a push bar transmission mechanism configured to rotate the first index table 4a in response to the movement of the push bar 7. The work 1 and the second index table 4b are rotated by the rotation of the first index table 4a integrally so as to index the work 1.
US10882143B2
For material processing of a material, which is in particular for a laser beam to a large extent transparent, asymmetric shaped modifications are created transverse to the propagation direction of the laser beam. Thereby, the laser beam is shaped for forming an elongated focus zone in the material, wherein the focus zone is such that it includes at least one intensity maximum, which is transverse flattened in a flattening direction, or a transverse and/or axial sequence of asymmetric intensity maxima, which are flattened in a sequence direction. After positioning the focus zone in the material, a modification is created and the material and the focus zone are moved relative to each other in the or across to the flattening direction or in the or across to the sequence direction for forming a crack along an induced preferred direction.
US10882136B2
A method for forming a conductive track on a surface (21) of a substrate (11) that includes providing the substrate (11), wherein the substrate (11) comprises deposited material (23) along a path on a surface (21) of the substrate (11). Generating a laser beam having an optical axis and an energy distribution within a cross-sectional area of the laser beam incident on the surface (21). The energy distribution of the laser beam is non-circularly symmetric about the optical axis at the surface (21). The method further includes directing the laser beam to move along the path to irradiate the deposited material (23) to provide a conductive track along the path. A selected orientation of the energy distribution within the cross-sectional area is aligned with the direction of movement of the laser beam.
US10882133B2
Apparatus, systems, and/or methods for providing welding systems or portions of welding systems that provide a tip-retention device that is configured to direct gas radially towards a contact tip.
US10882130B2
An assembly includes a first member, a second member adjacent to the first member, and an aluminum material. At least one of the first member and the second member defines at least one trench. The aluminum material is disposed within the trench and bonds the first member to the second member along adjacent faces. In one form, a spacing between the first member and the second member along the adjacent faces is less than 5 μm.
US10882125B2
A power tool includes a motor; an arbor attachment mechanism that includes a shaft configured to be driven by the motor about a spin axis. The arbor attachment mechanism is configured to hold a blade onto the shaft. The power tool includes a blade size limiter that is configured to prevent attachment of a blade with a radius greater than a predetermined size, and is configured to be connected to the arbor attachment mechanism independently of the attachment of the blade to the arbor attachment mechanism and such that the blade size limiter is at a distance from the spin axis of the shaft.
US10882122B2
A power shear tool includes a housing portion, a motor positioned within the housing portion, and a tool head portion extending from the housing portion and including a blade rotatable relative to the tool head portion. The power shear tool includes a workpiece support member positioned proximate the tool head portion. The workpiece support member includes a top surface and a bottom surface opposite the top surface, side surfaces extending between the top and the bottom surfaces, a first channel defined in the top surface and extending from at least one of the side surfaces, and a second channel defined in the top surface. The second channel intersects the first channel and extends transverse to the first channel.
US10882121B2
A drill according to a non-limiting aspect may have a body, a cutting edge, a rake face, and a groove. The cutting edge may have a curved chisel edge, a pair of first cutting edges, and a pair of second cutting edges. The second cutting edge may have a first portion extending from the chisel edge and a second portion extending from the first portion toward the first cutting edge. The rake face may have a first region extending from the first portion and a second region extending from the second portion. A first rake angle of the first region may be zero or a negative value. A second rake angle of the second region may be a negative value. An absolute value of the second rake angle may be greater than an absolute value of the first rake angle.
US10882120B2
A cutting tool may include a body, a cutting edge, and a flute. The body may include a rotation axis and extend from a first end to a second end. The cutting edge may be located at the first end. The flute spirally may extend from the cutting edge toward a side of the second end. The cutting edge may include a first cutting edge and a second cutting edge extending from the first cutting edge toward an outer peripheral surface of the body in a front view. The flute may include a first thinning portion located continuously with the first cutting edge at a side of the first end, and a second thinning portion located continuously with the second cutting edge at a side of the first end. A thinning angle of the first thinning portion may be smaller than a thinning angle of the second thinning portion.
US10882116B2
A coated cutting tool comprising a substrate and a coating layer formed on the substrate, wherein: the coating layer is laminated in order from the substrate side toward a surface side of the coating layer; and the coating layer comprises an upper layer and a lower layer which satisfy the following conditions that: “at least one of {422} planes of TiCN particles located closest to the surface in the lower layer and at least one of {006} planes of α-type Al2O3 particles located closest to the substrate in the upper layer and immediately above the TiCN particles are substantially parallel to each other, and at least one of {111} planes of the TiCN particles and at least one of {110} planes of the α-type Al2O3 particles are substantially parallel to each other”; and “at least one of {111} planes of TiCN particles located closest to the surface in the lower layer and at least one of {006} planes of α-type Al2O3 particles located closest to the substrate in the upper layer and immediately above the TiCN particles are substantially parallel to each other, and at least one of {422} planes of the TiCN particles and at least one of {110} planes of the α-type Al2O3 particles are substantially parallel to each other.”
US10882111B2
Additive manufacturing includes successively forming a plurality of layers on a support. Depositing a layer from the plurality of layers includes dispensing first particles, selectively dispensing second particles in selected regions corresponding to a surface of the object, and fusing at least a portion of the layer. The layer has the first particles throughout and the second particles in the selected regions. Alternatively or in addition, forming the plurality of layers includes depositing multiple groups of layers. Depositing a group of layers includes, for each layer in the group of layers dispensing a feed material to provide the layer, and after dispensing the feed material and before dispensing a subsequent layer fusing a selected portion of the layer. After all layers in the group of layers are dispensed, a volume of the group of layers that extends through all the layers in the group of layers is fused.
US10882108B2
The present invention relates to a non-crushing casting system including mold units for receiving a molten material from a melting furnace and casting the molten material to form a plurality of unit shape materials having a predetermined size; and a conveyor unit for performing infinite looping of mold units to detach the unit shape materials of the cast molten material, and for conveying and discharging the detached unit shape materials. According to the present invention, to manufacture a subsidiary raw material for steel manufacture having a certain unit size, ferromanganese or ferrosilicon is melted, and then cast in molds having a predetermined size.
US10882106B2
Disclosed is a method for producing a composite material, wherein two or more composite components are arranged with respect to one another by casting to form a composite, so as to create a contact region essentially without a material bond between the composite components, wherein the composite components are thereafter materially bonded to one another in the contact region by means of a hot-rolling process.
US10882101B2
Apparatus and method for filtering molten metal, in particular aluminium, including a container (1) with an outer shell or casing of metal and an inner thermally insulated interior cladding or wall construction made of heat resistant insulation and refractory material. A removable lid (2) provided on top of the container to keep the container sealed (air tight) during operation, the container (1) being provided with an inlet chamber (3) having an inlet opening (4) receiving metal from a metal supply launder (10) and an outlet chamber (5) with an outlet opening (6) in which a ceramic or refractory filter (7) is mounted.
US10882100B2
A method and apparatus for continuous Near Net Shape casting of a liquid metal (10) into a metal strip are described. Liquid metal is transferred in a velocity adjusted manner from a headbox (50) to a chilled substrate (36), via a meniscus gap (69). The headbox (50) has a slot nozzle (68) defined in a bottom portion (66) for the headbox (50) above the chilled substrate (36). The slot nozzle (68) defines a smooth elongated cavity with a slot width (67) and the slot length (65) of the metal strip (34). The generation of some turbulence at the outlet of the apparatus promotes stable Near Net Shape Continuous Casting. The present method and apparatus increase the level of turbulence in the liquid metal of the outlet nozzle upstream of the chilled substrate (36) to minimize premature metal freezing. In a particularly preferred embodiment, the slot nozzle is adjustable.
US10882090B2
The present invention relates to a method for forming a hollow 26 of a ferritic FeCrAl alloy into a tube 2. While tubes made of powder metallurgical, dispersion hardened, ferritic FeCrAl alloys are commercially available, hollows made of FeCrAl alloys so far can hardly be formed into tubes of small dimensions. The major reason for the problems in forming hollows of a ferritic FeCrAI alloy into a finished product is that FeCrAl alloys are brittle. It is therefore an aspect of the present invention to provide a tube 2 made of a ferritic FeCrAl alloy having arbitrary small dimensions. Furthermore, it is an aspect of the present invention to provide a machine 1 and a method for forming a tubular hollow 26 into a finished tube 2 of a ferritic FeCrAl alloy. At least one of the above aspects is addressed by a method for forming a hollow into a tube 2 comprising the steps providing the hollow 26 of a ferritic FeCrAl alloy, heating the hollow 26 to a temperature in a range from 90° C. to 150° C., and forming the heated hollow 26 by pilger milling or drawing into the tube.
US10882084B2
A shielded containment cabinet device for use for the cleaning under high visibility and high protection for user, while using reduction flow pressurized water for cleaning of materials.
US10882082B2
A freeze cleaning apparatus includes a table for supporting a processing target substrate having a first surface and a second surface opposite to the first surface, a liquid supply unit positioned to supply a cleaning liquid onto the second surface of the processing target substrate that is placed such that the first surface faces the table, and a cooling gas discharge unit in the table to supply a cooling gas to the first surface side of the processing target substrate. A gap between the table and the processing target substrate is set such that the cooling gas flows as a laminar flow between the table and the processing target substrate.
US10882080B2
A substrate processing apparatus includes a substrate holding unit having a spin base; a blocking member having a substrate facing surface facing an upper surface of the substrate held by the substrate holding unit and having a diameter larger than the spin base; a blocking member lifting unit raising and lowering the blocking member between a blocking position where a space between the substrate facing surface and the upper surface is blocked from lateral side on the upper surface and a retreat position where the space is not blocked from the lateral side on the upper surface; guards including an inner side and an outer side guards respectively surrounding periphery of the substrate holding unit and surrounding periphery of the inner side guard. An inner circumferential end of the outer side guard is positioned on radial outer side of an inner circumferential end of the inner side guard.
US10882074B2
FF properties of a multilayer coating film configured to exhibit a red color through a lustrous layer (14) and a translucent colored layer (15) are improved to achieve a metallic textured color having a high-quality color tone. The lustrous layer (14) is configured such that Y(10°) is 50 or more and 950 or less and that Y(25°) is 0.05 or more and 0.35 or less times the Y(10°), where Y(10°) represents a Y value, of an XYZ color system, of reflected light measured at a light receiving angle of 10° and Y(25°) represents a Y value of the reflected light measured at the light receiving angle of 25° in a case where a light incident angle is 45°. An inclination of a tangent to the spectrum of the spectral transmittance of the colored layer (15) at the wavelength of 620 nm is 0.012 nm−1 or more and 0.03 nm−1 or less, defined as an absolute value.
US10882070B2
A method of manufacturing a steering shaft assembly includes heating an inner shaft and heating an outer shaft. The method also includes applying a plastic coating to at least a portion of the inner shaft. The method further includes cooling the plastic coating and pressing the outer shaft and the inner shaft together.
US10882067B2
The present disclosure relates to a nozzle assembly for use in a servo valve. The nozzle assembly comprises three nozzle parts and a housing. The second part is coaxial with the first part and surrounds at least a first portion of the first part. The third part is coaxial with the first part, and a first portion of the third nozzle part surrounds a first portion of the second nozzle part, and a second portion of the third part is attached to a second portion of the first part. First and second nozzle parts are made of materials having approximately the same first coefficient of thermal expansion (TE1), and third part and housing are made of materials having approximately the same second coefficient of thermal expansion (TE2). TE1 is different from TE2. The interaction between the portions due to the differences in TE1 and TE2 allow the nozzle assembly to compensate for temperature fluctuations during and operation whilst remaining firmly held in position.
US10882064B2
A paint cup assembly for a paint sprayer is disclosed and includes a cap, a paint reservoir formed with an air inlet port, and a valve assembly disposed within the paint reservoir and engaged with the air inlet, wherein the valve assembly is configured to be operable from a closed configuration, in which air flow through the air inlet port is prevented, and an open configuration, in which air flow through the air inlet port is permitted, upon actuation of a spray gun.
US10882063B2
An electro-hydraulic actuation system for a sprayer comprises a hydraulic system, a hydraulic actuator, an electric actuator and a sprayer. The hydraulic system is for pressurizing a hydraulic fluid. The hydraulic actuator is powered by the hydraulic system. The electric actuator controls actuation of the hydraulic actuator by the hydraulic system. The sprayer is actuated by the hydraulic actuator.
US10882062B2
A hydroprocessing system having a processing vessel that discharges a high temperature effluent that must be cooled prior to collection in a reflux drum. One or more gas assisted spray nozzle are provided that utilize light atomizing gas having a density of 8-15 times less than air, such as hydrogen, which preferably is the processing or recycle gas of the system. The spray nozzles are designed for the efficient atomization and direction of cooling water into a micron sized droplet distribution utilizing the light atomizing gas for affecting higher mass and heat transfer from the effluent. The spray nozzles each include a unique atomizing gas and cooling liquid passageway systems, a downstream impingement post, and a plurality of discharge orifices which sequentially breakdown the liquid into micron sized droplets as low as 500 microns and less.
US10882061B2
A delivery device of a water jet comprises a delivery chamber and a safety valve suitable for reducing the water pressure in the delivery chamber when the water pressure exceeds a preset pressure threshold. The safety valve comprises a hollow housing body, a valve cartridge inserted tightly into the hollow housing body, the cartridge defining a valve seat for the passage of water and an obturator movable between a closed position, wherein the obturator closes said valve seat, and an open position, wherein the obturator opens said valve seat when a pressure greater than the preset pressure threshold value acts on said obturator. A support body is connected in a removable way to the hollow housing body and has a bottom wall on which the valve cartridge rests and which is penetrated by through-openings for the evacuation to the exterior of the water present in the hollow housing body.
US10882050B2
The present invention improves the even distribution of a powder to a pulverized coal pipe. A rotary classifier including: a rotary shaft rotatably supported around a rotational axis extending in a vertical direction; a frame body supported by the rotary shaft and including an opening on the outer periphery of the frame body; a plurality of powder outlets provided along the rotation direction and opening on the upper section of the frame body; a plurality of blades extending in the vertical direction at the opening on the outer periphery of the frame body and provided along the rotation direction; and an annular member that serves as a constricting section provided so as to narrow the interval from the blades to the rotary shaft.
US10882049B2
A tool for processing abrasive materials, in particular rocks, sand or ores, may include a main tool body and a hard metal plate positioned on the main tool body. A build-up weld may be applied to a surface of the hard metal plate and to the main tool body to bond the hard metal plate to the main tool body. Further, a method for producing or treating such a tool may involve positioning the hard metal plate on the main tool body and applying a build-up weld to the hard metal plate and the main tool body such that the hard metal plate is attached to the main tool body.
US10882040B2
An interface component (40), suitable for cooperating with a microfluidic device (1), the interface component comprising, one or more elements (41) which can be selectively connected to a pneumatic system (71 a,71 b) which can provide a positive and/or negative air flow to the one or more elements (41); wherein each of the one or more elements (41) comprises, an input port (42) which can be selectively fluidly connected to a pneumatic system (71 a,71 b); and a flow restrictor (43) according to a further aspect of the present invention; the flow restrictor (43) being arranged in fluid communication with the input port (42), wherein the flow restrictor (43) can restrict the flow of fluid through the element (41); and an aerosol filter (49) which is arranged to be in fluid communication with the flow restrictor (43); and wherein the interface component (40) further comprises one or more outlets (45), each of the one or more outlets (45) being in fluid communication with a respective element (41), so that fluid can flow from the element (41) out of the interface component (40) via the one or more outlets (45); and wherein each of the one or more outlets (45) can be selectively arranged to be in fluid communication with a respective reservoir (105,106,107,108) of a microfluidic device (1). There is further provided a corresponding method and assembly for extracting ferromagnetic, paramagnetic and/or diamagnetic particles from a sample.
US10882033B2
A slurry composition for a catalyst and a method for producing the same, a catalyst and a method for producing the same using the slurry composition for a catalyst. The method omits many heretofore required treatment steps and reduces catalyst production cost. The method comprising the steps of providing a slurry composition for a catalyst, comprising at least an aluminosilicate, Cu, and water, and having a solid concentration of 0.1% by mass to 90% by mass, wherein a component for a catalyst has composition represented by Al2O3·xSiO2·yT2O·zCuO (wherein T is a quaternary ammonium cation, and x, y and z are numbers that satisfy 10≤x≤40, 0.1≤y<2.0, and 0.1≤z<2.0, respectively) in terms of molar ratio based on an oxide; coating at least one side of a support with this slurry composition; and heat-treating at 350° C. or higher.
US10882030B2
A hydroprocessing catalyst has been developed. The catalyst is a crystalline transition metal tungstate material or metal sulfides derived therefrom, or both. The hydroprocessing using the crystalline transition metal tungstate material may include hydrodenitrification, hydrodesulfurization, hydrodemetallation, hydrodesilication, hydrodearomatization, hydroisomerization, hydrotreating, hydrofining, and hydrocracking.
US10882029B1
A method for using a nanocomposite of tin cobalt oxide nanocubes and graphene oxide to photo-catalytically degrade a portion of an organic contaminant in a solution. The nanocubes have an average side length in a range of 400 nm-1.5 μm and a carbon to tin molar ratio in a range of 10:1-25:1. The nanocomposite may also be used for enhancing the efficiency of a liquid fuel.
US10882011B2
There is provided a composite hollow fiber membrane for gas and vapour separation comprising: a porous membrane substrate; and a selective layer of cross-linked polydimethylsiloxane (PDMS) provided on a surface of the porous membrane substrate, wherein the molecular weight of the cross-linked PDMS is ≥100 kg/mol. There is also provided a method of forming the composite hollow fiber membrane, and a method of forming the cross-linked polydimethylsiloxane (PDMS) having a molecular weight ≥100 kg/mol.
US10882009B2
The present invention relates to shaped bodies comprising a composition (Z1), wherein said composition comprises at least one polymer having an elongation at break of >30% and at least one porous metal-organic framework material, to processes for producing shaped bodies of this kind and to the use of a composition (Z1) comprising at least one polymer having an elongation at break of >30% and at least one porous metal-organic framework material for production of a film, membrane or laminate having a water vapor permeability according to DIN 53122 at 38° C./90% rel. humidity of greater than 1000 g/(m2*d), based on a film thickness of 10 μm.
US10882007B2
Disclosed are examples of luminaires that provide light for general illumination and treat air via a biofilter. In the examples, a luminaire may include a light source configured to illuminate a space, a biofilter configured to treat air, and an air circulation system. The light source may be configured to illuminate a space in which the luminaire is located with general illumination light. The biofilter may include an air permeable membrane, a substrate, and a microorganism that treats air that comes in contact with the microorganism. The air circulation system is configured to draw air into contact with the biofilter and output air treated by contact with the biofilter into at least a portion of the space illuminated by the light source.
US10881999B2
There is provided an air cleaner including: an outlet pipe through which air is discharged; an airflow meter that is inserted toward an interior of the outlet pipe through a wall of the outlet pipe; and a flow-regulating member that is formed projecting from an inner surface of the outlet pipe at a leading end side of the airflow meter, the flow-regulating member including an edge that is formed with a peaked shape with respect to the inner surface and that runs along a direction of flow of air, a rear end that is formed at a downstream end of the edge in the direction of flow, and that is shaped cut sharply toward the inner surface and a width-narrowing portion that decreases in width in a circumferential direction of the outlet pipe on progression downstream in the direction of flow.
