US11988563B2
Methods, systems, and devices for temperature exception tracking in a temperature log for a memory system are described. The memory system may store the temperature log separate from data to which the temperature information corresponds. For example, a memory device may store data in a relatively higher-level cell and the corresponding temperature information in a relatively lower-level cell. To perform a write operation, the memory system may determine a current temperature at which the data is being written or was written to a partition of a memory device and may indicate in the temperature log if the current temperature is entering a temperature range that is outside a threshold temperature (e.g., a nominal temperature). To perform a read operation, the memory system may determine if the data to read was written to the memory device outside the threshold temperature to determine whether to perform temperature compensation for the read operation.
US11988561B2
A method for producing a thermal infrared sensor array in a vacuum-filled wafer-level housing with particularly small dimensions, consisting of at least two wafers, a cover wafer and a central wafer comprising multiple infrared-sensitive sensor pixels on a respective thin slotted membrane over a heat-insulating cavity is disclosed. A method for producing a high-resolution monolithic silicon micromechanical thermopile array sensor using wafer level packaging technology, wherein the sensor achieves a particularly high spatial resolution capability and a very high filling degree with very small housing dimensions, in particular a very low overall thickness, and can be inexpensively produced using standard CMOS processes. This is achieved in that the cover wafer is first rigidly mechanically connected to the provided central wafer comprising the sensor pixels with the infrared-sensitive pixels by means of wafer bonding, and the central wafer is then thinned out from the wafer rear face to a specified thickness.
US11988559B2
A color calibrator includes a first casing, a second casing and an optical sensor. The first casing has an accommodating recess and a plurality of first positioning members, wherein the first positioning members are arranged along an axial direction of the accommodating recess. The second casing is telescopically disposed in the accommodating recess. The second casing has a second positioning member. One of the first positioning member and the second positioning member is a magnet. Another one of the first positioning member and the second positioning member is a magnet or a magnetic induction material. The second positioning member cooperates with one of the first positioning members to position the second casing at one of a plurality of telescopic positions with respect to the first casing. The optical sensor is disposed on the second casing.
US11988541B2
A method for radar-based measurement of a filling level of a filling material in a container includes, in successive measurement cycles, generating an evaluation curve, and the relevant current evaluation curve is stored; a first difference curve is formed based on the evaluation curve of the current measurement cycle and a stored evaluation curve of a preceding measurement cycle; and the filling level is determined based on a maximum in the current first difference curve. The filling level is thus established from the difference curve rather than from the evaluation curve, and the filling level can be determined with greater certainty—in particular in the case of filling material having rippled surfaces.
US11988540B2
An apparatus includes a probe configured to provide at least a portion of capacitance of an inductance-capacitance (LC) circuit of a detection circuit, the capacitance of the LC circuit being dependent on a distance between the probe and a surface of a liquid in a biochemical analysis system. The apparatus includes a movement mechanism configured to move the probe. The apparatus includes circuitry configured to perform operations that include causing the movement mechanism to move the probe with respect to the liquid; measuring one or more characteristics of an output signal of the detection circuit, the one or more characteristics being dependent on the capacitance of the LC circuit; and detecting, based on the one or more characteristics of the output signal, a contact between the probe and the surface of the liquid.
US11988531B2
A system includes an optical waveguide, provided as a component of a first part, and at least one sensor system, provided as a component of a second part. The second part is movable relative to the first part, and the optical waveguide radiates light laterally on the side. The sensor system detects the light intensity of the laterally emitted light emitted by the optical waveguide. A grating is provided between the sensor system and the optical waveguide.
US11988527B2
The present invention is used to compose the structure of a system that operates inside pipelines. It can be used in a robotic system in the form of a train to move tools inside small diameter tubes or ducts. It avoids the need for costly commercial connectors with limited variety of connections. The proposed solution is to partition/separate the electronic or hydraulic components into pressure vessel modules, thereby making it necessary to provide an adequate means of interconnection between said modules by means of an elastomeric conduit. Each module has a heat exchanger system (sink) to remove the heat generated by the electronic equipment installed inside thereof. The product of the invention has a sufficient degree of freedom to move in ducts and underwater pipes, where the hydrostatic pressure is extremely high.
US11988526B2
Provided is a method, performed by a first vehicle, of providing detailed map data, the method including collecting first traveling data about a first path using at least one first sensor while the first vehicle is traveling the first path; obtaining first detailed map data corresponding to the first path based on the first traveling data about the first path; and providing the first detailed map data to at least one external device.
US11988517B2
A vehicle includes one or more transceivers configured to communicate with a server; and a controller programmed to responsive to detecting an extra load to the vehicle, obtain a first candidate energy consumption rate corresponding to the extra load from the server, calculate an estimated energy consumption rate using the first candidate energy consumption rate, and calculate a distance to empty using the estimated energy consumption rate.