US10881994B2
The disclosure concerns a liquid filter assembly. The filter assembly includes a filter and a drain pin coupled to a lower support plate of the filter. The Drain pin includes a body, a grip, a seal member, and a fixing block structured and arranged to secure the drain pin to the filter. According to an implementation, the lower support plate has a receiving groove, and the fixing block is coupled to the receiving groove for securing the drain pin to the filter.
US10881991B2
A filter insert for being removably arranged in a filter housing includes a first connection arrangement for engaging a corresponding second connection arrangement of a filter housing lid for a connection to the filter housing lid. The first connection arrangement is arranged to simultaneously prevent a relative rotational movement between the filter insert and the filter housing lid and allow a relative axial movement between the filter insert and the filter housing lid.
US10881988B2
The present disclosure relates to settler plates for a plate settler. The settler plates generally include a hollow support with a hollow interior to receive clarified liquid from a flow channel between adjacent settler plates. An orifice is formed through the hollow support to direct clarified liquid from the flow channel into the hollow interior. The orifice can be positioned such that clarified liquid can flow upwardly out of the flow channel and downwardly through the orifice into the hollow interior. The hollow support can be integrally formed with the settler plate. For example, the hollow support can be formed by bending a tab extending from an end of the settler plate. The tab can be bent into a hollow support with a cross section that is generally polygonal.
US10881984B2
The present disclosure relates to a composition for reducing aromatics from a hydrocarbon feedstock. The composition comprises a solvent mixture. The solvent mixture includes a primary solvent, a first co-solvent, a second co-solvent, and a secondary solvent. The present disclosure also relates to a process for reducing aromatics from a hydrocarbon feedstock.
US10881975B2
A toy building set comprising a number of toy building elements and an overload-safe linear actuator having a center axis and with two spindle parts comprising a first spindle part with an internal thread arranged concentrically to the center axis, and a second spindle part with an external thread screwed into the internal thread on the first spindle part, and wherein the thread on the one spindle is at least twice as long as the thread on the second spindle part. One of the spindle parts being provided with a slot extending through the spindle part longitudinally of the thread configured on the spindle part and essentially along the entire thread, it is accomplished that it is easy to adjust the length of the actuator by pulling or pressing the two spindle parts together or away from each other.
US10881973B2
An apparatus for providing lateral movement on a roller coaster includes a main chassis, a passenger chassis, and a hub. The main chassis is configured to ride on a track. The passenger chassis is rotatably supported on the main chassis via the hub. The hub and main chassis are behind the passenger chassis. The hub allows the passenger chassis to perform a full lateral rotation relative to the main chassis.
US10881966B2
A network game system of high interest in which a contingency and/or unpredictability intervenes in a data exchange between players in a network game is provided. When a map item and a character are selected, a game apparatus transmits a data exchange request and character information to a server apparatus. The received character information is stored in a character management table of the server apparatus. When a predetermined time elapses after the data exchange request, other-character information is specified, and the character management table is updated. The other-character information is transmitted to the game apparatus, and the game apparatus updates each table based on the received information.
US10881965B2
Methods, systems, and computer products for identifying improper online player accounts are provided. Aspects include receiving, by a processor, online gaming data associated with a user account of an online gaming environment, accessing a player profile associated with the user account, wherein the player profile includes historical online gaming data of a user, analyzing the historical online gaming data of the user to determine a historical play style of the user account, analyzing the online gaming data to determine a current play style of the user account, and comparing the historical play style of the user to the current play style of the user account to determine one or more deviations between the current play style and the historical play style of the user account.
US10881960B2
Methods, systems, and computer programs are presented for online game cooperation. One method includes an operation for receiving a first request from a first user to place a game asset in a first game board of the first user. The game asset is associated with a task to be performed in the game. Further, the method includes an operation for receiving a second request from a second user to place the game asset in a second game board of the second user. The first user and the second user make progress by interacting with the game asset in their respective game boards. When the first user or the second user receives a transactional reward for interacting with the game asset, the transactional reward is also given to the other user. A final reward is given to the first user and to the second user upon completion of the task.
US10881958B2
A system in accordance with present embodiments includes a surface that displays a plurality of images related to a game, a vehicle comprising interface circuitry configured to receive an input from the rider related to a vehicle path on the surface, wherein the vehicle operates according to the input to move on the surface on the vehicle path, and a controller that determines that the vehicle has moved over a first image of the plurality of images while on the vehicle path based on a signal from the vehicle, the surface, an external sensor, or a combination thereof; provides instructions to display circuitry associated with the surface to change the first image when the vehicle has moved over the first image while on the vehicle path; and updates a score associated with the vehicle when the vehicle has moved over the first image while on the vehicle path.
US10881956B2
Techniques related to the render and encode of graphics frames representative of 3D video games are discussed. Such techniques include translating one or more of a transparency map, a depth map, a color compression map, or a motion field used to encode a graphics frame to encode parameters and encoding the first graphics frame using the encode parameters to generate a bitstream.
US10881952B2
The first operation portion is configured to be pressed by one hand of a user holding a grip portion. The first button depression portion is configured to move toward a first button of a game controller secured in a compartment, thereby pressing the first button of the game controller secured in the compartment, in response to the pressing operation on the first operation portion. The second operation portion is configured to be pressed by the other hand of the user holding the grip portion. The second button depression portion is configured to move toward a second button of the game controller secured in the compartment, thereby pressing the second button of the game controller secured in the compartment, in response to the pressing operation on the second operation portion.
US10881936B2
An exercise assembly structured to perform different rowing routines characterized different rowing motions. A resistance device is movable within a chamber and is cooperatively structured therewith to resist such movement. A drive assembly includes two drive sections each independently connected in driving relation to said resistance device. A connector structure includes two connector members each attached to a handle and connected in driving relation to a different one of said drive sections. The handle is selectively movable through the plurality of different rowing motions, at least one of which results in the two drive sections concurrently driving the resistance member and being concurrently driven by the two connector members. At least one other rowing motion of the handle is defined by each drive section alternately driving the resistance member and being alternately driven by interconnected ones of said connector members.
US10881914B2
An improved golf club putter having a selectable hosel, each hosel having a characteristic lie angle and loft angle, wherein the hosel is mounted to the head of the golf club, and wherein the hosel has a position orientation feature which aligns the shaft and hand grip with respect to the putter head for accurate operation of the golf club putter.
US10881910B2
Systems and techniques for the collection and display of athletic information. Athletic data relating to a single person or group of people is collected at a central location, and subsequently displayed at a desired remote location so that the person or people can review and critique their performance. In addition, athletic data for multiple persons can be collected at a central location, and subsequently displayed to a user at a desired remote location, so that the user can compare his or her athletic activities to others.
US10881907B2
A machine implemented method and system, including: transmitting one or more credentials of a user account from a user device to an exercise management system (EMS) having a processor and one or more sensors where the EMS is disposed on an exercise equipment disposed in a selected at least one fitness center and the exercise equipment is part of a selected at least one exercise plan; transmitting the one or more credentials of the user account from the EMS to a cloud server having a processor; transmitting the selected at least one exercise plan for the new user account from the cloud server to the EMS; transmitting an exercise equipment information from the EMS; forming a user exercise data by the EMS for the exercise equipment based on data received from the one or more sensors and transmitting an exercise feedback from the EMS.
US10881902B2
An arm muscular strength training and rehabilitation apparatus has a body, an angle meter, a handle, a force sensing device and a main control unit. The body has a housing and a variable resistance device. The variable resistance device is disposed in the housing. The angle meter is disposed on the variable resistance device. The handle is disposed pivotally on the variable resistance device and has a suspension arm and a handlebar bracket. The force sensing device is disposed on handlebar bracket of the handle. The main control unit connects electrically to the variable resistance device, the angle meter and the force sensing device to receive the angle signal and the force sensing signal and controls resistance of the variable resistance device according to the angle signal and the force sensing signal. The apparatus disposing the force sensing device on the handle prevents measuring time lag and increase measuring precision.
US10881892B2
A workout apparatus 10 includes base 12. A lifting arm 14 is pivotally connected to base 12 and movable on base 12 between a raised position and a lowered position, the lifting arm 14 including a first end 14a pivotally connected to base 12 and a second end 14b opposite the first end, the second end 14b including a gripping end piece 16. At least one weight post 32 extends outward from lifting arm 14 at a location between first end 14a and second end 14b of lifting arm 14. A braking system 18 is mounted to base 12 and coupled to lifting arm 14. Braking system 18 allows lifting arm 14 to move toward the raised position freely. Braking system 18 is engaged as lifting arm 14 moves towards the lowered position to lower lifting arm 14 toward the lowered position at a controlled rate of speed.
US10881887B2
A valve assembly includes a pipe fitting through which a gas is configured to flow. The inlet of the pipe fitting is configured to connect to an open port of a fire suppression sprinkler system so that gas flows from the fire suppression sprinkler system into the pipe fitting. The valve assembly also includes a vent valve. The inlet of the vent valve is connected to the outlet of the pipe fitting. The vent valve is operable to move between an open position and a shut position. The valve assembly includes an inert gas analyzer and at least one vent port upstream of the inert gas analyzer. The inert gas analyzer is positioned to measure the inert gas content of gas flowing in front of the inert gas analyzer and through the vent port to an outside environment.
US10881884B1
A descender with folding handle and integral pulley preferably includes a base plate, a cover plate, a folding handle, a handle cam, a rope cam, an euler, an integral pulley and at least one spacer. The folding handle includes a base handle portion, a folding handle portion, handle pivot pin and a biasing device. The rope cam includes an inner profile, an outer perimeter, a pivot hole and a rope groove. The pivot hole is formed through rope cam to receive a spacer post. The euler includes a round diameter and a pair of D-shaped projections extending from opposing ends of the round diameter. D-shaped openings are formed in the base and cover plates to receive the D-shaped projections. The integral pulley preferably includes a pulley bracket, a spring clip, a rope pulley and a pulley axle. The rope pulley includes a peripheral groove for retaining a rope.
US10881881B2
A rotary irradiation apparatus of an embodiment comprises: a rotating gantry; a superconducting electromagnet being installed in the rotating gantry and forming at least one of a deflecting magnetic field that deflects a trajectory of a charged particle beam and a convergent magnetic field that converges the charged particle beam to guide the charged particle beam to an object to be irradiated; a rotating gantry drive unit that drives/rotates the rotating gantry; and a control device that controls the rotating gantry drive unit to rotate and stop the rotating gantry, while the superconducting electromagnet is being excited and the charged particle beam is not irradiated.
US10881871B2
A remote communications system for providing enhanced communication with cardiac devices includes a wearable defibrillator disposed on a torso of a patient and a remote device. The wearable defibrillator includes one or more buttons configured to be actuated by the patient to indicate that the patient is conscious, a speaker configured to communicate information to the patient, a wearable defibrillator transceiver configured to transmit the information, and a processor in communication with the speaker and the wearable defibrillator transceiver. The remote device includes a wireless transceiver for bi-directional communication configured to receive the information from the wearable defibrillator, at least one of a touch screen and a speaker, and a processor configured to cause the remote device to provide via the at least one of the touch screen and the speaker at least one of an alarm, voice message, and prompt based on the received information.
US10881869B2
Near-field energy transmitters for charging a rechargeable power source of an implantable medical device (IMD). In some cases, the transmitter may include an output driver that may drive a transmit coil such that near-field energy is transmitted to the IMD at a determined frequency. In some cases, the IMD may include a receiving coil that may capture the near-field energy and then convert the near-field energy into electrical energy that may be used to recharge the rechargeable power source. Since the rechargeable power source does not have to maintain sufficient energy stores in a single charge for the entire expected life of the IMD, the power source itself and thus the IMD may be made smaller while still meeting device longevity requirements.
US10881866B2
One aspect relates to an electrical contacting device for a medical implantable device, including an electrically insulating base body with a first and a second surface. The base body includes a ceramics, an electrically conductive conducting element that extends from the first surface of the base body through the base body. The conducting element includes a cermet and is connected to the ceramics of the base body in firmly bonded manner through a sintered connection, a contact element including a metal. The contact element is connected to the conducting element in electrically conductive manner and can be connected to an electrically conductive structure. The contacting device includes an adhesion element. The adhesion element is connected to the contact element in firmly bonded manner and wherein the adhesion element includes an adhesion promoter in order to form a firmly bonded connection at least to the first surface of the base body.
US10881864B2
The methods and systems herein generally relate to generating stimulation waveforms for a therapy of a neurostimulation (NS) device in a patient. The methods and systems receive a target stimulation waveform from a user interface, calculate a timing resolution of the target stimulation waveform, determine target amplitude resolutions of the target stimulation waveform, identify whether a mathematical relationship exists between the target amplitude resolutions, and automatically designate one of a first, second, or third generator circuits based on at least one of the timing resolution, the amplitude, or the mathematical relationship. The systems and methods further transmit the target stimulation waveform and an activation instruction for the designated one of the first, second, or third generator circuits along the communication link to a NS device. The NS device includes the first, second, and third generator circuits configured to generate different first, second, and third types of stimulation waveforms.
US10881862B2
Methods and/or devices may be configured to estimate right ventricular-timings from left ventricular (LV) sensing times for adaptive cardiac therapy using DDD/VDD LV pacing without using a right ventricular (RV) lead. One embodiment employs a subcutaneous device (SD) in a patient and a leadless pacing device (LPD) coupled to a patient's heart. Heart activity including atrial and ventricular events are sensed from the patient's heart using the SD. Left ventricular events (LVS) are sensed using the LPD. The SD is used to determine whether cardiac resynchronization pacing therapy (CRT pacing) is appropriate based upon the heart activity sensed by the SD. The SD is further configured to determine timing of CRT pacing pulses for delivery to cardiac tissue through the LPD.
US10881856B2
The present invention relates to systems adapted for remotely and intelligently tuning movement disorder of therapy systems. The present invention still further provides systems adapted for quantifying movement disorders for the treatment of patients who exhibit symptoms of such movement disorders including, but not limited to, Parkinson's disease and Parkinsonism, Dystonia, Chorea, and Huntington's disease, Ataxia, Tremor and Essential Tremor, Tourette syndrome, stroke, and the like. The present invention yet further relates to systems adapted for remotely and intelligently or automatically tuning a therapy device using objective quantified movement disorder symptom data to determine the therapy setting or parameters to be transmitted and provided to the subject via his or her therapy device. The systems of the present invention also are adapted to provide treatment and tuning intelligently, automatically and remotely, allowing for home monitoring of subjects.
US10881854B2
Provided is a respiratory muscle strengthening device, in which an inhalation start signal is generated correspondingly at an inhalation start time when a patient inhales air or an exhalation start signal is generated correspondingly at an exhalation start time when the patient exhales air, an electric signal according to the inhalation start signal or the exhalation start signal is transmitted to an electric muscle stimulator via a communication unit, a muscle pad installed on respiratory muscles of the patient enables smooth breathing motion by stimulating the respiratory muscles based on a signal transmitted from the electric muscle stimulator, and a receptor pad is provided to the respiratory muscles such that an alarm of determining whether electric stimulation is normally applied via the state of the respiratory muscles detected through the receptor pad is output, thereby securing reliability of a device.
US10881853B2
Neuromodulation systems are described comprising a signal generator and at least one electrode. The at least one electrode can be configured to deliver a stimulation to a mammal, wherein the stimulation includes a biphasic signal and an overlapping high frequency pulse thereby inducing voluntary movement in the individual. Methods of administering the stimulation are also described.
US10881848B2
A connector is connectable to a medical device that includes a female connector portion. The connector includes: a main body member including: a cylinder portion that is insertable into the female connector portion, and a lock portion configured to, upon insertion of the cylinder portion into the female connector portion, pass over part of the medical device and then move in a predetermined locking direction to lock the medical device; and a lock member that is movable with respect to the main body member. When the main body member is in a state in which the lock portion locks the medical device, the lock member is moveable to a lock position at which the lock member limits movement of the lock portion in a predetermined unlocking direction.
US10881847B2
A neutral pressure split-septum luer access device is described for receiving a luer lock connector. The septum has a plurality of elastomeric columns projecting laterally within a chamber. Each elastomeric column is under sufficient compression so that the columns are bowed and the column strength is reduced by bowing, but the slit sealing force is high. This configuration places the lower portion of the slit in a tightly sealed configuration which is never-the-less receptive to penetration by the male luer which causes the columns to bow further and collapse precipitously with the elastomeric force of the collapsing mass of the columns being carried distally to displace and pop open the central slit distal the tip of the male luer. The septum further provides a transverse separation between the columns and a distal sealing portion so the force of the displacement force to the sealing portion is reduced.
US10881845B2
A sheath for producing a fully sealed access to the interior of a vessel of an animal or human body comprises a base sheath having a tubular body defining a pass-through channel. The base sheath is adapted to be inserted into the vessel through a vessel aperture. A wall of the tubular body of the base sheath has a through channel. This channel extends in the wall from the distal end towards the proximal end. The channel can be present separately from the pass-through channel of the base sheath or can form a sideways extension of the pass-through channel, at least at the distal end. Such through channel is adapted to conduct blood from the vessel to the proximal end of the sheath when the sheath has been inserted into a vessel.
US10881842B2
Disclosed herein is ureteral stent. The ureteral stent includes a proximal end, a distal end, and a middle portion. The proximal end includes a retention feature having a coiled shape. The distal end is opposite the proximal end. The middle portion is between the proximal end and the distal end.
US10881836B2
Sheath assembly for the insertion of a cord-shaped element (32, 105), comprising an introducer sheath (101) and an auxiliary sheath (104) for insertion into the introducer sheath (101) together with the cord-shaped element (32, 105), with first fastening means (106) for detachably fastening the auxiliary sheath to the introducer sheath, and with second fastening means (107) for detachably fastening the cord-shaped element to the auxiliary sheath, wherein the introducer sheath (101) has a first sheath housing (13, 114) and a distal tubular section (11, 41 a) that terminates in the first sheath housing, and a first flushing device (108), wherein the auxiliary sheath (104) has a second sheath inner chamber (111), a distal, tubular part (112) and a second flushing device (109).
US10881835B2
A medical device for percutaneous or venous access for the purposes of administering a fluid to a patient or sampling from one is disclosed. The device includes a cannula holder that has a part or portion of cross-section which is reduced or different from its distal end and proximal end. The part or portion of reduced or different cross-section allows the cannula holder to deform within the body of the device when activating means are activated to separate the cannula holder from an immobilising member allowing the cannula holder to move in the body of the device and re-enter and disappear within such body of the cannula.
US10881827B2
A method for identifying a mask for a patient includes: receiving a plurality of images of a patient's face; analyzing the plurality of images to generate a temporal model of the patient's face, determining a mask for the patient using the temporal model of the patient's face, and identifying the mask to the patient.
US10881826B2
A method of obtaining a 3D scan of a patient's face includes receiving a request for a 3D scanner from the patient, sending the 3D scanner to the patient, receiving the 3D scan of the patient's face obtained from the 3D scanner from the patient, receiving the 3D scanner from the patient, and using the 3D scan of the patient's face to make, select, or customize a patient interface device for the patient.
US10881823B2
A single lumen endobronchial tube for selective mechanical ventilation of the lungs can include a medical tube having a single lumen with an opening at the proximal end of the tube being adapted for connection to an external mechanical ventilation device, and an opening at the distal end being adapted for delivery of a medical gas; a wall extending throughout the tube's entire length having an internal wall surface, an external wall surface and a thickness therebetween, a portion of the wall having an aperture and a shaft adapted to house a mechanism for sealing the aperture; a distal bronchial cuff and at least a first proximal tracheal cuff positioned along the external wall surface and adapted to expand radially outward.