US11988479B1
Disclosed herein are bolt carrier movement mechanisms that offer a higher ratio of bolt carrier applied force to user applied bolt action operating force. Such bolt carrier movement mechanism may comprise a bolt carrier, an impingement body, a primary extraction leverage member, and an action control structure coupler. The impingement body has at least one impingement surface. The primary extraction leverage member has a coupler mounting portion, an impingement member portion, and a bolt carrier mounting portion. The primary extraction leverage member is engaged at the bolt carrier mounting portion of the bolt carrier. The impingement member portion of the primary extraction leverage member is adjacent to the at least one impingement surface of the impingement body and includes at least one impingement member. The action control structure coupler is pivotably engaged with the coupler mounting portion of the primary extraction leverage member.
US11988478B1
A gun stand includes a support post, a tray assembly and a ground stake. A first telescoping connection connects the tray assembly to a first end of the support post. A second telescoping connection connects the ground stake to a second end of the support post. The two telescoping connections are independently adjustable.
US11988476B2
A expansion chamber assembly for a firearm is disclosed. The expansion chamber contains an outer tube containing a front end and a rear end, a front cap coupled with the outer tube at the front end, a rear cap coupled with the outer tube at the rear end, an inner tube retained within the outer tube by the front cap and the rear cap, wherein the inner cap contains one or more through apertures to allow expanding gasses to move from the inner tube into the outer tube, and one or more exit apertures to allow expensing gases to exit the expansion chamber assembly.
US11988473B1
A weapon has a barrel, a body connected to the barrel, a cylindrical part affixed to an internal cavity of the body, a magazine cooperative with the cylindrical part so as to dispense a projectile adjacent a front chamber of the cylindrical part, a receiver positioned in the front chamber of the cylindrical part, an actuator cooperative with the receiver, and a trigger cooperative at the front chamber of the cylindrical part so as to ignite oxyhydrogen gas in the front chamber in order to file the projectile through the barrel. The magazine has an oxyhydrogen tank in an interior thereof. The oxyhydrogen tank being in communication with the front chamber and the rear chamber of the cylindrical part. The receiver is adapted to receive a bullet therein. There actuator is adapted to move the receiver in order to chamber the projectile.
US11988471B2
Devices and methods for fabrication of a multiscale porous high-temperature heat exchanger for high-temperature and high-pressure applications are disclosed. The heat exchanger can include a core with macrochannels formed in a checkerboard pattern to facilitate alternative flow of working fluid having hot and cold temperatures between adjacent macrochannels. Each macrochannel can include a two-dimensional microchannel array that further distributes flow throughout the heat exchanger to enhance heat transfer and mechanical strength without significant pressure drop penalty. The heat exchanger can further include a header integrated therewith to distribute working fluid flowing through the heat exchanger through the outlets such that it flows evenly therethrough. Methods of fabricating heat exchangers of this nature are also disclosed.
US11988456B2
This exchanger (100) includes: substantially parallel and vertical membranes (30), permeable to vapor and impermeable to a liquid, these membranes delimiting zones, each of said zones belonging alternately to a first type of zone and to a second type of zone; the zones of said first type including in the upper portion a spray nozzle (20) configured to vaporize a liquid along a plane (R) substantially parallel to the membranes, and in the lower portion a first collector (50), independent and separated from the zones of the second type, a first pipe (10) supplying the spray nozzles (20) of the zones (Z20) of said first type with a liquid.
US11988433B2
A container energy storage system is provided in this disclosure. The system includes a container and a plurality of functional assemblies. The container includes a container frame and a bottom plate. The container frame is formed with a plurality of openings and a hollow main body. The bottom plate is disposed at a bottom of the container frame and is fixedly connected to the container frame. The functional assemblies are disposed in the hollow main body and located above the bottom plate.
US11988428B2
A transport refrigeration system includes a compressor, a heat rejection heat exchanger, a flash tank, an expansion device and a heat absorption heat exchanger arranged in a serial refrigerant flow order to circulate a refrigerant; a controller configured to: determine a presence of at least one condition of the transport refrigeration system; and initiate a low refrigerant charge detection process in response to detecting the presence of the at least one condition of the transport refrigeration system.
US11988424B2
A device is provided that may include a compressor configured to compress a refrigerant, a condenser configured to condense the compressed refrigerant, an expander configured to expand the refrigerant condensed by the condenser, an evaporator configured to evaporate the refrigerant expanded by the expander, a separation mechanism connected to an outlet pipe of the evaporator to separate liquid refrigerant and gaseous refrigerant discharged from the evaporator, a bypass pipe to guide the gaseous refrigerant separated from the liquid refrigerant to the compressor, a first pipe connected to the separation mechanism and through which the liquid refrigerant discharged from the separation mechanism flows, an accumulator connected to the first pipe to separate the gaseous refrigerant, which is not separated from the liquid refrigerant by the separation mechanism, from the liquid refrigerant and discharge the separated gaseous refrigerant, and a second pipe configured to guide the gaseous refrigerant discharged from the accumulator to the compressor.