US10881818B2
An oscillating positive expiratory pressure system including an oscillating positive expiratory pressure device having a chamber, an input component in communication with the chamber, wherein the input component is operative to sense a flow and/or pressure and generate an input signal correlated to the flow or pressure, a processor operative to receive the input signal from the input component and generate an output signal, and an output component operative to receive the output signal, and display an output.
US10881815B2
An herbal dabber vaporizer to heat materials therein to expel vapor therefrom, the herbal dabber vaporizer including a main body, including a main body base, a main body lid disposed above the main body based, at least one tube disposed between the main body base and the main body lid, at least one heating element connected to the at least one tube, and at least one stem to be inserted at least partially into a top aperture of the at least one tube to receive the materials therein, and a glass dome to cover the main body lid and the at least one stem, such that vapor generated from a heating of the materials causes the vapor to be generated within the glass dome, and then expelled out an aperture within the glass dome.
US10881805B2
A drug delivery device is provided comprising a container, a first product and a second product. The device is configured to mix the first product and the second product with each other within the container for forming a drug mixture. The device is further configured for dispensing the drug mixture. The device comprises a mixing member. The device is switchable from a first state, in which the first product and the second product are separated, into a second state, in which the first product and the second product are mixed. The mixing member is configured to exert a force onto the container in order to move the container to mix the first product and the second product with each other. Furthermore, a method for maintaining a predetermined property of a drug mixture to be dispensed from a drug delivery device is provided.
US10881798B2
An injector includes a trigger mechanism including: a trigger member disposed about an axis having an aperture and a protrusion, and a ram assembly having a ram configured to pressurize a medicament container for expelling a medicament therefrom, the ram assembly further having a trigger engagement member configured to engage the aperture of the trigger member when the trigger member is in a pre-firing condition; an energy source associated with the ram for powering the ram to expel the medicament; and a user-operable firing-initiation member having an aperture engaged with the protrusion of the trigger member and operable for causing an axial translation of the trigger member in a proximal direction from the pre-firing condition to a firing condition in which the trigger engagement member is released from the retaining portion to allow the energy source to fire the ram.
US10881794B2
An automatic administration instrument includes a syringe and a partition wall in the syringe which partitions the syringe into different rooms for respectively holding plural kinds of drug solutions or a drug and a drug solution. A partition-wall driver displaces the partition wall and an injection needle is connected to the syringe. A body cap attached to the administration instrument body so as to cover the injection needle. The syringe, the partition wall, and the body cap are configured such that displacing the partition wall dissolves or mixes the drug solutions or the drug and the drug solution in a state that the injection needle is covered by the body cap.
US10881793B2
The embodiments described herein may relate to methods and systems for adjusting insulin delivery. Some methods and systems may be configured to adjust insulin delivery to personalize automated insulin delivery for a person with diabetes. Such personalization may include adjusting user specific dosage parameters in response to a user provided insulin delivery amount, including a user provided insulin delivery amount that varies from a recommended insulin delivery amount.
US10881788B2
A digital biomedical device includes a substrate forming a cavity, a seal formed around the cavity, a lid coupled to the substrate by the seal, a reactive metal structure comprising a plurality of metal layers, wherein the reactive metal structure is a component of at least one of the substrate and the lid, a metal trace configured to initiate a self-propagating reaction between the plurality of metal layers of the reactive metal structure and release contents of the cavity, and a power supply configured to apply an electric current to the metal trace.
US10881786B2
A wearable liquid supplying device for insulin injection is fixed on a user's body through a ring belt and includes a carrier body, a flow-guiding-and-actuating unit, a sensor, an air bag, a miniature air pump and a driving chip. The sensor measures sweat on human skin to detect a level of the blood glucose. The driving chip receives the glucose monitoring data and accordingly controls the actuation of the flow-guiding-and-actuating unit and the open/closed states of the switching valves. The miniature air pump is enabled to inhale gas into the air bag, so that the air bag is inflated and the ring belt contacts the human skin tightly. The flow-guiding-and-actuating unit is enabled to generate a pressure difference so that the insulin liquid is transported to a liquid guiding outlet through a liquid guiding channel and flows into the microneedle patch for being injected into the subcutaneous tissue.
US10881784B2
A medication safety device and method can include an infusion pump and a drug library in communication with the infusion pump. The drug library can have upper hard and soft limits and lower hard and soft limits associated with at least one drug. A graphical user interface can display a bar chart showing upper and lower soft limit bars for the at least one drug. The upper and lower soft limit bars can be grabbed and dragged on the graphical user interface in touch-screen fashion to new positions associated with new upper and lower soft limits. The graphical user interface and associated hardware and software can be configurable to responsively re-analyze data and compare a particular infusion to the new upper and lower soft limits.
US10881776B2
The invention relates to a control unit (30) for detecting an overshoot of a first limit value (G1) of a first blood concentration (B1) in a first portion (17a) of a dialysate discharge line (17) downstream of a dialysate chamber (7) of a dialyser (4) of a blood treatment device and upstream of a node point (110) at which a bypass line (100) bypassing the dialyser (4) leads into the dialysate discharge line (17), wherein the bypass line (100) branches off, upstream of the dialysate chamber (7), from a dialysate supply line (15) suitable for supplying dialysate from a dialysate source (16) to the dialysate chamber (7).
US10881774B2
A method to protect kidneys of a patient undergoing cardiac surgery patient including: administrating a diuretic to the patient to increase urine output of the patient during cardiac surgery, wherein the diuretic is administered during the cardiac surgery; anesthetizing the patient with a general anesthetic during the cardiac surgery; infusing an intravenous liquid into the patient during the cardiac surgery; monitoring a rate or amount of urine output of the patient during the cardiac surgery, and automatically adjusting a rate or amount of the intravenous liquid infused into the patient to achieve or exceed a target urine output during the cardiac surgery.
US10881756B2
The present invention is directed to a gas scrubbing process for removing at least one odorous vaporous compound from a gas stream generated by a rendering process or at least reducing the concentration of that odorous vaporous compound. In one embodiment, a series of two gas/liquid contactors is used, each having a different liquid scrubbing solution, with one scrubbing solution controlled at an alkaline pH and the other scrubbing solution controlled at an acidic pH. In another embodiment, the pH of the respective scrubbing solutions in each of the two gas/liquid contactors is reversed.
US10881741B2
The present invention provides novel, single chain Fc fusion proteins having improved properties. The invention provides single chain fusions of soluble proteins fused to the Fc region of an immunoglobulin via a novel linker comprising a constant region of an immunoglobulin light chain linked to a CH1 constant region of an immunoglobulin heavy chain. This novel linker confers favorable properties on the Fc fusion proteins of the invention such as improved bioactivity and increased half-life as compared to non-Fc fusion counterparts or as compared to prior art Fc fusion proteins. The novel Fc fusion protein scaffold as described herein may be designed to include soluble proteins of interest capable of binding or interacting with any target of interest. Preferably, the Fc fusion protein of the invention is a dimer. The dimer preferably forms via a disulfide bond between free cysteine residues in the hinge region of two monomeric Fc fusion proteins of the invention.
US10881736B2
The present disclosure provides biophotonic compositions, kits and their uses. In particular, the biophotonic compositions of the present disclosure are substantially resistant to leaching such that low amounts of chromophores present in the biophotonic composition leach out of the composition. The biophotonic compositions and their uses are useful for promoting repair of non-healing wounds.
US10881732B2
The present invention provides antagonists and methods of use thereof in the treatment of cancer and abnormal immune suppression diseases.
US10881730B2
The disclosure features immunomodulatory therapeutic compositions of an mRNA encoding an activating oncogene mutation peptide and an mRNA encoding a polypeptide that enhances immune responses to the activating oncogene mutation peptide, for example an mRNA encoding an immune potentiator. The disclosure also features methods of using the same, for example, to stimulate anti-cancer immune responses.
US10881728B2
The invention relates to novel compositions and methods for diagnosing or treating food allergies. The invention particularly discloses new approaches for delivering food allergens to allergic patients by oral administration of formulations which dissolve and release proteins in the stomach. The invention allows the treatment of food allergies by delivering food allergens to the gut immune system with controlled exposure of the esophagus or oral cavity. The invention also allows to perform food challenges to assess the threshold of clinical reactivity without exposing the esophagus and oral cavity. The invention may be used in any subject, particularly human subjects, and is applicable to any food allergen.
US10881723B2
The present invention relates to a vaccine containing fixed virus particles, wherein a summed fever response of three rabbits to the fixed virus particles in a pyrogen test is less than 80% based on a summed fever response of three rabbits to original virus particles of the fixed virus particles or corresponding inactivated virus particles.
US10881710B2
The invention provides a method of treating rhinitis. The method comprises administering an effective amount of a pharmaceutical composition comprising a diketopiperazine with amino acid side chains of aspartic acid and alanine (DA-DKP) formulated for nasal administration. The invention also provides a pharmaceutical product comprising a DA-DKP containing composition.
US10881709B2
The present invention described herein relates to molecules and compositions that interact with molecules that suppress the immune system. More specifically, embodiments described herein concern the discovery, manufacture, and use of compositions that remove immunosuppression the immune system by binding to immunoregulatory peptides that interact with receptors on immune cells, compositions that can stimulate immune cells, and compositions that are cytotoxic to tumor cells.
US10881703B2
The present invention relates to a composition which comprises a mixture which comprises or, alternatively, consists of an extract (a) of a fruit of at least one plant of the genus Vaccinium and at least one ingredient (b) acceptable for pharmaceutical or food use and the use thereof in the prevention and/or treatment of diverticular disease or of a pathology deriving therefrom or correlated thereto.
US10881690B2
The present invention relates to peptides, proteins, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated T-cell peptide epitopes, alone or in combination with other tumor-associated peptides that can for example serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses, or to stimulate T cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules.
US10881689B2
Materials and methods for producing genome-edited cells engineered to express a chimeric antigen receptor (CAR) construct on the cell surface, and materials and methods for genome editing to modulate the expression, function, or activity of one or more immuno-oncology related genes in a cell, and materials and methods for treating a patient using the genome-edited engineered cells.
US10881684B2
Disclosed herein are artificial Invaplexes comprising deacylated lipopolysaccharides and methods of making and using thereof.
US10881683B2
The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet β-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet β-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2: (SEQ ID NO: 1) UAAAGUGCUGACAGUGCAGAU (SEQ ID NO: 2) AGCUACAUCUGGCUACUGGGUCUC.
US10881677B2
The present invention relates to the treatment of breast cancer, more particularly triple negative breast cancer (TNBC), with the use of an inhibitor of Interleukin 1 Receptor Associated Kinase 1 (IRAK1) such as ginsenosides. It also relates to a method for aiding in categorising or determining prognosis in a breast cancer patient or in selecting a therapeutic strategy comprising assessing the level of IRAK1 nucleic acid, protein or activity in a sample and, in some aspects, further assessing the paclitaxel resistance status of the patient and if the patient is resistant to paclitaxel therapy, treating the patient with an inhibitor of IRAK1 activity. In addition, a screening method for identifying a compound useful for treating breast cancer comprises determining the effect of a test compound on IRAK1 nucleic acid, protein or activity level and selecting a compound that reduces said level.
US10881669B2
Disclosed are inhibitors of the plasmodial surface anion channel (PSAC) inhibitors and the use thereof in treating or preventing malaria in an animal such as a human, comprising administering an effective amount of an inhibitor or a combination of inhibitors. An example of such an inhibitor is a compound of formula I, or a pharmaceutically acceptable salt thereof, wherein R1 to R7 are as described herein.
US10881662B2
A problem to be solved by the present invention is to provide a substance having an effect of increasing intracellular ATP and, particular, a potent ATP enhancer far surpassing the increasing effect of inosine alone or a xanthine oxidase/xanthine dehydrogenase inhibitor alone. A human or animal intracellular ATP enhancer comprising a combination of A) and B): A) a xanthine oxidase/xanthine dehydrogenase inhibitor; and B) hypoxanthine, or a compound capable of being converted to hypoxanthine in the body.
US10881661B2
The disclosure relates to an edible energy composition that includes a methylated xanthine, a choline derivative and a flavorant.
US10881654B2
Methods and pharmaceutical compositions for inhibiting 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) and the treatment of cancer are described.
US10881650B2
Novel methods for treating or reducing the likelihood of acquiring symptoms or diseases due to the menopause, in postmenopausal women, particularly osteoporosis, vaginal atrophy and dryness, hypogonadism, diminished libido, skin atrophy, connective tissue disease, urinary incontinence, breast, endometrial, ovarian and uterine cancers, hot flashes, loss of muscle mass, insulin resistance, fatigue, loss of energy, aging, physical symptoms of menopause, in susceptible warm-blooded animals including humans involving administration of a sex steroid precursor are disclosed. Said method comprising novel ways of administering and dosing dehydroepiandrosterone (DHEA) in order to take advantage of positive androgenic effects in the vaginal layers lamina propia and/or the layer muscularis, without undesirably causing systemic estrogenic effects in order to avoid the risk of breast and uterine cancer. Pharmaceutical compositions for delivery of active ingredient(s) useful to the invention are also disclosed.
US10881645B2
Methods for controlling, maintaining, or reducing blood pressure, and/or for treating, preventing, or alleviating symptoms such as dyspnea, in a patient suffering from or susceptible to acute heart failure. The methods involve the administration of an effective amount of a pharmaceutical composition comprising a short acting dihydropyridine compound such as clevidipine. The pharmaceutical composition may be administered at an initial dose, and if blood pressure is not controlled or maintained within a target blood pressure range or reduced to within a target blood pressure range, the initial dose may be titrated to achieve a blood pressure within the target blood pressure range. The patient may have a systolic blood pressure of about 120 mmHg or above.
US10881642B2
Provided are a compound of chemical formula 1 or 2 and a use thereof. The compound can be advantageously used in the prevention or treatment of metabolic diseases including type 2 diabetes, insulin resistance, or obesity, on the basis of a mechanism of autophagy activation through the promotion of lysosome production.
US10881640B2
A topical composition comprising about 5 wt % to about 12.5 wt % of metronidazole or a pharmacologically acceptable salt thereof in a non-aqueous vehicle. The composition may be used in the treatment of skin damage due to inflammatory skin conditions; thermal, chemical or electrical burns; infections or radiation treatment. One advantage of the composition is that topical administration of metronidazole results in a primarily local effect, and thus, side effects observed from systemic administration are avoided.
US10881628B2
Disclosed herein are methods for culturing CAR-modified immune cells with at least one Retinoic Acid Receptor and/or Retinoid X Receptor active agent.
US10881626B2
Disclosed herein are controlled-release oral pharmaceutical dosage forms comprising MGBG, and their application for the improved treatment of diseases with reduced side effects and/or longer time at maximum concentration.
US10881625B2
A method of reducing the risk of medication-related overdose, death, or other injury associated with inappropriate consumption of alcohol in conjunction with prescription opioid analgesics, comprising: administering a combination medication having an effective amount of one or more opioid medications, and an effective amount of one or more aldehyde dehydrogenase inhibitors, in order to provide the powerful analgesic effects of the opioid in conjunction with a substance that prevents concomitant alcohol consumption, thereby reducing the risk of alcohol mediated opioid overdose or death. A combination medication, including an effective amount of one or more opioid medications, and an effective amount of one or more aldehyde dehydrogenase inhibitors and a pharmaceutically acceptable carrier.
US10881622B2
Technologies are described for delivery of compounds to aid in weight management. A transdermal microdispenser based system may deliver weight management compounds through the time and dose specific administration of appetite suppression, metabolic enhancers, and satiation compounds. The transdermal delivery system may be controlled based on data associated with subject such as calorie intake, physical activity, satiation, and hunger. The system may be integrated with medical monitoring or fitness tracking systems. Delivery of the compounds may be distributed over the course of a day at selected or adjusted doses to be safe and effective for their specific modality. For example, appetite suppressants may be delivered during periods of the day when cravings occur, satiation compounds may be delivered to coincide with meals, and metabolic stimulators may be delivered at times to optimally increase metabolism based on caloric balance. Control factors may also be predictive to prevent the onset of hunger.
US10881621B2
A composition includes sintered ferrous amino acid particles prepared by sintering a ferrous amino acid chelate which includes ferrous ions and an amino acid. The sintered ferrous amino acid particles have an average particle size ranging from 500 to 2600 nm and a weight average molecular weight ranging from 1,500 Dalton to 600,000 Dalton. Also disclosed herein are a method for inhibiting and/or killing a virus in a subject and applications of such method. The method includes administering to the subject the composition.
US10881605B2
Injectable depot compositions comprising a biocompatible polymer which is a polymer or copolymer based on lactic acid and/or lactic acid plus glycolic acid having a monomer ratio of lactic to glycolic acid in the range from 48:52 to 100:0, a water-miscible solvent having a dipole moment of about 3.7-4.5 D and a dielectric constant of between 30 and 50, and a drug, were found suitable for forming in-situ biodegradable implants which can evoke therapeutic drug plasma levels from the first day and for at least 14 days.
US10881603B2
A method for reducing a presence of sebum on skin, reducing an appearance of shiny skin, or reducing an appearance of the size of skin pores is disclosed. The method can include topically applying to skin a composition comprising a navy bean extract comprising amino acids, an extract of Bambusa vulgaris wendl shoots, charcoal, and Lonicera japonica leaf extract.
US10881591B2
The instant disclosure relates to an integral porous fiber media with distinguishable distribution of fiber density, fiber diameter and capillary force. The instant disclosure further relates to a fiber porous media that includes multiple density portions. The disclosed media is a single piece, such that the different density portions are not separable. The disclosed media provides improved liquid delivery properties for a specific liquid delivery device.
US10881590B2
A wet wiper for cleaning an oral cavity or an oral appliance. The wet wiper comprises a water insoluble substrate and a physiologically acceptable cleansing composition. Methods for cleansing oral cavities and oral appliances are also provided, such methods comprising the step of contacting the surface of an oral cavity or an oral appliance with a wet wiper of the present invention for a sufficient time to permit cleaning.
US10881588B2
Methods of inserting a tube through the nasopharynx of a patient are disclosed. The methods of inserting a tube through a nasopharynx of a patient includes the steps of inserting the tube through a naris of the patient; and when a distal end of the tube is proximate a rear surface of the nasopharynx, pulling on or holding in place a thread-like member attached to a tube portion of the distal end of the tube so as to alter an initial direction of the distal end of the tube and point the distal end of the tube towards a throat of the patient. Kits for inserting a tube through the nasopharynx of a patient are also disclosed. The kits include a tube sized so as to move through a nasopharynx of a patient; and a thread-like member that is attachable to a tube portion of a distal end of the tube and can be tensioned so as to alter an initial direction of the distal end of the tube and point the distal end of the tube towards a throat of the patient. Methods of making kits for inserting a tube through the nasopharynx of a patient are further disclosed.
US10881585B2
A pill compliance device maintains a patient's pill supply and monitors the patient's access to pills contained in the device to memorialize the patient's compliance with his/her pill-taking regimen. The device has a housing, including an inner pill or capsule storage compartment and an electronics unit, a removable cover, a switch to detect removal of the cover and magnet away from the housing, and to detect a replacement of the cover and magnet to the housing, wherein activating the switch triggers a transition from an active state, to a dormant state, and vice versa. A transition from the dormant state to the active state, by replacing the cover to the housing generates a pill-taken signal. A microcontroller generates a compliance notification signal that is communicated wirelessly, to memorialize the apparent compliance.
US10881584B2
Kits for allowing pharmacist to easily compound medications are provided. The kits include a mixing container, a first active ingredient and an inactive ingredient. It is further provided that methods of mixing compounds. Some kits include coloring agents that aid in the establishment proper mixing. Other kits include colored labels located on the ingredients.
US10881581B2
A medicine dispensing apparatus comprises a medicine containing/dispensing unit (11) for supplying medicines of various kinds; a medicine wrapping part (45) for wrapping the medicine supplied from the medicine containing/dispensing unit (11) for every one dose package by a dispensing paper (S); a medicine wrapping hopper (73) for falling down the medicine for one dose package into a dispensing paper S in the medicine wrapping part (45) and a medicine check part (5) for determining depending on a photographed image of the medicine wrapping hopper (73) whether or not the medicine is adheres to the introduction part.
US10881571B1
A method and apparatus provides a body worn apparatus having a plurality of activation elements arranged in at least one bundle, and a substrate supporting the plurality of activation elements. The method also places the body worn apparatus onto the body of a person, and activates the at least one bundle.
US10881568B2
A system for adjusting the height of a patient support surface on a bed includes one or more height adjustment actuators operable to adjust a height of the patient support surface above a floor surface; a controller connected to the one or more height adjustment actuators, the controller including a memory; and one or more user interface units connected to the controller, wherein the controller is configured to record as a stored actuator state a current state of the one or more height adjustment actuators in the memory in response to a first input signal from the one or more interface units, and is configured to operate the one or more height adjustment actuators to automatically return them to the stored actuator state in response to a second input signal from the one or more interface units. Alternatively, or in addition, the controller may be configured to provide an indication to a user when the one or more height adjustment actuators have returned to the stored actuator state during a subsequent height adjustment operation.
US10881566B2
An articulated patient support apparatus includes upper and lower body support frames hinged together to form a patient support assembly which is hinged to head and foot end supports. One end of the assembly includes a length compensator to enable hinged angulation between the body support frames. Hinge motors are connected between the frames to cause hinged articulation therebetween. One or both of the body support frames has a body slide assembly mounted thereon to enable part of a patient's body to move linearly along the particular body support frame by operation of a slide motor to compensate for hinged articulation of the frames. The hinge motors and slide motor have encoders interfaced to a controller to digitally coordinate sliding movement with hinging articulation.
US10881565B2
A system for use with a bed having a frame and a supporting surface includes a sheet having a bottom surface placed above the supporting surface of the bed, a top surface, and a plurality of tether straps connected to and extending from the sheet. Each tether strap is configured for connection to the bed. The bottom surface is at least partially formed of a low friction material, and the top surface is at least partially formed of a high friction material, such that the top surface provides greater slipping resistance than the bottom surface. The tether straps include at least two pairs of tether straps, with one pair connected proximate a top edge of the sheet and another pair connected proximate a bottom edge of the sheet. The sheet may further include a sliding member on the bottom surface to assist in lateral sliding of the sheet.
US10881564B2
A seat assist device is described. The seat assist device includes a base, a lift platform having a front portion and a rear portion, with the front portion of the lift platform being pivotally connected with the base. A lifting arm is connected with the rear portion of the lift platform. The lifting arm extends from the lift platform to project beyond the front portion of the lift platform, with the lifting arm terminating in handles for grasping by a user. A lift bar is pivotally connected between the base and the lifting arm, whereby a user sitting upon the seat assist device can press downward on the handles to cause the rear portion of the lift platform to rise and, in doing so, assist the user in rising from a seated position.
US10881560B1
This invention includes embodiments which disclose patient transportation devices such as toboggans or litters, which may include adjustable handle lock and positioning systems, a handle attachment and detachment system which renders the handle readily attachable and detachable to the transportation device and/or an anchor system for securing or stabilizing rescue stretchers and rescue litters when rescuing and transporting patients.
US10881557B1
A sanitary product disposal device includes an outer telescopic member and a flexible inner liner for holding a sanitary product to be dispensed. The outer telescopic member is adjustable between a collapsed position and an expanded position. The telescopic member has two sealable ends. The inner liner has a dispensing end at one of the two sealable ends. The dispensing end of the liner is configured to receive a sanitary product. The telescopic member is in the collapsed position before receiving a sanitary product, and in the expanded position after receiving the sanitary product.
US10881556B2
In an absorbent article (200), a pair of slits (40) each extending in a front and rear direction with a predetermined width is formed in an absorbent body (23) at a front and rear direction region at least at a crotch portion (C2) such that to section a first portion (11) at middle, and a second portion (12) and a third portion (12) at both sides of the first portion in a width direction, respectively, projection portions (23P) projected toward both sides in the width direction at middle in the front and rear direction of the first portion (11) are included in the absorbent body, and cavity portions (23D) in which the projection portions (23P) fit outwardly in the width direction are formed at a front and rear direction position corresponding to the projection portions (23P) in the second portion (12) and the third portion (12), respectively.
US10881555B2
A fluid-absorbent article having an upper liquid-pervious layer, a lower liquid-impervious layer, a fluid-absorbent core between the layer and the layer, containing from 0 to 20% by weight fibrous material and from 80 to 100% by weight of a water-absorbent polymer material, based on the sum of water-absorbent polymer material and fibrous material. The fluid absorbent article has a first intake time of 15 seconds or less by the hanging U-shape test (HUS).
US10881547B2
A dental orthotic strut having at least one multi-axis rotable joint connecting the strut to either a maxillary and/or mandibular retainer attached to the teeth. Jaw advancement may be accomplished by periodically replacing the strut with a new strut having a slightly longer minimum length, thereby advancing the resting position of the closed jaw. The rotable joint or joints allow greater freedom of movement and comfort when the jaw is opened in a non-sagittal plane. A plurality of strut pairs having a same length, but with progressively longer sets of strut pairs is generally supplied, so that left and right struts can be progressively replaced with longer struts over time.
US10881544B1
The invention concerns a brace, ideally disposable, formed from a blank and, particularly but not exclusively, a neck or limb brace wherein the brace is contoured to fit about a wearer and comprises at least one, or a series of, crease line(s) that mirror(s) the contour of at least one edge of said brace and spaced from same by a selected amount whereby said edge can be folded or torn along at least one selected crease line to fit a wearer.
US10881539B2
An implantable biocompatible expander suitable for implantation into a urinary duct, comprises an elongated sinusoidal ring comprising at least two proximal prongs and at least two distal prongs, wherein the expander is resiliently deformable from a relaxed radially expanded orientation to a radially contracted orientation suitable for transluminal delivery through the urinary duct. The expander is configured to exert an outward radial force against a wall of the urinary duct when in-situ within the urinary duct. In particular, the expander is suitable for treatment of benign prostatic hyperplasia and configured for implantation into the prostatic urethra between, and substantially spanning the prostatic urethra between, the bladder neck and external sphincter.
US10881536B2
[Object] To provide a hybrid actuator attaining both driving force and responsiveness, capable of reducing inertia of a movable portion. [Solution] A pneumatic air muscle has a cylinder (112) provided in a flexible member (100) forming a pneumatic artificial muscle. At the center of an upper lid element (109) of the cylinder, a through hole is opened, and an inner wire (103) of a Bowden cable passes through this through hole and is coupled by means of a spring (106) to a bottom portion of the cylinder. When the pneumatic artificial muscle contracts, the inner wire (103) and the pneumatic air muscle move together because of the stopper (105), and the contraction force is transmitted. In contrast, when the pneumatic air muscle extends, the stopper (105) is disengaged, while the tension of inner wire (103) is kept by the spring (106) to prevent slacking.
US10881531B2
Apparatus and associated methods relate to a spinal implant configured to expand both vertically and laterally at the same time when wedges coupled by a threaded post drive movable spinal implant endplates radially outward from the longitudinal axis of the threaded post, displacing the wedges and expanding the implant as the threaded post turns. In an illustrative example, the wedges may be a pair of wedges configured with dual inclined planes. The inclined planes may be, for example, disposed both vertically and laterally with respect to the threaded post longitudinal axis, permitting implant expansion both vertically and laterally simultaneously. In some examples, the wedges may be cones. Some embodiments may include a lock adapted to prevent the threaded post from turning. Various examples may advantageously provide improved stability and reduced subsidence, based on increased vertebral body contact area with an implant expanded in place to the desired height and width.
US10881529B2
A spinal implant is provided that includes a body extending in direction at least substantially along a body axis, between a first end portion and a second end portion. The spinal implant also includes a first bearing surface disposed relative to the first end portion, and defining a first relief pattern that is configured to inhibit movement of the spinal implant relative to one or more vertebrae in at least substantially all directions. A method for manufacturing the spinal implant involves use of selective laser sintering.
US10881525B2
Presently disclosed is a spinal implant. In an embodiment, a spinal implant includes a porous body configured to promote bone growth. The porous body may have an attachment portion that is configured to secure the spinal implant to a fixation system attached to one or more vertebra. The porous body may also include a fusion plate extending from the attachment portion and configured to contact transverse processes, lamina, or facet of adjacent vertebrae. Accordingly, when the attachment portion is secured to the fixation system, the fusion plate may be maintained in compression against the transverse processes, lamina, or facet.
US10881523B2
The present invention provides a next generation, closed profile, total disc replacement device with mechanical features designed to sustain, restrain and guide the larger motions required to preserve normal mechanical motion, while at the same time, providing a flexion component to guide and restrain the finer motions reached at the extremes of the mechanical motion preservation components.
US10881519B2
A mosaic implant (2010) comprises a mesh support frame comprising a plurality of polygonal support rings (2040 A, B, C) connected by a plurality of struts (2014), and a plurality of mosaic plates (2012). The support rings are positioned within the mosaic plates; the struts extend between adjacent plates. An implant (1510) for filling a bore hole comprises a plate (1512) and a support frame (1520) having a central portion (1522) located at least partially within the plate, a polygonal outer rim (1524) having a plurality of fastening points for attaching the implant to bone surrounding a bore hole, and a plurality of arms (1530) extending between the central portion and the outer rim. The plurality of arms extend inwardly and downwardly away from the outer rim such that the central portion is located below the plane of the outer rim and the upper surface of the plate is flush with or slightly above the upper surface of the outer rim.
US10881508B2
A replacement valve for replacing a damaged heart valve having a plurality of cusps separating an upstream region from a downstream region of a passage. The replacement valve includes a flexible band having biocompatible scaffolding sized for contact with a wall surrounding the passage in the patient's heart. The valve includes a resilient element attached to the flexible band for expanding the flexible band to contact the wall of the passage. The valve includes regenerative struts spaced around the flexible band. Each strut extends from an outboard end joined to an inward face of the flexible band to a central end. The central ends of the struts are joined together. The valve includes a flexible regenerative membrane joined to adjacent struts. The membrane extends outboard to an inward face of the band. An outboard edge of the membrane is free to move between a closed position and an open position.
US10881500B2
An orthopedic attachment system includes a first bone anchor, a second bone anchor, and a flexible connector. The flexible connector is connected between the first bone anchor and the second bone anchor. The flexible connector includes a sliding loop, a tensioning end and a fixed end. The sliding loop is connected to a sling loop bone anchor, and the fixed end is connected to the fixed end bone anchor. The tensioning end is slidably connected and lockable to the fixed end. A flexible connector, a method for attaching a flexible connector between at least two bone anchors in a patient's body, and a method of making a flexible connector are also disclosed.
US10881492B2
An oral care regimen where a user applies a first composition and a second composition to the oral cavity. The first composition can be a dentifrice and can contain stannous fluoride and the second composition can be a dentifrice and can contain hydrogen peroxide. The regimen can provide a long-lasting clean feeling. Compositions and methods for improving compliance with a two-part oral care regimen may include the use of a first composition with mildly unpleasant organoleptic properties.
US10881476B2
A surgical tool includes a drive housing having an input shaft and a drive cable capstan arranged therein. The input shaft includes a drive gear and the drive cable capstan including a driven gear intermeshed with the drive gear such that rotation of the input shaft rotates the drive cable capstan. An elongate shaft extends from the drive housing, and an end effector is operatively coupled to a distal end of the elongate shaft. A drive cable is received within a pulley track defined on the drive cable capstan and extends only partially around a circumference of the drive cable capstan. The drive cable is fed directly into the elongate shaft from the pulley track and extends to the end effector.
US10881468B2
Systems, methods and a sensor alignment mechanism are disclosed for medical navigational guidance systems. In one example, a system to make sterile a non-sterile optical sensor for use in navigational guidance during surgery includes a sterile drape having an optically transparent window to drape the optical sensor in a sterile barrier and a sensor alignment mechanism. The alignment mechanism secures the sensor through the drape in alignment with the window without breaching the sterile barrier and facilitates adjustment of the orientation of the optical sensor. The optical sensor may be aligned to view a surgical site when the alignment mechanism, assembled with the sterile drape and optical sensor, is attached to a bone. The alignment mechanism may be a lockable ball joint and facilitate orientation of the sensor in at least two degrees of freedom. A quick connect mechanism may couple the alignment mechanism to the bone.
US10881461B2
A method of analyzing a hollow anatomical structure of interest for percutaneous implantation. The method comprises acquiring image data of an anatomical region of interest that includes the anatomical structure of interest, and generating a segmented model of the anatomical region of interest using the acquired image data. The method further comprises obtaining image(s) of the anatomical structure of interest by sectioning out intervening anatomical structures from the segmented model thereof, identifying one or more pertinent landmarks of the anatomical structure of interest in the acquired image(s), and measuring at least one of a circumference, a maximal diameter, or a minimal diameter of one or more features of the anatomical structure of interest contained in the acquired image(s) to determine an anatomical structure size. The method still further comprises reconciling the anatomical structure size and an implant size.
US10881459B2
The invention relates to a tissue monitoring apparatus, a tissue monitoring method and an ablation lesion monitoring, measuring, and controlling automated algorithm incorporating diffuse reflectance spectroscopy (DRS) and/or Arrhenius model thermal denaturation kinetics for determining the characteristics of the lesion or the tissue, especially for identifying the transmurality of the ablation lesion. The invention pertains to a device for and method of real time monitoring of lesion formation as ablation is being carried out.
US10881450B2
A surgical instrument having a handle, elongate shaft protruding from handle and end-effector located at end of shaft is described. To allow for rotation of the end-effector the shaft is connected to a rotation wheel mounted on handle, towards rearward end of handle proximal to the user. The rotation wheel is in the form of a thumbwheel, having an ergonomically designed shape that tapers from distal direction to proximal direction, with angle of the taper matching angle of the outer surface of the handle. The outer tapered surface of the thumbwheel has a number of shaped cut-out or scalloped portions arranged around the outer circumference of the wheel, and arranged in use to receive the tip of a user's thumb to allow the user to rotate the wheel in order to set the rotational orientation of the end-effector. Such an arrangement provides a comfortable and easy to use instrument.
US10881449B2
An end effector is disclosed. The end effector includes a first jaw member. The first jaw member comprises a first electrode. The first jaw member defines a first aperture at a distal end. The end effector includes a second jaw member. The second jaw member comprises a second electrode. The second jaw member defines a second aperture at a distal end. The second jaw member is operatively coupled to the first jaw member. The first and second apertures are configured to define a single aperture when the first and second jaw members are in a closed position. The first and second electrodes are configured to deliver energy.
US10881448B2
A surgical instrument includes a body assembly, a waveguide, a transducer, and a coupling assembly. In some versions the coupling assembly translates the transducer to couple the transducer to the waveguide. For instance, a gear having arcuate troughs may engage pins on the transducer and/or waveguide to mate the transducer to waveguide. A pawl may selectively engage and prevent rotation of the gear. Alternatively, lever arms may cam the transducer into the waveguide. The lever arms may selectively couple to a casing to prevent decoupling of the transducer and waveguide. In another configuration, a locking tab can be slid and locked into a slot to couple the transducer and waveguide. Further still, levers with self-locking pins may engage and couple the transducer to the waveguide. In another version, a rotatable body portion may engage a tab on the transducer to rotate and couple the transducer to the waveguide.
US10881447B2
Systems and methods for treating or manipulating biological tissues are provided. In the systems and methods, a biological tissue is placed in contact with an array of electrodes. Electrical pulses are then applied between a bias voltage bus and a reference voltage bus of a distributor having switching elements associated with each of the electrodes. The switching elements provide a first contact position for coupling electrodes to bias voltage bus, a second contact position for coupling electrodes to the reference voltage bus, and a third contact position for isolating electrodes from the high and reference voltage buses. The switching elements are operated over various time intervals to provide the first contact position for first electrodes, a second contact position for second electrodes adjacent to the first electrodes, and a third contact position for a remainder of the electrodes adjacent to the first and second electrodes.
US10881433B2
The present disclosure relates to software used in planning the correction of bone deformities preoperatively or postoperatively, and in particular relates to virtually manipulating rings and struts of an external fixation frame in order to plan the steps for making a desired correction to two or more bone portions of a patient. The software can be used prior to surgery, allowing a user to virtually define a bone deformity, and virtually add and manipulate fixation rings and struts to the bone deformity. Based on the virtual manipulations, a correction plan can be generated that describes length adjustments that should be made to the plurality of model struts over a period of time to correct the bone deformity. The software can also be used after surgical fixation of the fixation frame and struts to the deformed bone.
US10881432B1
A uterine manipulator device useful for laparoscopic hysterectomy procedures or other minimally-invasive gynecologic procedures.
US10881430B2
In an aspect, a device includes a body structure including a core and a sleeve disposed around at least a portion of the core, the core defining a channel through the core extending from a first end of the core to a second end of the core, the sleeve including a flange adjacent the second end of the core; and a deployable portion coupled to the body structure adjacent the first end of the core, the deployable portion having a wired structure transitionable between a retained configuration and a deployed configuration, wherein a top portion of the wired structure extends beyond the first end of the core in a longitudinal direction when the wired structure is in the retained configuration, and wherein first end of the core extends beyond the top portion of the wired structure when the wired structure is in the deployed configuration.
US10881414B2
The present disclosure provides a surgical clip for ligating a blood vessel or tissue structure. The surgical clip includes a first leg member including a first inner surface and a first plurality of protrusions disposed on the first inner surfaces. The surgical clip also includes a second leg member including a second inner surface and a second plurality of protrusions disposed on the second inner surface. The surgical clip further includes a hinge member joining the first leg member and the second leg member. The at least one of the first and second plurality of protrusions includes a gable structure that extends along a longitudinal direction of the first or second inner surface. The orientation and the geometric shape of the protrusions of the surgical clip allow for increased resistance to the migration or sliding of the clip along a longitudinal direction of the blood vessel or tissue structure, while providing a balanced closure force. The surgical clip can prevent the longitudinal migration along the blood vessel or tissue structure.
US10881409B2
A surgical device includes an actuator assembly including a handle, an adapter assembly extending distally from the adapter assembly, and a tool assembly supported on a distal portion of the adapter assembly. The adapter assembly includes a rotation assembly that rotatably supports the adapter assembly in relation to the actuator assembly and a wire harness that allows the actuator assembly to communicate with the tool assembly. The rotation assembly includes a stop assembly for limiting a degree of rotation of the adapter assembly in relation to the actuator assembly to prevent separation of the wire harness from communication with the actuator assembly and/or the tool assembly. The stop assembly includes a stop plate and a stop pin that are spaced from the wire harness to minimize the likelihood of damage to the wire harness during rotation of the adapter assembly in relation to the actuator assembly.
US10881407B2
An assembly including a positioning tool that includes a probe affixed to a portion of a grasping tool, wherein a distal tip of the probe protrudes distally from the grasping tool a distance corresponding to a position for placing a magnet with the grasping tool.
US10881406B2
A side-to-end vascular anastomosis device comprising a diversion conduit coupled to a lower flange which is inserted into the vessel and an upper flange located on the outside of the vessel designed to clamp together to seal the incision into which the lower flange of the device is inserted.