US11988417B2
There are a first coolant circuit that supplies a first coolant in a first tank to a first load, a second coolant circuit that supplies a second coolant in a second tank to a second load, and a refrigeration circuit that adjusts temperatures of the first and second coolants to set temperatures by heat exchange between the first and second coolants and refrigerants by using heat exchangers. The set temperature of the second coolant is equal to the set temperature of the first coolant or higher than the set temperature of the second coolant, and the set flow rate of the first coolant is higher than the set flow rate of the second coolant, and the volume of the first tank is larger than the volume of the second tank.
US11988414B2
System and methods of operating a water heater receiving power from an electrical grid. The water heater includes a heating element, a controller, and a first control circuit. The first control circuit including an energizing terminal and a microprocessor. The method includes connecting an energizing terminal of the first control circuit between a power output terminal of the controller and the heating element, receiving driving power from the controller based on a temperature signal. The method also includes receiving a control signal from the controller based on electrical grid information, and selectively energizing the heating element, by the microprocessor of the first control circuit and through the energizing terminal of the first control circuit based on the control signal.
US11988413B2
A water heater includes a tank, an insulation blanket, and an outer shell. The insulation blanket includes a preformed foam assembled from at least two pieces of foam, which together surround the tank. The outer shell includes a lower part surrounding the at least two pieces of foam. The at least two pieces of foam have notches extending along outer comers thereof to form channels between the pieces of foam and the lower part. The channels extend from above the tank to a drain outlet from the lower part to conduct any leakage out of the water heater.
US11988410B2
An air circulation system for vocal music and band ensembles provides a downdraft through a riser structure to remove aerosols from around performers in the riser structure. The riser structure includes platforms and an air intake disposed within a vertical space between the platforms. The aerosols are drawn through the riser structure, cleaned and filtered and exhausted away from the performers.
US11988408B2
A humidifier has a base and a housing. The housing has a steam exhaust vent and a vaporizer. The vaporizer includes a heating element surrounded by a removable porous sleeve that protrudes downwardly into water within a reservoir of the base. The sleeve wicks the water including its minerals and impurities into contact with the heating element wherein energization of the heating element causes the wicked water to convert to steam that rises through the exhaust vent and from the housing during a humidification mode.
US11988406B2
A return air grille air purifier including an air filtration system including a media filter and a filter enhancement module. The filter enhancement module includes an ionization array configured to charge particles in an airstream passing through the filter enhancement module and towards the media filter. The return air grille air purifier also includes a first housing and a second housing configured to contain the air filtration system. The second housing contained within the first housing in a closed position and the second housing configured to move outward with the air filtration system at least partially out of the first housing in an open position. The media filter being removably accessible from the second housing in the open position.
US11988403B2
An air conditioner includes an outdoor unit having a compressor for compressing a refrigerant and an outdoor heat exchanger. A ventilator is connected to the outdoor unit by a plurality of refrigerant pipes. The ventilator includes a case having a supply passage, through which the outside air flows into the indoor space, a discharge passage through which the indoor air is discharged to the outside, a partition wall disposed in the case and separating the supply passage and the discharge passage, a main heat exchanger disposed in the supply passage, an outside air inlet damper, an indoor air outlet damper, a circulation hole damper, an outdoor temperature sensor, and a controller, configured to control operations of the dampers.
US11988402B2
A control method of an air conditioner includes obtaining a first operating frequency of a compressor of the air conditioner; in response to the first operating frequency being greater than or equal to a preset frequency, obtaining a current temperature of an evaporator of the air conditioner; and in response to the current temperature being less than a preset temperature, controlling the compressor to operate according to a second operating frequency greater than the first operating frequency.
US11988395B2
A thermal energy extraction assembly is disclosed, the thermal energy extraction assembly is configured to extract heat and/or cold from a thermal energy distribution grid. The assembly may include a connection circuit connecting the assembly to the grid; a first heat exchanger configured to exchange heat from a heating circuit to the grid; a second heat exchanger configured to extract heat from the grid to a cooling circuit; and a plurality of heat pumps each having a condenser side connected to the heating circuit and an evaporator side connected to the cooling circuit, the heat pumps being configured to pump heat from the cooling circuit to the heating circuit.
US11988394B2
An operator control panel for a household appliance includes an operator control front, a panel carrier supporting the operator control front and having a recess, and a haptic actuator guided through the recess of the panel carrier for coupling to the operator control front so that during an operator control procedure of the operator control panel the haptic actuator outputs a haptic signal as feedback to a user in response to the operator control procedure via the operator control front.
US11988385B2
A gas turbomachine combustion chamber includes bridges extending side by side to connect in one piece a radially inner wall and a radially outer wall towards a free end of the radially inner wall. The bridges, inner wall, and outer wall have an additive layer structure.