US10881403B2
Surgical stapling systems and methods for stapling tissue during a surgical procedure are provided. In an exemplary embodiment, a control system is provided for controlling at least one motor coupled to a drive system on a surgical stapling device for driving one or more drive assemblies. The control system can be configured to communicate with the drive system of the stapling tool and to control and modify movement of one or more drive assemblies based on certain feedback.
US10881397B2
A surgical device is provided that includes a jaw portion, having a first jaw in opposed correspondence with a second jaw, the second jaw including a surgical member. The surgical device may include a shaft portion coupled to a proximal end of the jaw portion and at least one motor configured to rotate the jaw portion relative to the shaft portion, to move the jaw portion relative to the shaft portion, move the first jaw relative to the second jaw and move the surgical member within the second jaw. The surgical member may be prevented from moving within the second jaw unless the first jaw is in a closed position relative to the second jaw. Advantageously, the surgical member may include one or both a cutting element or a stapling element, disposed within one of the jaws.
US10881392B2
Devices and methods for minimally invasive suturing are disclosed. One suturing device for minimally invasive suturing includes a proximal section a distal end, and an intermediate region therebetween. The device includes a suture head assembly having a suturing needle with a pointed end and a second end. The suturing needle is capable of rotating about an axis approximately perpendicular to a longitudinal axis of the device, wherein the pointed end of the suturing needle is positioned within the suture head assembly prior to deployment of guides that are adapted and configured to guide the needle around a circular path when advanced by a drive mechanism having a needle driver for engaging and rotating the suturing needle.
US10881382B2
Disclosed herein is method and system for determining quality of semen sample. Trajectories of objects, identified in each of plurality of image frames of semen sample, are generated by tracking movement of the objects across image frames, and compensating a drift velocity of the semen sample. Further, generated trajectories are classified into sperm and non-sperm trajectories. Finally, total concentration estimate and total motility estimate of the semen sample are computed to generate a semen quality index, which indicates quality of the semen sample. In an embodiment, the method of present disclosure uses a multi-level Convolutional Neural Network (CNN) analysis technique for effectively classifying the object trajectories into sperm and non-sperm objects. Also, since the present method includes estimating and compensating drift velocity in the semen sample, it enhances overall accuracy of motility estimation and semen quality analysis.
US10881372B2
In an X-ray imaging apparatus, an X-ray irradiation unit, an X-ray detection unit, a control unit configured to control irradiation of an X-ray, an X-ray image processing unit configured to operate independently of the control unit, and a storage battery for the X-ray image processing unit and the control unit are provided. The X-ray image processing unit is configured to acquire information on a remaining amount of the storage battery from the control unit and perform processing of reducing power consumption of the X-ray image processing unit when the remaining amount of the storage battery is equal to or less than a predetermined threshold value.
US10881360B2
A method for determining a deformation measurement of a couch in a medical procedure may include determining a first deformation measurement of the couch at a reference point, the first deformation measurement corresponding to a first working position of the couch. The method may also include determining a second deformation measurement of the couch at the reference point, the second deformation measurement corresponding to a second working position of the couch. The method may further include determining a difference between the first deformation measurement and the second deformation measurement and causing an adjustment of one of the first working position and the second working position of the couch based on the difference between the first deformation measurement and the second deformation measurement.
US10881354B2
An online real-time correction method and system for a positron emission tomography (PET) detector. The method includes: acquiring a drifted channel number of a peak position of a full-energy peak in a drifted energy spectrum after a gain value of a PET detector system has changed and a ratio of a currently accumulated energy of each signal channel to a current total accumulated energy of all signal channels; substituting the above parameters, an initial channel number of the peak position of the full-energy peak in an initial energy spectrum and a ratio of an initially accumulated energy of each signal channel to a total initially accumulated energy of all of the signal channels in the PET detector system into a gain adjustment ratio calculation formula to calculate a gain adjustment ratio; and adjusting, according to the gain adjustment ratio, a gain value of the PET detector system.
US10881344B2
A method and apparatus for reconstructing the behavior of an individual which provides: a detection operation, comprising recording monitoring signals using a detection apparatus carried by the subject; a mapping operation, comprising recording monitoring signals in an environment in which the behavior of the subject is to be reconstructed and the monitoring signals are to be associated with a map of the environment; an operation of reconstructing the behavior, comprising taking on as positions, over time, points on the map in which the monitoring signals recorded in the detection operation correspond to the monitoring signals recorded in the mapping operation.
US10881340B2
An apparatus for insertion of a medical device in the skin of a subject is provided, as well as methods of inserting medical devices.
US10881339B2
Devices, systems, and methods for providing more accurate and reliable sensor data and for detecting sensor failures. Two or more electrodes can be used to generate data, and the data can be subsequently compared by a processing module. Alternatively, one sensor can be used, and the data processed by two parallel algorithms to provide redundancy. Sensor performance, including sensor failures, can be identified. The user or system can then respond appropriately to the information related to sensor performance or failure.
US10881322B2
Described herein are novel fMRI-based neurologic signatures that predict fibromyalgia (FM), clinical severity, and treatment outcomes. Further described are methods for diagnosing FM and for predicting or evaluating efficacy of a treatment of FM based on the neurologic signature.
US10881319B2
An apparatus for treating dizziness comprises an input unit configured to input a type of dizziness suffered by a patient, a storage unit configured to store different treatment methods respectively corresponding to different types of dizziness, an operation unit configured to search for a treatment method corresponding to the diagnosed type of dizziness among the treatment methods stored in the storage unit based on the diagnosed type of dizziness, and an output unit configured to output the searched treatment method for the inputted type of dizziness to the patient.
US10881318B2
An improved apparatus and method of using an EEG net to obtain electroencephalographic measurements from a patient in an emergent or urgent care setting. The net is comprised of a headpiece with a plurality of straps and recording ports formed therein. A recording head of an electrode is associated with each recording port and is pre-incorporated into the net. Transmitting wires are associated with each electrode head and have common terminated points. The terminus of each wire is hard wired into a connecting device that can be directly mated to a receiving console or remotely transmit wirelessly the electrode signals.
US10881316B2
A method for automatically determining the 3D position and orientation of a radio-opaque medical object in a living body using single-plane fluoroscopy comprising: (a) capturing a stream of digitized 2D images from a single-plane fluoroscope; (b) detecting an image of the medical object in a subset of the digital 2D images; (c) applying to the digital 2D images calculations which preserve original pixel intensity values and permit statistical calculations thereon, using (i) multiple sequential determinations of a midline of the medical object image, (ii) a plurality of unfiltered raw-data cross-sectional intensity profiles perpendicular to each sequentially-determined midline, (iii) removal of outlier profiles from each plurality of profiles, and (iv) statistically combining each plurality of profiles to estimate image dimensions; (d) applying conical projection and radial elongation corrections to the image measurements; and (e) calculating the 3D position and orientation of the medical object from the corrected 2D image measurements.
US10881300B2
Described herein are systems and methods for noninvasive functional brain imaging using low-coherence interferometry (e.g., for the purpose of creating a brain computer interface with higher spatiotemporal resolution). One variation of a system and method comprises optical interference components and techniques using a lock-in camera. The system comprises a light source and a processor configured to rapidly phase-shift the reference light beam across a pre-selected set of phase shifts or offsets, to store a set of interference patterns associated with each of these pre-selected phase shifts, and to process these stored interference patterns to compute an estimate of the number of photons traveling between a light source and the lock-in camera detector for which the path length falls within a user-defined path length range.
US10881298B2
A method and apparatus for metal implant contact detection through capacitive measurements is provided. Capacitive measurement is accomplished with a conductive wire/lead, for example a main needle. The measured capacitance increases as the main needle is moved through the skin and tissues, then jumps when the main needle makes contact with the metal implant, thus proving the metal implant exists as well as detecting the location of the metal implant. The jump in capacitive measurement is detectable because the area of capacitance has increased from the main needle alone to the main needle plus the surface area of the metal implant. The apparatus can include a reference needle for taking reference needle capacitive measurements in the tissues surrounding the metal implant to increase the accuracy during use of the apparatus. A housing is provided for supporting the main and reference needles and supporting or housing apparatus electronics.
US10881292B2
The invention is directed to a system for determining the refractive properties of an eye. The system includes a wavefront measurement device for measuring the refractive properties of the eye. The system is configured to have at least one measurement mode assigned to children, wherein the system has an input device configured to switch the system into one of the at least one measurement mode assigned to children. The system is further configured to alter at least one of a group including a default pupillary distance, a default cornea vertex distance, a default position of the wavefront measurement device, a default position and/or direction of a measurement ray of the wavefront measurement device, a default position of a forehead and chin rest assembly of the system and a fixation target when the system is switched into the one of the at least one measurement mode assigned to children.
US10881280B2
Certain aspects relate to manually and robotically controllable medical instruments. A manually and robotically controllable medical instrument can include an elongated shaft articulable by pull wires. The elongated shaft can be connected to an instrument handle that attaches to an instrument drive mechanism. The instrument handle can include a pulley assembly on which the pull wires can be mounted. Rotation of the pulley assembly can actuate the pull wires to cause articulation of the elongated shaft. The medical instrument also includes a manual drive input connected to the pulley assembly such that manual actuation of the manual drive input causes rotation of the first pulley assembly and a robotic drive input configured to engage with a robotic drive output of the instrument drive mechanism such that rotation of the first robotic drive output causes rotation of the pulley assembly.
US10881267B2
A fabric care device comprising a body having first and second ends for attaching respective first and second fabric care attachments, wherein at least one of the first and second ends is adapted to detachably attach one of the first and second fabric care attachments. An attachment for a fabric care device selected from the group consisting of a depiller, a delinter, a fabric pile restorer, and a brush.
US10881263B2
A cleaning pad including at least one strip of relatively lower absorbency material and at least one strip of relatively higher absorbency material.
US10881256B1
A retractable platform for use in conjunction with a toilet seat configured to be compact when in the retracted position. The retracted platform becomes a generally leveled standing platform when engaged in the opened position providing a stable platform for a child to stand on and turn around to position oneself to sit on a toilet seat. When the platform is in the retracted position, it allows an adult to sit on a toilet seat without any obstruction from the stool to their legs or feet. A cut out on its front panel receive adult-sized feet so the platform in the retracted position does not have to be physically moved when an adult needs to use the toilet. The retracted platform can be easily moved to assist a child needing a vertical advantage in a different location.
US10881252B2
Versatile personal sprayers positioned on or in a floor or ground spray fluid upward in a variety of permanent and portable environments and installations, such as a portable or fixed bidet, spray toy and shower floor. A versatile personal fluid spraying device has a spray chamber and may be combined with a drain chamber. Multiple sets of spray patterns may variously spray upward and angled, e.g., to the front and back locations between the legs of a user above the spray device. A drain feature permits a versatile personal sprayer to drain the same fluid it sprays regardless whether it is fixedly or portably installed. Drain features include one or more of a narrowing shape allowing side drainage, an elevating shape allowing underside draining and an integrated drain chamber allowing flow through drainage.
US10881251B2
A walk in bath includes a shell, a door, and a seal member. The shell defines a bathing area and includes a wall with an opening therein. The door is moveable relative to the wall between a closed position, in which the door engages the opening, and an open position allowing ingress into and egress from the bathing area through the opening. The seal member is located between the wall and the door in the closed position to seal a gap therebetween to prohibit water from leaking from the bathing area through the gap. The seal member includes a first end, a second end, and an intermediate hollow section extending between the first and second ends. Each of the first and second ends is closed to prevent water from entering into the seal member.
US10881248B2
A collapsible horizontal vegetable processor comprises a base (1) and a cutter frame holder (13). The cutter frame holder is detachably provided with a replaceable cutter frame (2). The base is provided with a sliding rail mechanism. The base comprises a fixed portion (11) and a collapsible portion (12). The cutter frame holder (13) is arranged on one side of the fixed portion, and the collapsible portion is arranged on the other side of the fixed portion. The sliding rail mechanism is slidably provided with a sliding seat (4). The sliding seat is provided with a sliding seat frame body (5) and a handle (6). Pressing teeth (51) used to fix vegetables and a rotating operation device (52) are arranged at the top of the sliding seat frame body. The sliding seat is driven by the handle to move on the sliding rail mechanism. The base of the vegetable processor is collapsible, thereby greatly reducing an occupied space.
US10881244B2
A lid assembly that can be placed on a pan having a bottom surface that is configured for placement on a burner of the stove top with one or more foods to be cooked supported above an inner bottom surface of the pan by a rack. The lid assembly covers the pan and thereby encloses the one or more foods to be cooked and the rack within a cavity defined by the pan and the lid assembly. An air flow generator mounted on a shaft that extends through a cover portion of the lid from a motor disposed on an opposite side of the cover portion rotates the shaft to produce airflow within the cavity. The lid assembly cooks foods in less time and using less energy than normally required with a conventional oven.
US10881243B2
A machine (100) for espresso coffee of the piston type is described. The machine comprises a cylinder (1), a piston (2) which is configured to perform a translation movement in said cylinder, a rod (4) having an end cooperating with said piston (2), an operating lever (5), a spring (3), a member (6) configured to cooperate with said rod (4) and to move said piston (2) from a first position to a second position in which said spring (3) is at least partially compressed, and an opening (71) for introducing water into said cylinder (1) configured so as to introduce water above the piston (2).
US10881236B2
A cooking vessel includes a receptacle of a first material for receiving foodstuff, and a bottom section of a second material. The bottom section being attached to the receptacle for providing an induction heating capability for the cooking vessel. In order to provide a cooking vessel whose temperature can simply and reliably be determined during induction heating the second material is unalloyed or low-alloyed steel.
US10881234B2
A secure mail and package storage apparatus for safely receiving mail includes a package housing that is secured to the ground and a lid coupled to the package housing that selectively closes a storage cavity. A lid lock locks and unlocks the lid. A CPU that is in operational communication with the lid lock has a transceiver that is configured to communicate with a smartphone. A mail tower with a mail door and a mail door lock is coupled to the package housing. A first keypad and a second keypod operate the lid lock and the door lock, respectively.
US10881223B1
A first face has a picture with an image to be displayed. A second face is operatively coupled to the first face. The second face has text pertinent to the image on the first face. A support component is operatively coupled to the second face for positioning the picture in an orientation whereby the image is displayed with the text in operative proximity.
US10881222B1
Embodiments of the invention include a barrier assembly including a frame to hold a barrier member. A bracket defines a track and the bracket can be attached to a support surface such that a first branch of the bracket resides on a first side of the support surface and a second branch of the bracket resides on a second side of the support surface. An articulating connector couples the frame to track, the articulating connector enables the frame to move in at least two degrees of freedom relative to the track. The frame and connector can move along the track from a first position in which the frame resides above the support surface to a second position in which the frame resides below the support surface.
US10881220B2
Utensil dispensers and methods for making and using same are provided herein. In some examples, the utensil dispensers can include a housing. At least two dispense chassis can be disposed within the housing. Each dispense chassis can be configured to move between a first position in which the dispense chassis is configured to dispense utensils from the housing and a second position in which the dispense chassis is configured to be loaded with utensils. A chassis interlock can be configured to prevent at least one of the dispense chassis that is in the first position from moving toward the second position when one other of the dispense chassis is in the second position.
US10881218B2
The invention provides an overlay configured to substantially conform to a contoured surface. The overlay comprises at least a first layer having a rear surface on which a plurality of channels are located. Optionally, the overlay also comprises one or more removable contouring members, which are located between adjacent channels on the rear surface of the overlay.
US10881211B1
The collapsible chair is foldable and collapsible in a variety of different configurations. The collapsible chair includes a seat frame having a rear bar and a pair of side bars. A seat is mounted on the seat frame, the seat having a rear edge pivotally attached to the rear bar of the seat frame and a front edge slidably and pivotally attached to the pair of side bars of the seat frame. Front and rear portions of the seat are selectively foldable with respect to one another and with respect to the seat frame. The chair has a plurality of legs, an upper end of each leg being pivotally attached to the seat frame and selectively foldable against the seat frame. The chair has a back rest having opposed upper and lower ends, the lower end being pivotally attached to the rear bar of the seat frame.
US10881208B2
A chair includes a support mechanism 2 interposed between a leg 1 and a seat 3, wherein the support mechanism 2 is arranged below the seat 3, is configured to each individually and movably support the seat 3, at least at two locations in a front-rear direction and two locations in a left-right direction, along a predetermined trajectory, and the support mechanism 2 includes: a seat inclining mechanism Q or a seat inclining function configured to downwardly incline a tip side in a movement direction of the seat 3 in accordance with movement of the seat 3, and further includes: a center-of-gravity movement mechanism P or a return-force generation mechanism configured to generate a return force in a direction of returning the seat 3 having moved from a reference position (S) in a front-rear or left-right direction, to the reference position (S) by using a center-of-gravity movement.
US10881204B2
A drawer and its furniture fittings are provided. The furniture fittings include a first wall, a second wall, and a mounting device. The second wall is provided with a first structure, and the mounting device is provided with a second structure. The second structure of the mounting device and the first structure of the second wall are detachably engaged with each other without using tools. The second wall is mounted on the first wall through the mounting device.
US10881199B1
A rack features a front panel, a rear panel, a first rail assembly and a second rail assembly. The first rail assembly includes (i) support members extending in a first lateral direction, (ii) a first set of edge connectors extending in a first longitudinal direction for coupling with a first attachment mechanism of the front panel, and (iii) a second set of edge connectors extending in a second longitudinal direction for coupling with a third attachment mechanism of the rear panel. The second rail assembly includes (i) support members extending in a second lateral direction opposite the first lateral direction, (ii) a third set of edge connectors extending in the first longitudinal direction for coupling with the second attachment mechanism of the front panel, and (iii) a fourth set of edge connectors extending in the second longitudinal direction for coupling with the fourth attachment mechanism of the rear panel.
US10881196B1
The makeup application brush with detachable illuminated mirror is comprised of a cosmetic brush and a lighted mirror integrated into one device. The lighted mirror is attached to a proximal end of the makeup application brush handle with the makeup brush head at a distal end of the makeup application brush handle. The makeup application brush is separated by screwing apart the handle for independent use of the lighted mirror or cosmetic brush. The lighted mirror segment is powered by USB charging. With the provision of visibility and lighting from the lighted mirror, the makeup application brush can be used for makeup application or makeup removal. The makeup application brush is innovative in the beauty industry field by combining two beauty accessories: a lighted mirror and a makeup application brush into one device.
US10881189B2
A carrying bag with a water resistant Velcro® outer case and an activated carbon inner liner provides an odor proof capability. The Velcro® outer surface provides for user selected placement of one or more removable patch attachments. The invention described here reduces the need to purchase alternative backpacks due to endless user configuration of possible looks. The carry bag may include one or more carry handles and one or more shoulder straps.
US10881184B1
A disposable cartridge assembly for stick products, intended to be used in conjunction with a rotating base member that unlocks the cartridge and raises and lowers the stick product in the assembly. The rotating base member is intended to remain connected to the cartridge assembly for the life of the stick product, but may be detached and reused with multiple cartridges, which can be sold for the purpose. This design creates various options for manufacture and assembly of the various components at one or more locations.
US10881183B2
A cosmetic product applicator tip includes an attachment part suitable for being assembled with a support rod and an application part of the product extending along a main direction. The attachment part includes a support finger external to the support rod, the application part being attached to the support finger so as to encompass most of the support finger. The application part is configured to switch from an idle position wherein the support finger and the proximal end of the application part are free from any contact to a use position, wherein the support finger and/or the application part yield such that the proximal end of the application part is at the point of coming, or comes, into contact with the support finger and/or the support rod.