US11988384B2
A device for controlling a combustible gas supply to a heating apparatus burner includes: a valve with a respective valve seat which is associated with a corresponding closure member provided with a respective control rod for opening the valve seat, a system for amplifying movement of the control rod which has a snap-fit spring which acts on the rod and a pushing element which in turn acts on the spring, a first end of a lever acts on the pushing element which is hinged at a fulcrum location which is positioned at an opposing second end of the lever, actuator which moves the lever, operationally associated with the lever in a position between the opposing lever ends to control the lever about the fulcrum location resulting in movement of the closure member away from and towards the valve seat, the actuator comprising a linear actuator element with converse piezoelectric effect.
US11988381B2
Apparatus and methods for debinding articles. The apparatus and methods may transform binder from furnace exhaust before the exhaust is discharged to the atmosphere. The apparatus may include a furnace retort and a reactor. The furnace retort may be configured to: exclude ambient air; and receive a carrier gas. The reactor may be configured to: receive from the retort (a) the carrier gas and (b) material removed in the retort from the article; and combust, at a temperature no greater than 750° C., the material. The material may be decomposed binder. The material may be hydrocarbon from binder that is pyrolyzed in the retort. The carrier gas may include gas that is nonflammable gas.
US11988373B1
A light fixture with self-test ability of sealing includes a light head with a head housing, a light source for emitting light and generating heat, and a temperature sensor and an air pressure sensor for respectively detecting the temperature and air pressure inside the head housing are provided in the head housing. A controller is further included for determining the sealing performance of the head housing based on the detection results of the temperature sensor and the air pressure sensor. The head housing is provided with a waterproof breathable valve allowing the internal space of the head housing in air communication with the external space of the light fixture. A switch is configured which is capable of switching between two states by unblocking/blocking the waterproof breathable valve to make the internal space of the head housing in air communication with the external space of the light fixture or not.
US11988371B1
Disclosed is a starry sky lamp with good heat dissipation effect. The lamp includes a shell, and a laser and a circuit board arranged in the shell, where the laser is electrically connected with the circuit board, and further includes a light-transmitting cover and a heat dissipation fan, where the heat dissipation fan is arranged in the shell, and the heat dissipation fan is electrically connected with the circuit board and blows air towards the laser; and the shell is provided with an opening, the light-transmitting cover is installed at the opening, the light-transmitting cover is a semi-circular hollow structure, and a starry sky effect pattern cutting surface is arranged inside the light-transmitting cover.
US11988370B2
A solid-state lighting fixture assembly having a lighting fixture with a socket configured to receive a plug associated with one or more accessories to allow for easy in-field mounting of accessories, e.g., controls, onto installed lighting fixtures. The socket may be internally electrically connected to an auxiliary power output of a driver and/or to a battery power pack within the lighting fixture assembly, thereby providing direct-current voltage power for the accessory and, also, allowing for signal transmission to and from the accessory. Each accessory includes one or more sensors and communication components to provide the connected lighting fixture assembly with specific capabilities including, but not limited to, motion detection, ambient light level detection, ambient temperature measurement and wireless communications. The wireless communication can also be used to control one or a group of lighting fixtures and transmit sensor data associated with, for example, monitoring space utilization and asset tracking.
US11988365B1
Systems, devices, and methods for a housing extension for lighting. A system embodiment may include: a primary housing, a first adjusting bracket attached to the primary housing, a second adjusting bracket, an adjustment screw inserted into both the first adjusting bracket and the second adjusting bracket, and an electrical component disposed within the primary housing.
US11988360B1
Disclosed herein is a solar light kit and a method of assembling the solar light kit, the kit comprising: a printed circuit board (PCB) housing configured to enclose a first PCB and second PCB, wherein the first PCB comprises an array of light sources and the second PCB comprises a plurality of electrical ports, the first PCB and second PCB are configured to connect and fit in the PCB housing in one orientation; a battery housing configured to enclose at least one rechargeable battery, wherein the battery housing is configured to connect to the PCB housing; a casing configured to enclose the connected PCB housing and battery housing; and a solar panel configured to connect to the second PCB using a connector cable removably connectable to the solar panel and the second PCB.
US11988359B2
The present disclosure relates to the technical field of solar street lamps, in particular to, an integrated solar street lamp. The present disclosure provides an integrated solar street lamp, including an integrated light emitting panel and a transparent cover body; the integrated light emitting panel is hermetically arranged in the transparent cover body; the integrated light emitting panel includes a first conducting plate including two separated plate bodies, a second conducting plate including two separated plate bodies, and a plurality of monocrystal silicon thin slabs coplanar with the first conducting plate; the plurality of monocrystal silicon thin slabs are connected in series through conductors; and two ends of the conductors are electrically connected to the two plate bodies of the first conducting plate respectively.