US10881181B2
A garment hanger. The garment hanger includes a body having a triangular perimeter. A first end of a strap is connected to an apex portion of the body. A slide adjuster is disposed on the strap and configured to adjust the length thereof. A fastener is disposed on a second end of the strap, and a strap connector is disposed on the strap between the first end and the second end. The strap is configured to maintain an open loop configuration when the fastener is connected to the strap connector, such that a garment may be hung on a horizontal rod. In one embodiment, the garment hanger includes a bag having a bag connector thereon, wherein the fastener is removably securable to the bag connector, so that a garment may be hung from the bag.
US10881177B2
A bag, in particular a foldable bag, comprises a tube having a closed end and an open end. The tube is of a fabric and includes at least one set of pleats. The at least one set of pleats includes at least five parallel longitudinal folds in alternating directions that extend from the closed end to the open end of the tube. The longitudinal folds of the at least one set of pleats are secured in place at the closed end of the tube. The sections of fabric on opposite sides of each longitudinal fold are arranged the one on top of the other in a folded state of the at least one set of pleats.
US10881173B1
An embodiment includes a walking stick. The walking stick includes a rod assembly, a water purification assembly, and a manual pump. The rod assembly extends from a first end to a second end that is opposite the first end along a longitudinal direction of the rod assembly. The rod assembly includes at least one rod portion. The water purification assembly is integrated with the rod assembly. The manual pump is configured to impose a pressure gradient in the water purification assembly. The manual pump includes a plunger that is physically coupled to a handle portion. Motion of the plunger relative to the water purification assembly draws water into an inlet tube that is positioned in the rod portion and through the water purification assembly. The motion of the plunger results from translation of the handle portion in substantially the longitudinal direction of the rod assembly.
US10881166B2
A sole member for an article of footwear includes a composite sole structure and a reinforcing member. The sole structure may comprise two layers of woven composite material. The two layers have substantially similar woven patterns. The sole structure includes bulging portions with centrally recessed portions. The reinforcing member fits into channels associated with the bulging portions.
US10881161B2
A helmet may include an upper-body comprising a first outer shell coupled to a first energy-absorbing shell formed of expanded polypropylene (EPP), expanded polystyrene (EPS), expanded polyurethane (EPU), or expanded polyolefin (EPO). A lower-body may include a second outer shell coupled to a second energy-absorbing shell formed of EPP, EPS, EPU, or EPO, wherein an upper portion of the lower-body is nested within the upper-body and a lower portion of the lower-body extends to an outer surface of a lower portion of the upper-body. A strap anchor may be disposed between the upper-body and the lower-body, and be sandwiched between the upper-body and the lower-body with the strap anchor being adjacent to, and oriented towards, the lower-body. A strap may be coupled to the fastening device and coupled to the strap anchor for coupling the helmet to a head of a user.
US10881158B1
A lighted artificial tree includes a first tree portion including a first trunk portion, first branches joined to the first trunk portion, and a first light string. The first trunk portion has a trunk connector and a first trunk wiring assembly, the first trunk wiring assembly is electrically connectable to the first light string and the trunk connector, and at least a portion of the first wiring assembly is located inside the first portion. The second tree portion includes a second trunk portion, second branches, and a second light string. The second trunk portion has a trunk connector and a second trunk wiring assembly, the second trunk wiring assembly electrically connectable to the second lighting string and the trunk connector. The second tree portion may be mechanically coupled and electrically connected to the first tree portion by coaxially coupling the first trunk portion to the second trunk portion.
US10881157B1
Personal protective equipment (PPE) and a method of wearing the PPE integrating a temperature reader biasing the temperature reader into direct thermal contact with the forehead without projecting elements and without the use of tight straps, thereby improving the comfort of the wearer while still providing face shielding functionality and accurate temperature reading. The frame has a concave curvature opposite the forehead of the wearer and the thermochromic strip is disposed as a chord across the concavity to bias the thermochromic strip against the forehead, thus reliving some of the pressure from the nosepiece to the thermochromic strip.
US10881153B2
A garment portion comprises a flexible resilient belly panel portion adapted to substantially conform to and cover a wearer's belly. The belly panel portion extends from an upper edge portion below the wearer's breast area and over the wearer's abdomen to a lower edge portion below the wearer's waist. A waistband is selectively connected with the lower edge portion of the belly panel. The belly panel portion is removably attached to the waistband.
US10881150B2
Smoking articles, and methods for forming such smoking articles, such as an electronic smoking article, are provided. An exemplary smoking article comprises a control body portion having a control body engagement end, and having a first control component therein. A cartridge body portion includes a cartridge body engagement end configured to removably engage the control body engagement end of the control body portion. The cartridge body portion further includes a consumable arrangement comprising at least an aerosol precursor composition and at least one heating element operably engaged therewith, and a second control component. At least the consumable arrangement is configured to be in communication with the first control component upon engagement between the cartridge body and control body portions.
US10881149B2
There is provided an aerosol generating device for heating an aerosol-forming substrate, including a storage portion for storing the aerosol-forming substrate and a vaporizer for heating the aerosol-forming substrate to form an aerosol. The storage portion has an outer housing and an internal passageway, the storage portion forming a reservoir for the aerosol-forming substrate between the outer housing and the internal passageway, and the vaporizer extends at least partially inside the internal passageway in the storage portion. The device further includes a porous interface at least partially lining the internal passageway for conveying the aerosol-forming substrate from the storage portion towards the vaporizer.
US10881146B2
An elastic locking mechanism, an atomizer for an electronic cigarette, and an electronic cigarette are disclosed. The elastic locking mechanism includes an upper cover removably arranged on an opening end of a liquid storage assembly, a screw cap sleeved outside the upper cover, an upper engagement component arranged on the screw cap, a lower engagement component arranged on the upper cover, and an elastic element mounted between the screw cap and the upper cover to prevent the upper engagement component and the lower engagement component from engaging each other. When the screw cap is pressed down or pulled up, the elastic element is compressed or stretched so that the upper engagement component engages the lower engagement component, and the upper cover is driven to rotate together with the screw cap by rotating the screw cap.
US10881143B2
A flavor inhaler includes: an aerosol flow path for guiding, to the mouthpiece side, an aerosol generated by an atomizing part; and an acid flow path for guiding, to the mouthpiece side, an acid discharged from an acid generating source without allowing the acid to pass through the atomizing part. The aerosol flow path includes at least a first flow path for guiding the aerosol to the mouthpiece side through a flavor inhalation component source.
US10881141B2
An aerosol provision system for generating an aerosol from a source liquid, the aerosol provision system including: a reservoir of source liquid; a planar vaporizer comprising a planar heating element, wherein the vaporizer is configured to draw source liquid from the reservoir to the vicinity of a vaporizing surface of the vaporizer through capillary action; and an induction heater coil operable to induce current flow in the heating element to inductively heat the heating element and so vaporize a portion of the source liquid in the vicinity of the vaporizing surface of the vaporizer. In some example the vaporizer further comprises a porous wadding/wicking material, e.g. an electrically non-conducting fibrous material at least partially surrounding the planar heating element (susceptor) and in contact with source liquid from the reservoir to provide, or at least contribute to, the function of drawing source liquid from the reservoir to the vicinity of the vaporizing surface of the vaporizer. In some examples the planar heating element (susceptor) may itself include a porous material so as to provide, or at least contribute to, the function of drawing source liquid from the reservoir to the vicinity of the vaporizing surface of the vaporizer.
US10881140B2
A vaporizer assembly includes a tube having a first end with an inlet opening and a second end with an outlet opening. The vaporizer assembly also includes a heater element configured to vaporize liquid aerosol-forming substrate. The heater element is at the second end of the tube. The first end of the tube is fluidly connectable with a liquid storage portion. When the first end of the tube is fluidly connected with the liquid storage portion, the liquid aerosol-forming substrate can flow from the liquid storage portion through the inlet opening into the tube. The outlet opening of the tube includes perforations having a width ranging from about 1 micrometer to about 500 micrometers.
US10881135B1
A hydrodynamically cooled and filtered smoking apparatus is provided having a housing, an inlet pipe, a stirring mechanism, and a flow deflecting body. The housing having at least one wall portion providing a chamber configured to contain a fluid for circulation therein. The inlet pipe has an inlet configured to draw in smoke from a source and an outlet provided within the chamber beneath a top surface of the contained fluid configured to deliver the smoke into the chamber for entrainment within the fluid. The stirring mechanism is provided in the housing and is driven to induce cyclonic circulation of the fluid and the smoke in the chamber. The flow deflecting body has a suction surface with at least one aperture provided in the suction surface and communicating with the inlet pipe. The suction surface is oriented in the fluid to generate hydrodynamic force to draw smoke into the fluid and aerate the fluid by entraining the smoke in the fluid as bubbles. A method is also provided.
US10881132B2
The invention provides a smokeless tobacco composition adapted for oral use, the composition including a tobacco material and an effervescent material. The effervescent material includes a sugar material containing an entrapped gaseous component, such that release of the entrapped gaseous component occurs upon dissolution of the sugar material in the oral cavity. The invention also provides a method for making a smokeless tobacco composition that involves mixing a tobacco material with an effervescent material, the mixing step including either admixing a granulated composition comprising a tobacco material with a gasified sugar material in particulate form, or forming a gasified sugar material in situ by mixing a water source with a molten composition comprising a tobacco material and a sugar alcohol.
US10881129B2
A method of making coated avian egg yolk cores includes providing dried avian egg yolk cores having a diameter of 100 to 1500 micrometers, applying avian egg albumen to the dried avian egg yolk cores to provide the coated avian egg yolk cores, and optionally drying the coated avian egg yolk cores, wherein the ratio of dry avian egg albumen to dried avian egg yolk in the coated avian egg yolk cores is 1:10 to 10:1. Also included are the coated avian egg yolk cores, food and feed additives containing the coated avian egg yolk cores and food and feed compositions containing the coated avian egg yolk cores.
US10881128B2
The invention relates to a squeezing machine of the type in which the juice is obtained in a squeezing unit comprising at least one male drum (5) and at least one female drum, the female drum (4) having recesses for holding the fruit and the male drum having protrusions that insert in the recesses of the female drum to catch the fruit, the squeezing unit (2) and other auxiliary elements are joined to each other, preferably by a casing, such that they can engage and be released from the drive element (1) as a single block.
US10881124B2
Provided is a method for producing an alkyl cellulose having a high viscosity and not having an excessively high gel strength. More specifically, there is provided a method for producing an alkyl cellulose comprising the steps of: mixing a cellulose pulp with a first alkali metal hydroxide solution with stirring to obtain alkali cellulose; reacting the alkali cellulose with an alkylating agent to obtain a first reaction mixture; blending a second alkali metal hydroxide solution with the first reaction mixture with stirring, without further blending of the alkylating agent, to obtain a second reaction mixture; and purifying the second reaction mixture to obtain an alkyl cellulose. There is also provided an alkyl cellulose being produced by the above method and having a degree of substitution of alkyl group of 27 to 33% by weight.
US10881121B2
A cooking-conveying-batching apparatus for automatic cooking and food production. It uses the principle of rotation to cook, convey and formulate batching. Cooking containers are rotated by a curved bevel track that lowers the cooking containers into a heat source cooker. At the end of the cooking process the cooking containers are raised and rotate to deposit the cooked food into conveying containers. The conveying containers rotate towards a batching container that deposits ingredients into the food-containing conveying containers.
US10881112B2
The present invention relates to a method for the production of a soft cake having at least a molded face and at least a non-molded face, the molded face having at least one molded three-dimensional pattern, the method comprising the steps of: a) pouring a cake batter suitable for forming a soft cake into a pan, wherein the cake batter has a viscosity of between 500 and 1 Pa·s; b) baking said soft cake batter in said pan to form a soft cake; and c) removing the soft cake from the pan, wherein the pan has a molded inner surface for receiving the cake batter and which provides the three dimensional molding pattern of the soft cake, and wherein the molded inner surface of the pan has an arithmetical mean degree of roughness (Ra) of from 0.12 μm to 0.22 μm, wherein the molded three-dimensional pattern of the soft cake is complementary to the molded inner surface of the pan and has a molded groove which is in recess relative to said molded face and/or a molded ridge which protrudes relative to said molded face, said molded groove and/or molded ridge having a minimum width of less than 4 mm measured across the groove or ridge at the maximum depth or height respectively.
US10881111B1
The present invention provides a composition of long-term constant-concentration aqueous chlorine dioxide solution including dissolved chlorine dioxide, a decomposition inhibitor for dissolved chlorine dioxide, and a pH modifier, and a method for preparing the same.
US10881110B2
The present invention relates to herbicidal compositions comprising an isoxazolo[5,4-b]pyridine and at least one further compound selected from herbicidally active compounds and, if desired, safeners. The present invention also relates to the use of such a composition for controlling unwanted vegetation and to a method for controlling unwanted vegetation, which comprises allowing a composition to act on plants, their seeds and/or their habitat.
US10881109B2
The present invention relates to herbicidal compositions comprising an isoxazolo[5,4-b]pyridine and at least one further compound selected from herbicidally active compounds and, if desired, safeners. The present invention also relates to the use of such a composition for controlling unwanted vegetation and to a method for controlling unwanted vegetation, which comprises allowing a composition to act on plants, their seeds and/or their habitat.
US10881107B2
Embodiments of the invention relates to an antimicrobial composition comprising an alkyl pyrazine compound or mixture of compounds selected from the group consisting of 2-isobutyl-3-methylpyrazine, 2-isobutyl-3-methoxypyrazine, 2-isopropylpyrazine, 2-isobutylpyrazine and mixtures of methylpyrazines having one, two and three isopropyl or isobutyl substituents. Further embodiments of the invention relate to uses of alkyl pyrazine compounds, in particular for controlling microbial growth.
US10881104B2
The present invention generally relates to compositions and methods related to controlling arthropods. Embodiments of the invention include compositions for controlling an arthropod, which can include one or more plant essential oils and methods for using these compositions. The plant essential oils, when combined, can have a synergistic effect. Embodiments of the invention relate to compositions and methods related to controlling lice.
US10881101B2
A mechanical insecticide including: a biodegradable substrate; and a layer of mineral particles partially embedded in a surface of the biodegradable substrate.
US10881096B1
A motion sensing nuisance fauna deterrent is provided for abating animal nuisances from disturbing a target flora. A sensing platform having a fixed base portion provides a stationary support platform. A rotating base platform has proximity detection sensors positioned about a periphery for proving non-contact proximity sensing capable of detecting a nuisance animal. A speaker provides an audible output in response to an actuation initiated the proximity sensors. A decoy secured to the platform is in the form of a canine. By placing at a detection perimeter and directed outward, an approach of a nuisance animal initiates an audible alarm to deter the approach of the nuisance animal with a non-lethal effect. The instant abstract is neither intended to define the invention disclosed in this specification nor intended to limit the scope of the invention in any way.
US10881094B2
An insect vacuum and trap attachment system can include a tubular member having an elongate channel that extends along an outer surface of the tubular member. The system can also include a suction member that slideably receives the tubular member. The suction member can have a narrowed open tip that receives insects and a stem that extends along at least an outer surface of the suction member. The stem can be slideably received by the elongate channel to enable the suction member to slide with respect to the tubular member. The system can include a catch that protrudes from the stem. The catch may be arranged and configured to receive a portion of an insect filter pod and thereby couple the insect filter pod between the tubular member and the suction member.
US10881080B2
The purpose of the present invention is to provide a pet bed which is not soiled by liquids such as liquid excrement and cleaning solutions, and which can maintain excellent sanitary conditions. This pet bed (1) is provided with a bed main body (5) that includes: a frame (3) which has a prescribed thickness; and a mat (4) which is less thick than the frame (3) and is detachably fitted into the frame (3). The pet bed (1) is provided with an absorbent sheet (2) on the top surface of the mat (4), and, in an opened state, the area in plan view of the absorbent sheet (2) is greater than the area in plan view of the top surface of the mat (4).
US10881072B2
Herein provided is a new soybean variety designated ‘G13LL-44’ as well as the seeds, plants and derivatives of the new soybean variety ‘G13LL-44’. Also provided are tissue cultures of the new soybean variety ‘G13LL-44’ and the plants regenerated therefrom. Methods for producing soybean plants by crossing the new soybean variety ‘G13LL-44’ with itself or another soybean variety and plants produced by such methods are also provided. ‘G13LL-44’ is a MG VII line with glufosinate tolerance technology, and with resistance to race 3 of the soybean cyst nematode and frogeye leaf spot, and moderate resistance to southern root-knot nematode. ‘G13LL-44’ yielded 1.4 bu/ac (2.3%) greater than its recurrent parent ‘G00-3213’, across 11 environments and 0.5 bu/ac more than the high-yielding check cultivar ‘AG738 RR’. ‘G13LL-44’ provides a high yielding glufosinate tolerant soybean cultivar with superior nematode resistance.
US10881068B1
A novel maize variety designated X03N361 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X03N361 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X03N361 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X03N361, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X03N361 are provided. Methods for producing maize varieties derived from maize variety X03N361 and methods of using maize variety X03N361 are disclosed.
US10881067B1
A novel maize variety designated X95N785 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X95N785 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X95N785 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X95N785, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X95N785 are provided. Methods for producing maize varieties derived from maize variety X95N785 and methods of using maize variety X95N785 are disclosed.
US10881066B1
A novel maize variety designated X00N529 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X00N529 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X00N529 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X00N529, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X00N529 are provided. Methods for producing maize varieties derived from maize variety X00N529 and methods of using maize variety X00N529 are disclosed.
US10881062B1
A novel maize variety designated X13N205 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X13N205 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X13N205 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X13N205, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X13N205 are provided. Methods for producing maize varieties derived from maize variety X13N205 and methods of using maize variety X13N205 are disclosed.
US10881055B2
The invention is an important innovation in mushroom culture in which not only are mycelia beneficially grown on the novel combination of a grain (or seed) and an herb, in the preferred embodiment of the invention the mycelial mass is grown in a co-fermentation with all of a grain (or seed), an herb and a juice.
US10881044B2
An agricultural machine includes a frame having a tongue hitch for attachment to a towing vehicle, the tongue hitch being oriented along a longitudinal axis inline with the direction of travel. The agricultural machine has running gear configured to support the frame. The running gear includes an axle mounted to the frame and a swing arm pivotably mounted to the axle defining a main pivot axis. A front spindle is mounted at the front end of the swing arm with a front tire mounted to the front spindle and a rear spindle is mounted at the rear end of the swing arm with a rear tire mounted to the rear spindle. The tires are positioned on a same side of the swing arm. The front tire has a smaller diameter than a diameter of the rear tire.
US10888039B2
An apparatus includes a ear piece case housing, a receptacle within the ear piece case housing and configured to hold an earpiece, an earpiece connector at the receptacle and configured to electrically connect with the earpiece, and electromagnetic shielding materials integrated into the ear piece case housing to electromagnetically isolate the earpiece while the earpiece is contained within the case housing. The ear piece case housing may include a charger and a removable slide cover adapted for sliding over the charger.
US10888026B2
An air curtain canister for creating an air curtain includes a housing having a form factor approximating an exterior of a data storage drive. The air curtain canister also includes a fan for creating an airflow in the housing and a nozzle for directing the airflow exiting the housing in a predefined trajectory for creating an air curtain. A data storage library includes an array of drive slots each configured to receive a data storage drive therein. The data storage library also includes a plurality of air curtain canisters positioned laterally in the array of drive slots for creating an air curtain across a front of the remaining drive slots in the array. A method includes selectively instructing air curtain canisters in a data storage library to create an air curtain across a front of an array of drive slots in the data storage library.