US11988352B2
A light module for a motor vehicle light is obtained, comprising a light source assembly comprising at least one light source unit, at least one first guide section, and at least one first fasting section, and an optics assembly comprising at least one optical element, at least one second guide section, and at least one second fastening section, wherein the light source assembly and the optics assembly can be moved toward one another along the adjustment axis (J) in a first state, in particular an adjustment state, by the first guide sections, and wherein the light source assembly and the optics assembly can be fixed in place in relation to one another with the first and second fastening sections in a second state, in particular in an adjusted final assembly state.
US11988350B2
Provided is a vehicle lamp including a light source module. The light source module includes a light source configured to generate and emit light and a microlens array module provided in front of the light source and configured such that light enters the microlens array module. The microlens array module includes an incident lens array configured such that the light enters the incident lens array and including a plurality of incident lenses and an exit lens array provided in front of the incident lens array, configured to receive the light that has entered the incident lens array and emit the light outward, and including a plurality of exit lenses. The exit lens array is configured such that heights of the exit lenses are different in a top-bottom direction of a vehicle.
US11988339B2
The present disclosure relates to an apparatus for fixing a pressure vessel, the apparatus including: a frame part disposed to be separable from the subject and configured to support the pressure vessel; and a foothold disposed on the frame part, thereby obtaining an advantageous effect of simplifying a structure and improving a degree of design freedom and spatial utilization.
US11988330B1
Techniques for managing a lubricant fluid include storing a lubricant fluid that includes liquid water in an interior volume of a reservoir, which includes a vapor space above the lubricant fluid that encloses water vapor; circulating, with a blower, a first airflow from the vapor space to an ambient environment to remove at least a portion of the water vapor to the ambient environment; circulating a second airflow to a heater in fluid communication with the vapor space within the interior volume of the reservoir; heating the second airflow with the heater; circulating the heated airflow into the vapor space to reduce a relative humidity of the vapor space; and releasing at least a portion of the liquid water from the interior volume of the reservoir through a control valve coupled to the reservoir.
US11988326B2
A modular coupler coaxially mountable with a mast includes a first plate, a second plate and a column axially extending between the first and second plates. An arm is rotatably attached to the column and generally transversely extends therefrom and beyond a radial extent of the first plate and of the second plate. A mounting bracket projects from the arm along a portion of the arm outside the radial extent of the first plate and of the second plate. The mounting bracket is configured to removably mount a first surveillance equipment thereto. A motor is mounted to the arm outside the radial extent of the first plate and of the second plate and is configured to rotate the arm about the column.
US11988324B2
An assembly includes an attachment arm having an axle extending from a first end of the attachment arm. The attachment arm of the detachable wheel assembly further includes a securing portion forming a second end of the attachment arm, the securing portion of the attachment arm including a pin positioned to extend above a first frame member of a gantry truss and to secure the first frame member between the pin and a portion of the attachment arm. The attachment arm also includes a frame support corresponding to a second frame member of the gantry truss such that the frame support supports the second frame member when the assembly is secured to the gantry truss, and the assembly includes a wheel rotatably attached to the axle of the attachment arm.
US11988317B2
An adaptive sealing device for pipeline porous leakage. The device includes a pressure protection device and an encircling sealing rubber cover. The pressure protection device is used to pressurize and seal the pipeline by the encircling sealing rubber cover. The device further includes a control mechanism connected with the pressure protection device for adjusting the sealing pressure of the pressure protection device on the pipeline. The device further includes an anti-retraction mechanism connected with the pressure protection device and the control mechanism for limiting the pressure protection device and/or the control mechanism.
US11988301B2
A valve assembly for a fuel tank includes a cage having a seat that defines an aperture and a spring latch that holds a poppet in an intermediate-open position, which spaces the poppet from a seat to allow fluid communication through an aperture. A method of operating a valve assembly due to a first-time fueling event is disclosed.
US11988295B1
A novel fluid valve system includes a housing defining a fluid path between first and second ports. The housing preferably includes an interior cylindrically-arcuate surface that defines a center of curvature, with the fluid flow path passing through an opening in the interior cylindrically-arcuate surface. The fluid valve may include a foot having a bottom and a heel, with the bottom facing the interior cylindrically-arcuate surface, and with the heel disposed transverse to the bottom. The foot may extend in a radial direction away from the center of curvature, with the foot pivoting within an operational angular range about the center of curvature. The bottom of the foot may be configured to translate over the opening in the interior cylindrically-arcuate surface, and the heel may be configured to abut the second port with the foot pivoted to a closed position of the operational angular range.
US11988278B2
A dual clutch transmission for a motor vehicle, with a first sub-transmission, with a second sub-transmission, with a first clutch associated with the first sub-transmission, and with a second clutch associated with the second sub-transmission. The dual clutch transmission is designed to be shifted into a parking lock state, in which two gears of one of the sub-transmissions are simultaneously engaged, and in the lock state, the two gears of the one first sub-transmission are simultaneously engaged. A first gear wheel of a first of the gears, which is designed as loose wheel and rotatably arranged on a first shaft of the dual clutch transmission, is connected in a torque-proof manner to the first shaft, by a first switching element.
US11988274B2
A passive lubrication system for lubricating components of a gearbox is provided. The passive lubrication system includes a first sump, formed in a housing of the gearbox, for holding a lubricant fluid for lubricating components of the gearbox and a second sump formed in the housing of the gearbox, the second sump for capturing lubricant fluid displaced, by rotation of the gear wheel, from the first sump, the second sump having one or more openings for directing lubricant fluid captured in the second sump to the one or more components of the single speed drive system to provide lubrication to the one or more components of the single speed drive system. The passive lubrication system also includes a channel formed in the housing of the gearbox, the channel for channeling lubricant fluid, displaced by rotation of the gear wheel, from the first sump to the second sump.
US11988272B2
A planetary transmission includes a transfer device for transferring a supply medium. First and second transmission parts rotate relative to one another, with the transfer device having an annular groove on a surface of the first transmission part or of the second transmission part. The transfer device has bores distributed over a periphery. The first transmission part includes a separate bush which points towards the second transmission part and has a sealing groove with a sealing ring axially on both sides of the annular groove. The bush is arranged rotationally fixed on a rest of the first transmission part and designed to float in an axial direction with sufficient play in order to tilt out of a coaxial relative position with respect to the first transmission part and/or to the second transmission part to the extent of a relative movability of the respective sealing ring within the associated sealing groove.
US11988271B2
An axle assembly and a method of manufacture. The axle assembly may include a differential carrier and a bearing support wall. The differential carrier may be made of a first material. The bearing support wall may be mounted to the differential carrier and may be made of a second material. The second material may have a greater stiffness than the first material.
US11988267B2
To provide a chain that can reduce friction loss, alleviate wear on sliding surfaces of a chain guide member, and reduce vibration and noise of the running chain. The chain is made up of a multiplicity of inner link plates and outer link plates alternately coupled together by connecting pins along the longitudinal direction of the chain. The height from a pitch line to a highest point on a backside of the plurality of inner link plates (backside height of the inner link plates) is different from the height from a pitch line to a highest point on a backside of the plurality of outer link plates (backside height of the outer link plates) by more than 0 and not greater than 0.5 mm.
US11988261B2
A biasing system for an actuator. The system includes a lock sleeve, a lock shaft, a tine having a tine finger extending along a longitudinal axis, a biasing member and a biasing spring. The biasing member and biasing spring are configured to maintain a position of the tine finger away from the longitudinal axis in the direction of the lock sleeve when the lock shaft and the lock sleeve are deployed, in use, such that, when the lock sleeve is returned, the tine finger is biased against the lock sleeve to prevent the lock sleeve from returning to a locked position before the lock shaft is able to return to a locked position.
US11988249B2
The invention relates to a joint, in particular for use in a parallel kinematic positioning device, which has at least three rotational degrees of freedom, and which has a rigid carrier element and at least two elastically deformable joint devices arranged overlapping one another at least in sections on the carrier element, wherein each of the joint devices comprises two joint elements, and each of the joint elements has an elongated connecting section and a securing section arranged at one end of the connecting section for securing the joint device to a higher level unit, and the two connecting sections of each joint device extend in a direction pointing away from the carrier element in such a way that they cross over one another.
US11988241B2
A self-locking nut includes a main-nut body and a deformable-nut body. The main-nut body has a recess leading into an interior threaded bore forming x turns of an internal thread therein. The deformable-nut body has an outer flange and an interior threaded bore forming y turns of an internal thread therein. The outer flange of the deformable-nut body is fixed to the main-nut body such that a relief space is formed between the deformable-nut body and the recess. A ratio of x:y is about 2:1.
US11988236B2
A threaded joint arrangement with visual and tactile indication of correct tightening force, includes a threaded fastener having a fastener shaft and a fastener head, a biasing member, a first object provided with a cavity in a reference surface with a bottom surface provided with a through hole, and a second object with a threaded hole. The through hole is aligned with the threaded hole and the fastener shaft extends through the through hole and is in threaded engagement with the threaded hole. The biasing member is arranged in the cavity between the fastener head and the bottom surface and is compressed between the fastener head and the bottom surface in response to rotation of the threaded fastener. An alignment surface is movable by rotation of the threaded fastener between a first position outside the cavity, a second position flush with the reference surface and a third position inside cavity.
US11988234B2
The disclosure relates to an electronic pump that can be used in a motor vehicle, particularly for generating hydraulic fluid flow for steering and braking, or to perform auxiliary functions such as dump bodies for garbage trucks or landscape trucks. Methods of operating the system and manufacturing the system are also provided.
US11988229B2
A method of positioning exits of diffuser pipes of a centrifugal compressor in an aircraft engine includes aligning an alignment tool with a structure supporting the diffuser pipes, and rotating each diffuser pipe about an inlet axis thereof to close a gap between a surface of the diffuser pipe and part of the alignment tool until the diffuser pipe abuts the part of the alignment tool. The alignment tool includes for example a body defining a center axis and having at least one tool datum configured for abutting against the casing, and a plurality of alignment members that are fixed to the body and extend radially from the body relative to the center axis.