US10888023B2
A leak mitigation system for a cooling system may include an isolation valve, a controller, and a computer-readable medium. The isolation valve may selectively isolate an expansion tank from a closed loop containing a coolant circulated by a primary pump having a pump inlet. The expansion tank may maintain the coolant at a predetermined pressure at the pump inlet in the closed loop. The controller may communicate with the primary pump and the isolation valve. The computer-readable storage medium may include instructions executable by the controller to: in response to a detection of a leak of the coolant from the closed loop, shut down the primary pump; and close the isolation valve to isolate the expansion tank from the closed loop.
US10888020B2
Examples herein relate to cooling systems. In one example, a cooling system comprises a plurality of adjacent fan modules configured to generate a plurality of cooling flows, a fan cage having a central axis adapted to contain the plurality of adjacent fan modules, the fan cage comprising a cavity on its central axis. Furthermore, the system comprises a first support bracket adapted to support the fan cage such that the fan cage rotates on its central axis and a bush established in the cavity of the fan cage. A first end of the bush is adapted to engage the first support bracket on a first surface of the fan cage.
US10888018B2
A cooling system for electrical and electronic devices for hot swapping of a fan module without affecting cooling efficiency due to air backflow, preventing stalling of newly installed exhaust device due to reverse rotation. A check valve assembly having an inlet side frame member, an outlet side frame member, and one or more non-symmetrical valve flaps, each flap having a movable part and a fixed part. The outlet side frame allows the flaps to open under suction pressure on side of the outlet side frame, the inlet side frame disallows the flaps to open under suction pressure on side of the inlet side frame, allowing air to flow in one direction from inlet side frame side to outlet side frame side only. The check valve assembly can be independent of the exhaust device. The check valve assembly can prevent backflow of air during hot swapping of the exhaust device.
US10888014B2
A slide rail mechanism includes a slide rail and a bracket device. The bracket device is arranged to the slide rail. Wherein one of the slide rail and the bracket device includes a structure feature for communicating with two opposite sides of the slide rail mechanism.
US10887999B2
A method for manufacturing a mounting body comprising: a mounting step of mounting an electronic component onto a wiring board via an anisotropic conductive film containing a binder having an epoxy resin as a primary constituent and conductive particles having a compressive hardness (K) of 500 kgf/mm2 or more when compressively deformed by 10%, wherein a relation between a thickness (A) of the binder and an average particle diameter (B) is 0.6≤B/A≤1.5 and an elastic modulus of the binder after curing is 50 MPa or more at 100° C.; and a remounting step of mechanically peeling to detach the electronic component and the wiring board in the case of a problem occurring in mounting of the mounting step and reusing the wiring board to perform the mounting step.
US10887998B2
A method (200, 300, 500) for producing an electrically conductive pattern on substrate (202, 402), comprising: providing electrically conductive solid particles onto an area of the substrate in a predefined pattern (508), where the pattern (403) comprises a contact area (404B) for connecting to an electronic component and a conductive structure (404A) having at least a portion (414) adjacent to the contact area, heating the conductive particles to a temperature higher than a characteristic melting point of the particles to establish a melt (510), and pressing the melt against the substrate in a nip, the temperature of the contact portion of which being lower than the aforesaid characteristic melting point so as to solidify the particles into essentially electrically continuous layer within the contact area and within the conductive structure in accordance with the pattern (512), wherein the thermal masses of the contact area and the at least adjacent portion of the conductive structure are configured substantially equal.
US10887996B2
A method for increasing a service lifetime of an electronic component includes applying a topological insulator coating layer on a surface of the electronic component and performing a test on the electronic component with the topological insulator coating layer applied thereto. The electronic component with the topological insulator coating layer exhibits at least a 100% improvement during the test when compared to an otherwise equivalent electronic component without the topological insulator layer applied thereto. The electronic component with the topological insulator coating layer exhibits at least a 100% improvement during the test when compared to an otherwise equivalent electronic component with a graphene layer applied thereto. The test includes at least one of: a waterproofness test, an acetic acid test, a sugar solution test, and a methyl alcohol test.
US10887993B2
An apparatus includes an electrical device having a surface. The electrical device includes a first surface conductor spaced apart from a second surface conductor on the surface to provide circuit contacts to the device. A first standoff connector is bonded to the first surface conductor. The first standoff connector includes a leg having a proximal end bonded to the first surface conductor. The leg of the first standoff connector extends outwardly from the first surface conductor to a bend that is spaced apart from the surface of the electrical device. A second standoff connector is bonded to the second surface conductor. The second standoff connector includes a leg having a proximal end bonded to the second surface conductor. The leg of the second standoff connector extends outwardly from the second surface conductor to a bend that is spaced apart from the surface of the electrical device.
US10887987B2
An article includes a wafer having a body which defines a first surface and a second surface. The wafer defines a via having a via surface extending between the first and second surfaces through the body. An adhesion layer is positioned on the via surface. At least a portion of the via surface is free of the adhesion layer. A metallic component is positioned within the via and extends from the first surface to the second surface.
US10887983B2
A printed circuit board includes a circuit layer and a ground layer disposed above the circuit layer. The ground layer includes ground layer sections each having metal members, arranged in parallel in one direction on a plane. Areas of the metal members of adjacent ground layer sections are different from each other. The areas of the metal members are determined based on respective areas of circuits of the circuit layer corresponding to respective ground layer sections.
US10887979B2
A system for reducing low cycle fatigue of a soldered connection includes a controller and a heating element operatively connected to the controller. The system also includes a printed wire board soldered in connection with an electronic component. The controller is configured to retrieve a signal indicative of a temperature of the electronic component, and compare the temperature to a stored predetermined range of operating temperatures. Responsive to determining that the temperature of the electronic component is less than a lower threshold temperature of the predetermined range of operating temperatures, the controller transmits a signal to the heating element that causes the heating element to heat the electronic component. The controller then saves, to an operatively connected computer readable memory, a magnitude of temperature difference and a number of times that magnitude is reached. The controller uses the stored information to track the life of the electronic component.
US10887976B2
A negative ion-based beam injector comprising a negative ion source and an accelerator. The ions produced by the ion source are pre-accelerated before injection into a high energy accelerator by an electrostatic multi-aperture grid pre-accelerator, which is used to extract ion beams from the plasma and accelerate to some fraction of the required beam energy. The beam from the ion source passes through a pair of deflecting magnets, which enable the beam to shift off axis before entering the high energy accelerator. The negative ion-based beam injector can be combined with a neutralizer to produce about a 5 MW neutral beam with energy of about 0.50 to 1.0 MeV. After acceleration to full energy, the beam enters the neutralizer where it is partially converted into a neutral beam. The remaining ion species are separated by a magnet and directed into electrostatic energy converters. The neutral beam passes through a gate valve and enters a plasma chamber.
US10887973B2
Laser-produced plasma light source contains a vacuum chamber with a rotating target assembly providing a target in an interaction zone with a laser beam focused on the said target, which is a molten metal layer. A debris shield is rigidly mounted to surround the interaction zone, said shield comprising only two opening forming an entrance for the laser beam and an exit for a short-wavelength radiation beam. The means for debris mitigation can additionally include: the rotation of target with high linear velocity exciding 80 m/s; the orientation of the short-wavelength radiation beam and/or of the laser beam at an angle of less than 45° to the target surface, a nozzle supplying a high-speed gas flow to the interaction zone, etc. The technical result is the creation of the high-brightness low-debris sources of soft X-ray, EUV and VUV light at wavelengths of 0.4 to 200 nm.
US10887967B2
A data generation method is for generating video data that covers a second luminance dynamic range wider than a first luminance dynamic range and has reproduction compatibility with a first device that does not support reproduction of video having the second luminance dynamic range and supports reproduction of video having the first luminance dynamic range, and includes: generating a video signal to be included in the video data using a second OETF; storing, into VUI in the video data, first transfer function information for identifying a first OETF to be referred to by the first device when the first device decodes the video data; and storing, into SEI in the video data, second transfer function information for identifying a second OETF to be referred to by a second device supporting reproduction of video having the second luminance dynamic range when the second device decodes the video data.
US10887960B2
Tunable LED lighting systems, devices and methods are described herein. A light emitting device includes at least a first phosphor-converted LED configured to emit light having a desaturated orange color point characterized by CIE 1976 color coordinates 0.3
US10887952B2
A tortilla cooking device includes induction stages arranged in a substantially vertical configuration, with some of the induction stages including one or more induction elements. The cooking device also includes tortilla pans. A respective tortilla pan is configured for being removably positioned on at least one of the induction stages and formed from a material suitable for magnetic induction based heating. The tortilla pay converts magnetic energy received from at least one induction element of the induction stage to thermal energy. A respective induction stage includes a recessed portion substantially matching a protruding bottom surface of the tortilla pans. The tortilla pans further include a lip structure for retaining one or more materials on a cooking portion of the tortilla pans. The cooking device further includes a casing unit configured to contain the plurality of induction stages arranged in a substantially vertical configuration.
US10887951B2
Disclosed are a cooking apparatus and a method of controlling the same. The cooking apparatus includes a plurality of light sources configured to emit light toward a cooking container and grouped into a plurality of groups and a light emission driving controller configured to perform control in a manner that flame images are displayed by performing group controlling on the basis of at least one of a control command input by a user, a grouping form of the plurality of groups and a preset operation pattern.
US10887948B2
Power feed connections and sauna heating panels include a power feed having a first insulated conductor electrically coupled to a first terminal and a second insulated conductor electrically coupled to a second terminal. The first and second terminals are electrically coupled with at least one heating element. In some cases the power feed includes a supply portion, a connection portion, and an extension portion. The extension portion has one or more conductors in a twisted configuration extending away from the first and second terminals. In some cases the power feed includes an extension conductor portion coupled to a return conductor portion in a twisted configuration. The extension portion extends away from a second terminal past a second connection point and the return portion returns back to and connects to the second connection point at the second terminal. Methods for providing power connections to heating panels are also provided.
US10887944B2
A method of operating a UPF in a wireless communication system includes receiving a data packet, identifying a PFCP session context associated with the data packet, determining whether a PDR associated with the PFCP session context should be modified or a new PDR should be created, transmitting a request to a session management function to provision a new or modified PDR at the UPF, receiving a session modification response from the SMF provisioning the new or modified PDR for the PFCP session context at the UPF, and applying the new or modified PDR on the data packet.
US10887934B2
A terminal is described, along with a method for data processing carried out by the terminal, for communication via a plurality of interfaces of the terminal. The terminal can include a first interface for communication via a radiofrequency link, and a second interface for communication via a short-range link, where the second interface can be polluted by the radiofrequency link used by the first interface. The terminal can be configured to activate the first interface, deactivate the first interface and initiate a time-out during which the terminal can activate a third interface for communication via an optical link, and then activate the second interface.
US10887931B2
The present disclosure relates to communication methods and communications apparatus. One example method includes receiving a first message that is sent by a terminal through an access network device and that includes a first identifier, where the first identifier is used to indicate a message type of the first message, and the message type corresponds to a control plane entity type, and determining the control plane entity type to receive the first message based on the first identifier.
US10887919B2
The present disclosure relates to converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT), and may be applied to intelligent services, such as smart home, smart building, smart city, smart car, connected car, health care, digital education, smart retail, security and safety services. A method according to disclosed aspects includes receiving a first control message including a first random access response window for a first cell group, receiving a second control message for adding a second cell group, including information on a second random access response window size for the second cell group, transmitting, on a cell of the second cell group, a random access preamble, and monitoring, on the cell of the second cell group, a random access response based on the second random access response window size for the second cell group.
US10887915B2
A method for transmitting the downlink in a WLAN that includes the steps of: an access point (AP) transmitting, to a plurality of stations (STA), each of a plurality of request to send (RTS) frames through each of a plurality of channels; and the AP receiving a clear to send (CTS) frame from at least one of the plurality of STAs through at least one channel from the plurality of channels, wherein each of the plurality of RTS frames may include channel information for indicating a channel to be used from among the plurality of channels when transmitting the downlink to each of the STAs, and identifier information for indicating the plurality of STAs.
US10887914B2
An electronic device, information processing apparatus, and information processing method. The electronic device at a base station side includes a processor circuit. The processor circuit is configured to acquire information related to a success rate of uplink transmission in an unlicensed frequency band of at least one user equipment unit, wherein the user equipment unit employs a channel detection process to perform carrier sensing on the unlicensed frequency band, and the channel detection process includes a random back-off process having a variable contention window size. The processor circuit is further configured to adjust, based on the information, the contention window size of the user equipment unit. The processor circuit is further configured to perform control, such that the user equipment unit is notified of the adjusted contention window size or a value of a random back-off counter generated on the basis of the adjusted contention window size.
US10887912B2
Discloses are a method for a terminal for transmitting an uplink signal to a base station and an apparatus supporting the method in a licensed assisted access (LAA) system in which a base station or a terminal transmits listen-before-talk (LBT)-based signals. Specifically, disclosed are a method for a terminal transmitting an uplink signal by executing a particular LBT action and an apparatus supporting the method if the uplink signal is transmitted by the terminal by sharing a maximum channel occupancy time (MCOT) with a base station.
US10887909B2
The present invention discloses a method for a user equipment to receive system information in a wireless communication system. Particularly, the method is characterized in detecting a first synchronization signal block configured with a Primary Synchronization Signal (PSS), a Secondary Synchronization Signal (SSS) and a Physical Broadcasting Channel (PBCH) at a specific frequency position, determining a presence or non-presence of system information corresponding to the first synchronization signal block within a first synchronization raster corresponding to a specific frequency position based on a system information indicator included in the PBCH, and if the system information corresponding to the first synchronization signal block is determined as not existing, determining a second synchronization raster having system information exist therein based on the system information indicator.
US10887904B2
Methods, systems, and devices for wireless communications are described. A base station may implement cross-carrier scheduling. A user equipment (UE) may identify a minimum scheduling delay and may receive a downlink grant on a first CC. The UE may further identify the slot in which a downlink data transmission corresponding to the downlink grant will be received, and may identify the slot such that the minimum scheduling delay is satisfied. The UE may the receive the downlink data transmission, as indicated in the downlink grant, in the identified slot. In some examples, the UE and the base station may alternate between a long minimum scheduling delay and a short minimum scheduling delay. In some examples, the UE and the base station may alternate between a cross-carrier mode, and a self-scheduling mode.
US10887903B2
A wireless device may receive at least one message comprising: first configuration parameters of a first bandwidth part, and second configuration parameters of a second bandwidth part. The second configuration parameters may comprise a scheduling request configuration indicating scheduling request resources for a logical channel. A scheduling request may be triggered in response to data becoming available for the logical channel. A random access process may be started in response to a valid scheduling request resource for the logical channel not being available on the first bandwidth part. A downlink control information may be received. The downlink control information may indicate switching from the first bandwidth part to the second bandwidth part. In response to the scheduling request resources being available on the second bandwidth part: the random access process may be cancelled, and a scheduling request signal may be transmitted via the scheduling request resources.
US10887902B2
There is disclosed a method for operating a wireless device in a wireless communication network. The method comprises configuring, by the wireless device, a reporting time window for transmitting a report to the wireless communication network and determining, by the wireless device, whether data transmission from the wireless device to the wireless communication network is scheduled for a transmission time within the reporting time window, as well as transmitting the report together with the scheduled data transmission if it is determined that such is scheduled for a transmission time within the reporting time window. There are also disclosed corresponding methods and devices.
US10887897B2
Methods, systems, and devices for wireless communications are described. In one example, a method includes receiving broadcast information from a base station that identifies types of resources for vehicle-based sidelink communications that are supported by the base station and transmitting a request to the base station for resource scheduling information to perform a vehicle-based sidelink communication based on the broadcast information. In some cases, the request includes an indication of a type of resources for the vehicle-based sidelink communication supported by the base station and a quality of service (QoS) metric associated with the vehicle-based sidelink communication. In some cases, the method further includes receiving, in response to the request, a response from the base station that comprises the resource scheduling information to perform the vehicle-based sidelink communication.
US10887896B2
A base station (BS) operated in an unlicensed band configures a first energy detection threshold for a discovery signal and a second energy detection threshold for data, and performs energy detection. The BS transmits the discovery signal to a user equipment in the unlicensed band if a detected energy based on the energy detection is less than the first energy detection threshold. Further, the BS transmits the data to the user equipment in the unlicensed band if the detected energy based on the energy detection is less than the second energy detection threshold. The first energy detection threshold for the discovery signal is higher than the second energy detection threshold for the data.
US10887895B2
According to one embodiment, a wireless communication device includes a transmitter configured to transmit a first field containing information to identify a plurality of wireless communication terminals, and configured to multiplex and transmit a plurality of second fields in each of which a first frame containing an address of any of the wireless communication terminals is set; and a controller configured to determine, for the first frames, values pertaining to lengths of durations to suppress access to a wireless medium to the wireless communication terminal having an address different from the address contained in each of the first frames. The transmitter is configured to set the values in the first frames, the second fields, or the first field. The controller is configured to determine the values so that the durations have an end at an identical time.
US10887881B2
According to one embodiment, a wireless communication device includes a transmission circuit and a processing circuit. The transmission circuit is configured to transmit a physical frame including a physical header and a physical payload. The physical header is transmitted in a frequency band. The physical payload includes data and is transmitted by using resource units which are parts of the frequency band. The processing circuit is configured to set a single destination for the data transmitted by a plurality of the resource units and set at least part of the data transmitted by the plurality of the resource units to same data content.
US10887879B2
Methods and devices are described for encoding and decoding control information that has been modulated based on one or more identifiers of the transmitter and/or receiver. Some embodiments describe scrambling sequence design for multi-mode block discrimination on downlink control information (DCI) blind detection. Separate scrambling masks may be applied to disparate bit fields within a coded DCI message, wherein each of the scrambling masks is derived from a unique identifier associated with either the transmitter or the intended receiver. The scrambling masks may be used by the receiver to perform early termination of the decoding process, to mitigate intercell interference, and to verify that the receiver is the intended receiver.
US10887877B2
Embodiments of the present invention provide a method and an apparatus for transmitting a downlink control channel. The downlink control channel includes a first downlink control channel and a second downlink control channel. The first downlink control channel includes a first RS and first DCI. A method for receiving a downlink control channel by user equipment includes: obtaining a first RS time-frequency resource corresponding to the first RS; determining a first DCI time-frequency resource corresponding to the first DCI based on the first RS time-frequency resource; detecting the first RS on the first RS time-frequency resource, and demodulating the first DCI on the first DCI time-frequency resource by using the first RS; and determining a second time-frequency resource corresponding to the second downlink control channel based on the first DCI.
US10887872B2
This specification provides a long PUCCH using multiple slots in a wireless communication system. The method is performed by a user equipment and includes receiving first information about a TDD UL-DL slot configuration from a base station, receiving, from the base station, second information including a first parameter for a number of slots used for a transmission of the long PUCCH and a second parameter for a duration of a PUCCH symbol within a PUCCH slot, determining the multiple slots for transmitting the long PUCCH based on the first information and the second information, and transmitting the long PUCCH to the base station over the determined slots.
US10887864B2
A communication method and system for converging a 5th-generation (5G) communication system for supporting higher data rates beyond a 4th-generation (4G) system with a technology for Internet of things (IoT) are provided. The t disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology, such as smart home, smart building, smart city, smart car, connected car, health care, digital education, smart retail, security and safety services. The disclosure provides a method and an apparatus for determining paging occasions (PO).
US10887860B1
Provided are a wireless communications node (WCN) and a method therefor achieving optimized estimation of coordinate location of the WCN relative to wireless communications with a plurality of reference points (RPs). To do so, the WCN coordinates clustering of such RPs, and determines an estimated coordinate location of the WCN based on one or more RPs of selected ones of clusters each having a centroid thereof that is measured as being most proximate the WCN when compared with unselected clusters.
US10887858B2
A device performs registering with a first access network to generate a first registration, detecting a triggering event, and registering with a second access network to generate a second registration while maintaining the first registration with the first access network.
US10887856B2
Synchronizing devices in a network. In one example, a first communication interface of a first communication device transmits a first message through a first communication path in a mesh network. The first communication path includes the first device, a second device, and a remote server. The first message includes a status of the first device. The first communication interface is switched to a sleep mode after transmission of the first message. Subsequently, the communication interface switches from the sleep mode to an awake mode. While the first communication interface is in the awake mode, the first communication interface transmits a second message through a second communication path in the mesh network. The second communication path includes the first device, a third device, and the remote server.
US10887849B2
Provided are a method and a device for reporting a power headroom in a wireless communication system. The device receives initial downlink control information (DCI) for physical uplink shard channel (PUSCH) transmission in a first subframe and receives triggering DCI in a second subframe. The device calculates a power headroom on the assumption that the PUSCH transmission is not performed.
US10887845B2
In an operating method of a radio frequency integrated circuit (RFIC) including a transmission circuit and a reception circuit, the operating method includes receiving, from a modem, first information for setting transmission power of the transmission circuit or second information about a blocker which is a frequency signal unused by the RFIC, obtaining an allowable value of phase noise of a local oscillator included in the transmission circuit, using the first information, obtaining an allowable value of phase noise of a local oscillator included in the reception circuit, using the second information, determining a level of a driving voltage, using the obtained allowable values of the phase noises, and providing the driving voltage to the local oscillators.
US10887843B2
Configuration information can be received in a first serving cell. A determination can be made as to whether the configuration information includes a cell ID. A pathloss estimate for an uplink transmission transmit power setting can be determined based on a pathloss reference signal associated with a second serving cell if the configuration information includes the cell ID. The uplink transmission can be transmitted on the first serving cell based on the determined pathloss estimate.
US10887832B2
A method for decoding PLMN information comprises receiving a message comprising PLMN information for a plurality of cells and determining PLMN information from the message for a first group of cells that comprises at least one cell, each cell of the first group of cells associated with a first core network type. The method further comprises determining PLMN information from the message for a second group of cells that comprises at least one cell, each cell of the second group of cells associated with a second core network type. At least one cell is a part of the first group of cells and the second group of cells. The PLMN information for the at least one cell in the first group of cells and the second group of cells is provided only once.
US10887822B2
Techniques for assigning APs to wireless network controllers are described. One or more RF constellations for a plurality of APs in a wireless network are generated. The RF constellations are organized based on estimated RF distances among the plurality of APs. The plurality of APs are clustered into a plurality of groups of one or more APs, based on the RF constellations and the estimated RF distances. Each group, of the plurality of groups, is assigned to a wireless network controller.
US10887818B1
A system includes a software-defined wide area network having a software-defined wide area network control plane and a software-defined wide area network user plane; wherein the wide area network control plane is configured to operate in a first network and the wide area network user plane is configured to operate in a second network and further configured to communicate with the wide area network control plane, a serving gateway user plane in communication with the software-defined wide area network user plane, wherein the serving gateway user plane is configured to operate in the second network and further configured to communicate wirelessly with a device, and wherein the wide area network user plane is configured to route a communication between the device and a destination.
US10887812B2
Methods and apparatuses are provided in a wireless communication system supporting dual connectivity of a first base station and a second base station. A predetermined number of consecutive out-of-syncs for a special cell are received. A timer for the special cell is started. A radio link failure (RLF) is detected upon an expiration of the timer. A failure message including failure type is transmitted to the first base station in case that the RLF for the special cell is associated with the second base station.
US10887799B2
In one illustrative example, a user plane (UP) entity for use in a mobile network may receive a data packet from a user equipment (UE) operative to communicate in one or more sessions via a serving base station (BS) (e.g. eNB or gNB) of the mobile network. The UP entity may detect, in a header (e.g. SRH) of the data packet, an identifier indicating a new serving BS or session of the UE. The identifier may be UE- or BS-added data (e.g. iOAM data) that is inserted in the header by the UE or BS. In response, the UP entity may cause a message to be sent to an analytics function (e.g. a NWDAF) to perform analytics for session or flow migration for the UE.
US10887795B2
Systems and methods for OTA Wi-Fi offloading are provided. According to one embodiment, a first AP of a private network provides connectivity between one or more wireless client devices and a wired network portion of the private network. The first AP is coupled to a switch via a first wired link. The first AP determines whether the traffic being transmitted on the first wired link exceeds a configurable or predefined threshold. When the determination is affirmative, the first AP offloads a portion of the traffic to a second AP of the private network by: (i) dynamically establishing a mesh like link with the second AP; and causing the traffic to be delivered to the wired portion of the private network via a second wired link, coupling the second AP to the switch, by transmitting the portion of the traffic via the mesh like link to the second AP.
US10887784B2
Facilitation of multiple input multiple output communication for 5G or other next generation network
Doppler metric data relating to a speed of a mobile device can be used by the mobile device to determine whether a speed threshold has been satisfied. If the speed threshold has been satisfied, then the mobile device can make a recommendation to a network node device to terminate closed-loop multiple input multiple output transmissions and to use a rank-1 precoder transmission. The network device can then decide how to proceed. Alternatively, the network device can change the transmission type based on a load threshold being determined to have been satisfied and the recommendation from the mobile device.
US10887781B2
In one embodiment, a network assurance service that monitors a wireless network identifies a set of wireless network anomalies detected in the wireless network that are associated with a set of one or more network measurements. The network assurance service classifies the set of wireless anomalies as radio-related or backend-related. The network assurance service, when the set of wireless anomalies are classified as radio-related, determines that the wireless anomalies are recurring for a particular wireless access point in the network. The network assurance service initiates a change to the wireless network in part to move clients in the wireless network from the particular wireless access point to another wireless access point in the network.
US10887778B2
In one example, the present disclosure describes a device, computer-readable medium, and method for proactively adjusting the infrastructure of a communications network in response to reporting of real-time network performance. For instance, in one example, a method includes obtaining real-time network performance metrics directly from a user endpoint device operated by a customer of a telecommunication service provider network, correlating the real-time network performance metrics with data from another data source, wherein the data includes data other than network performance metrics, and adjusting an infrastructure of the telecommunication service provider network in response to an insight gleaned through the correlating.
US10887777B2
A method and device for data transmission in a wireless communication network are disclosed. The method includes that: a data regularity of data in a transmitted data packet is acquired; a subsequent sending manner and corresponding receiving manner for the data having the data regularity are determined; and the data having the data regularity is sent according to the determined sending manner.
US10887773B2
A dark fiber design tool for hardware, circuits, and paths is provided. A method can include generating, by a device comprising a processor, a data record comprising properties of a group of hardware elements associated with a wireless communication network; establishing, by the device, a set of rules that define permissible interactions between respective hardware elements of the group of hardware elements based on the data record; building, by the device, a circuit plan associated with the wireless communication network, the circuit plan comprising optical connections between the respective hardware elements of the group of hardware elements as determined based on the data record and the set of rules; and associating, by the device, respective optical wavelength paths with respective ones of the optical connections of the circuit plan further based on the set of rules.
US10887772B2
Embodiments of the present invention disclose a signal transmission method and apparatus. The apparatus includes an LTE-U processing unit, a Wi-Fi processing unit, an antenna unit, and a coupling apparatus. After receiving an LTE-U signal sent by the LTE-U processing unit, the coupling apparatus divides the LTE-U signal into a first LTE-U signal to be sent to the antenna unit and a second LTE-U signal to be sent to the Wi-Fi processing unit, so that the Wi-Fi processing unit does not send a Wi-Fi signal; and after receiving a Wi-Fi signal sent by the Wi-Fi processing unit, the coupling apparatus divides the Wi-Fi signal into a first Wi-Fi signal to be sent to the antenna unit and a second Wi-Fi signal to be sent to the LTE-U processing unit, so that the LTE-U processing unit does not send an LTE-U signal.
US10887756B2
A method of group establishment for multi-login authentication user implemented by a switching device, the method comprises steps of receiving, by the switching device, group configuration information, carried by a first network signal, of at least one communication device including an eSIM card, wherein the group configuration information includes eSIM card information; and establishing, by the switching device, a communication group list which allows the communication devices on the list to interacts each other via the switching device for data sharing.
US10887751B1
A network repository function (NRF) device may receive first locality and priority information concerning a first network function device from the first network function device and may receive second locality and priority information concerning a second network function device from the second network function device. The NRF device may update a data structure based on the first locality and priority information and the second locality and priority information. The NRF device may receive a query concerning a locality from a third network function device and may search the data structure based on the query to identify network function device information associated with the locality. The NRF device may send the network function device information to the third network function device.
US10887736B2
The present invention provides a method for a vehicle-to-X (V2X) operation performed by means of a V2X UE in a wireless communication system, the method characterized by: determining whether or not another communication is being performed on V2X resources on which V2X communication is being performed; and performing the V2X communication on the basis of the determination, wherein a terminal drops the transmission for the V2X communication during the determining of whether or not another communication is being performed on the V2X resources on which the V2X communication is being performed.
US10887735B2
A method according to one embodiment includes receiving, by a control system secured to the insulated portable container, sensor data from a temperature sensor positioned within the insulated portable container, determining, by the control system, whether the sensor data is associated with a notification range, establishing, by the control system, a long-range wireless communication connection with a server in response to a determination that the sensor data is associated with the notification range, and transmitting, by the control system, a message to the server indicating that the sensor data is associated with the notification range in response to establishing the long-range wireless communication connection.
US10887728B2
A method for determining the mobility status of a user of a wireless communication network includes retrieving, from the wireless communication network, an indication about interactions between a user equipment associated with that user and the wireless communication network, and, for each interaction, determining a served area of the wireless communication network pertaining to that user equipment at the occurrence of that interaction, and determining the mobility status of that user at the occurrence of that interaction according to a comparison between a distance between the served area and a first further served area of the wireless communication network pertaining to that user equipment, and a first threshold distance; or a comparison between a distance between the served area and a second further served area of the wireless communication network pertaining to that user equipment, and a second threshold distance.
US10887719B2
In respect of spatial audio configured to be associated with a moveable, particular object in a scene, the spatial audio for presentation such as to be perceived as originating from a particular direction, the location of the object determined based on automatic identification in sensor data to enable positioning of the spatial audio to correspond to the location of the object, the sensor data from a sensor having a limited field of view of the real-world scene at any one time; based on a current location of the object being unknown; provide for audible presentation of the spatial audio with a previously-determined-direction and, based on a current field of view of the user moving to the previously-determined-direction, provide for modification of the spatial audio from the previously-determined-direction to a direction outside the current field of view of the user at least until the object is once again identified.
US10887714B2
A manufacturing method for a microphone is provided. The microphone includes a case that is vibrated by a vibration signal. A sound inlet through which a sound signal is input is formed at a portion of the case and a first sound element is formed in the case at a position corresponding to the sound inlet. The first sound element receives the sound signal and the vibration signal to output a first initial signal. A second sound element is formed to be adjacent to the first sound element and receives the vibration signal to output a second initial signal. A semiconductor chip is connected to the first sound element and the second sound element and receives the first initial signal and the second initial signal to output a final signal.
US10887707B2
A hearing aid device includes: a hearing aid housing surrounding an inner space; a frame structure arranged in the inner space, the frame structure configured for mounting at least a microphone and a signal processing unit; a sound emitter sized for being arranged in an ear canal; a conductor, wherein the sound emitter is arranged on a first end of the conductor; a connector socket arranged in the frame structure, wherein the hearing aid housing comprises a passage located in front of the connector socket; a connector plug arranged on a second end of the conductor, the connector plug configured for insertion through the passage for connection to the connector socket; a recess at an outer surface of the connector plug; and a locking plug having a first part configured to extend through a housing opening at the hearing aid housing, and engage with the recess.
US10887705B2
A method for controlling a controllable acoustic valve of a hearing device. The valve includes a moveable valve element adapted to be positioned in one of at least two essentially stable states. The moveable valve element is configured to be maintained in each of the essentially stable states by a retention force. A neutral point with essentially cancelling retention forces exists between the least two essentially stable states. The method includes providing a first drive signal to the controllable acoustic valve to overcome a retention force of a first essentially stable state in order to initiate movement of the moveable valve element from the first essentially stable state to a second essentially stable state. The provided first drive signal is capable of bringing the moveable valve element from the first essentially stable state and beyond a neutral point between the first and second essentially stable states.
US10887704B2
The invention discloses a method for noise reduction in a binaural hearing aid, said binaural hearing aid comprising a first local unit and a second local unit, wherein the method comprises the following steps: generating a first main signal and a first auxiliary signal in the first local unit from an environment sound, and a second main signal in the second local unit from the environment sound, estimating a direction of arrival of a useful sound signal in the environment sound, assigning a first frequency range and a second frequency range, generating a first range beamformer signal in the first frequency range from the first main signal, the first auxiliary signal and the second main signal by imposing at least one spatial condition related to the estimated direction of arrival on the directional characteristic of the first range beamformer signal, generating a second range beamformer signal in the second frequency range from the first main signal and the second main signal by imposing at least one spatial condition related to the estimated direction of arrival on the directional characteristic of the second range beamformer signal, and generating a first local output signal from the first range beamformer signal and the second range beamformer signal, wherein the first local output signal is transduced into a first output sound by a first output transducer of the first local unit.
US10887695B2
A method includes receiving sound by a first audio unit installed in an electrical outlet, routing audio data corresponding to the received sound from the first audio unit to a second audio unit installed in a second electrical outlet, and sending the audio data to a mobile device using a wireless link between the mobile device and the second audio unit. Routing the audio data may include receiving the audio data from the first audio unit by a third audio unit and routing the audio data to the second audio unit by the third audio unit serving as a router. The data may be routed using table driven routing, on-demand routing or some other appropriate routing protocol. The method may also include performing voice recognition on the audio data and detecting a command word and routing command word data to the second audio unit.
US10887692B1
A microphone array device including microphone capsules and at least one processing unit configured to receive output signals of the microphone capsules, dynamically steer an audio beam based on the received output signal of the microphone capsules, and generate and provide an audio output signal based on the received output signal of the microphone capsules. The processing unit is configured to operate in a dynamic beam mode where at least one focused audio beam is formed that points towards a detected audio source and in a default beam mode where a broader audio beam is formed that covers substantially a default detection area. The microphone array may be incorporated into a conference system.
US10887690B2
A sound processing method and an interactive device are provided. The method includes determining a sound source position of a sound object relative to an interactive device based on a real-time image of the sound object; and performing a sound enhancement on sound data of the sound object based on the sound source position. The above solution solves an existing problem that noises cannot be effectively cancelled in a noisy environment is solved, thus achieving the technical effects of effectively suppressing the noises and improving the accuracy of voice recognition.
US10887686B2
A directional microphone including a casing and a microphone element is provided. The casing has a front sound reception hole and at least one rear sound reception hole. The microphone element is disposed in the casing. The microphone element has a front sound reception surface and a rear sound reception surface. The front sound reception hole is located on a same side as the front sound reception surface, and the front sound reception hole is aligned with the front sound reception surface. The rear sound reception hole is located on a same side as the rear sound reception surface, but the rear sound reception hole and the rear sound reception surface are misaligned with each other.
US10887679B2
An earpiece is configured for providing audiometric testing. The earpiece includes an earpiece housing, an intelligent control system disposed within the earpiece housing, at least one transducer operatively connected to the intelligent control, and at least one speaker operatively connected to the intelligent control. The earpiece is configured to perform audiometric testing of a user by reproducing sounds at the at least one transducer and receiving user feedback regarding the sounds to provide audiometric test data.
US10887672B1
Method and apparatus for detecting a pattern used by an encoder when outputting segments for HTTP streaming. A pattern detector receives, as part of a HTTP streaming protocol, a sequence of video segments and a sequence of audio segments forming at least a portion of a media presentation. The pattern detector identifies a duration of the video segments and then sums the durations of the sequence of audio segments until the summed duration is an integer multiple of the duration of the video segments. The pattern detector determines the number of the audio segments used to form the summed duration which includes the number of audio segments forming a cycle of the pattern. This pattern is then added to a manifest of the media presentation along with a repeat indicator defining the number of times the pattern is repeated.
US10887667B2
A method for flagging advertisement frames for automatic content recognition is provided. The method includes receiving broadcast fingerprints indicative of broadcast frames of a media stream comprising a series of broadcast scenes. The method also includes receiving advertisement fingerprints indicative of ad frames of ad scenes. The method further includes determining a scene change between a first broadcast scene and a second broadcast scene. The scene change is based on a Pearson correlation coefficient between an initial broadcast fingerprint of an initial broadcast frame of the second broadcast scene and a last broadcast fingerprint of a last broadcast frame of the first broadcast scene. The method also further includes determining whether the second broadcast scene is one of the ad scenes. When the second broadcast scene is one of the ad scenes, the method associates an identification of the second broadcast scene as the one of the ad scenes.
US10887661B2
A system and method of conserving network bandwidth by controlling access to resources. A filtering service determines if a resource should be blocked or allowed to pass between computers on the network based on information about the resource including the path and any query parameters in the URI along with any available metadata about the resource. The metadata may be retrieved from the remote hose, generated based on the content of the resource, or any combination thereof. One or more filtering algorithms may be engaged to compare the information about the resource to filtering rules to determine whether access to the resource is allowed. The information about the resource, and the result of the filtering algorithm may be stored to reduce the time required to make future determinations for the same resource, or for similar resources.
US10887658B2
A system and method for the simultaneous creation, assembly and transmission of synchronous multiple personalized messages to specific targeted individuals or other entities. The system can send rich media distinctly personalized messages such as commercials to a small or large group of selected individuals through any appropriate distribution media. A personalized message is created based on segmenting a message into multiple slots, and providing different selectable segments for each slot. The multiple segments are then simultaneously broadcasted over multiple data streams to a receiver, wherein the receiver switches between the data streams to assemble the personalized message in a just-in-time fashion. Other data including overlays, animation, frame transitions etc. may also be transmitted and used to assemble the personalized message.
US10887649B2
A reception apparatus including a decoding apparatus and a demultiplexing apparatus for identifying a packet with clock information. The decoding apparatus receives a transfer frame, which includes one or more first transfer units obtained by multiplexing contents. A decoder in the decoding apparatus acquires the first transfer units by decoding the transfer frame, and outputs the first transfer units to the demultiplexing apparatus. The demultiplexing apparatus acquires content by demultiplexing the first transfer units. Additionally, a heading first transfer unit, which is positioned at a head within the transfer frame, contains reference clock information. The decoder generates information for identifying the heading first transfer unit and outputs the information to the demultiplexing apparatus.
US10887644B2
The present technology relates to a reception device, data processing method, and a program which make it possible to smoothly switch the output of data in a case where data transmitted via different transmission paths is received to be output. A reception device includes: a reception unit that receives a plurality of pieces of data separately transmitted via different transmission paths and given time stamps corresponding to each other; an output control unit that selects data to be output from among the plurality of pieces of data and controls a timing of outputting the selected data on the basis of the time stamp of a piece of data having a latest time stamp among the plurality of pieces of data; and an accumulation unit that accumulates at least the plurality of pieces of data given the time stamps later than the time stamp of the data that has been output from among the received plurality of pieces of data. The present technology can be applied to, for example, a reception device of a broadcasting system using MMT.