US11988227B2
A compressor housing includes: when an intake side in an axial direction of the centrifugal compressor is defined as a front side, and a side opposite to the intake side in the axial direction is defined as a rear side, a shroud surface including a surface facing a tip of an impeller blade of the impeller with a predetermined gap; a front-side inner peripheral surface formed on the front side of the shroud surface in the axial direction and positioned on an outer side in a radial direction than a front end of the shroud surface; and plurality of grooves formed in the front-side inner peripheral surface at intervals in a circumferential direction wherein each of the plurality of grooves includes: an inclined portion whose depth gradually increases toward a rotation direction of the impeller; and a stepped portion formed at a downstream end of the inclined portion in the rotation direction.
US11988225B2
Provided is an axial fan including multiple forward-swept blades. An angle of advance of a trailing edge of the forward-swept blade is larger than an angle of advance of a leading edge of the forward-swept blade. An outer portion of the trailing edge, being positioned further in an outer periphery of the trailing edge than an intermediate portion of the trailing edge with respect to a rotary shaft of the axial fan, advances as the trailing edge advances radially outward of a ventilation channel of the axial fan.
US11988224B2
A fan blade (1) has a front inflow edge (2) and a rear outflow edge (3). The fan blade (1) also has an at least partially wavy inflow edge (4), that forms a wave (W) having a specific three-dimensional waveform.
US11988208B2
Sealing in rotary positive displacement machines based on trochoidal geometry that comprise a helical rotor that undergoes planetary motion within a helical stator is described. Seals can be mounted on the rotor, the stator, or both. The rotor can have a hypotrochoidal cross-section, with the corresponding stator cavity profile being the outer envelope of the rotor as it undergoes planetary motion, or the stator cavity can have an epitrochoidal cross-section with the corresponding rotor profile being the inner envelope of the trochoid as it undergoes planetary motion. In some embodiments, the geometry is offset in a manner that provides advantages with respect to sealing in the rotary machine. In multi-stage embodiments, the rotor-stator geometry remains substantially constant or varies along the axis of the rotary machine.
US11988199B2
The invention discloses a power generating device and an operation method thereof based on ocean temperature difference, which belong to the field of ocean energy utilization, and include a negative thermal expansion body, a rope and a generator. The negative thermal expansion body is connected to the rope, and the rope is connected to the generator simultaneously. The negative thermal expansion body is in a contracted state when in the hotter upper seawater close to the sea surface, and the difference obtained by deducting buoyancy from gravity is relatively large. The negative thermal expansion body is in an expanded state when in colder deep seawater, and the difference obtained by deducting buoyancy from gravity is relatively small. The unbalanced force on the rope will drive the rope to move, and the generator will be driven to generate power through the rope.
US11988195B2
A control arrangement of a wind turbine includes a watchdog including a reset module and a trigger module, wherein the watchdog reset module is configured to perform an internal reset when a sign-of-life signal is received from a remote communication system within a predetermined time limit, and wherein the watchdog trigger module is configured to issue a watchdog trigger when the predetermined time limit is exceeded; a sensor arrangement including a number of sensors configured to observe local parameters and to report local sensor data; and a wind turbine controller that initiates a local control sequence in response to the watchdog trigger, which local control sequence is configured to switch between a first mode of operation and a second mode of operation on the basis of the local sensor data. A method of operating a wind turbine is further provided.
US11988190B2
Disclosed is a wind turbine blade and a method for its manufacture. A lower shell part and an upper shell part are provided, each shell part having a leading edge end and a trailing edge end. A flatback profile component and web for connecting an inner surface of the lower side shell part with an inner surface of the upper side shell part are connected. The assembly which comprises the flatback profile component and the at least one web are placed on the lower shell part and the upper shell part is mounted. The wind turbine blade comprises a flatback profile component being arranged at the trailing edge, wherein the flatback profile component is coupled by at least one distance holder with at least one web, wherein the web couples the interior surface of the upwind side shell part with the interior surface of the downwind side shell part.
US11988188B2
A rotor for a wind turbine, to a rotor blade for a wind turbine, to a blade-fastening element for the fastening of a rotor blade, to a wind turbine, and to a method for mounting a rotor. A rotor for a wind turbine, comprising at least one rotor blade which extends from a blade tip to a face side, a hub having a blade-fastening element which, at the rotor-blade side thereof, has a blind hole for receiving a longitudinal bolt for the fastening of a rotor blade to the blade-fastening element, wherein the rotor blade has a fastening region which is of tubular form and which is arranged adjoining the face side, wherein the fastening region has at its outer circumferential surface and/or at its inner circumferential surface at least one thickened portion.
US11988181B2
A fuel distribution pipe that distributes and supplies fuel supplied from a fuel pipe to a plurality of fuel injection devices includes a pipe member configured to form a storage space for storing the fuel therein, and a connection member inserted into and joined to a tip end portion of the pipe member and having a through hole connected to the storage space. The connection member has an intermediate diameter portion adjacent to the storage space and a small diameter portion disposed on a side opposite to the storage space with respect to the intermediate diameter portion. The intermediate diameter portion has an inner diameter that is larger than an inner diameter of the small diameter portion and smaller than an inner diameter of the pipe member.
US11988180B2
The present invention provides a permanent magnet-electromagnet synergistic coupling-based high-speed solenoid valve with a high dynamic response and a low rebound, including a shell and an iron core. The iron core is installed in the shell, an axial center through hole is formed in a middle of the iron core, a spring limiting sleeve is installed in the axial center through hole, an armature and a reset spring cavity are sequentially formed below the iron core, an upper portion of a valve rod is located in the spring limiting sleeve, an upper disc permanent magnet, a lower disc permanent magnet and a spring washer are arranged in the spring limiting sleeve, and a giant magnetostrictor is installed between the upper disc permanent magnet and the lower disc permanent magnet. By means of the present invention, electromagnetic force generated during pickup of the armature can be effectively improved.
US11988178B2
Provided are systems and methods for propulsion and powering systems using recyclable metallic fuels. The method includes capturing fuel products, including a metal oxide and unburnt fuel from combustion of a metallic fuel, storing the unburnt metallic fuel and the fuel products to generate power and/or thrust, and recycling the metal oxide to recreate the metallic fuel and/or byproducts. A system for propulsion and power generation using a metallic fuel includes a combustion chamber for combusting the metallic fuel to provide propulsion, a reaction chamber for generating electricity and thermal power using heat from unburnt metallic fuel and fuel products, a storage system for capturing the unburnt metallic fuel and the fuel products and at least one recycling system for directing the captured unburnt metallic fuel and/or the fuel products to the combustion chamber and/or the reaction chamber.
US11988173B2
A multi-pulse propulsion system includes at least one pulse chamber containing at least one propellant for igniting during at least one pulse of the multi-pulse propulsion system, at least one additional pulse chamber containing at least one additional propellant for igniting during at least one additional pulse of the multi-pulse propulsion system, and at least one passive fuzing system configured to initiate the at least one additional pulse. The at least one passive fuzing system includes a sensor and an igniter. The sensor is configured to sense an environmental condition and/or a ballistic condition. The igniter is configured to provide a stimulus that causes ignition of the at least one additional propellant in response to the sensor sensing that the environmental condition and/or the ballistic condition has reached or exceeded one or more threshold values.
US11988171B2
A rocket engine section includes a combustion chamber body having an inner wall and a channel carrying a cooling medium extending outside and along the inner wall. The rocket engine section further comprises a porous portion integrally formed with the inner wall and integral with the inner wall and adapted to allow the cooling medium carried in the channel to pass from the channel to the interior of the combustion chamber body. A porosity of the porous portion determines a volume flow rate and/or mass flow rate of the cooling medium let through into the interior of the combustion chamber body.
US11988163B2
Providing additional mass air flow to an engine of a vehicle to expand an operating range of cylinder deactivation (CDA) is provided. Aspects of the present disclosure describe a method and system to provide additional mass air flow to an engine using an auxiliary air source coupled to a turbocharger. When a low air-to-fuel ratio state is determined in association with operating the vehicle in CDA mode, the auxiliary air source is activated to assist the turbocharger with increase the supply of supercharged intake air to the engine. Accordingly, the operating range of CDA is expanded.
US11988156B2
A power plant assembly, including—a turbine for driving at least one rotor shaft; —a combustion chamber for generating drive energy for the turbine; —at least one electric machine which is coupled to the rotor shaft and can be operated both in a generator mode and in a motor mode; —and at least one energy storage system which is connected to the electric machine and can store energy generated by the electric machine when the electric machine is in generator mode. A set of control electronics of the power plant assembly is configured to operate the combustion chamber using a lean fuel-air mixture and, for this purpose, to selectively operate the at least one electric machine in generator mode or in motor mode, depending on the power to be applied by the power plant assembly.
US11988155B2
A compressor wheel is provided for the output shaft. Air bleed ports are formed in a shroud case that surrounds the compressor wheel. A plurality of air bleed passages are formed in the engine housing that surrounds the shroud case. An annular chamber is formed between the air bleed ports and the air bleed passages, for storing compressed air that is extracted from the air bleed ports.
US11988154B2
A direct drive electrically-geared turbofan is provided via a first magnetic gearbox assembly connected to a fan of a turbofan engine; a second magnetic gearbox assembly connected to a spool shaft of the turbofan engine; and a speed controller configured to adjust a rotational speed of the fan based on a rotational speed of the spool shaft by selectively coupling and decoupling the first magnetic gearbox assembly with the second magnetic gearbox assembly. In various aspects, the first or second magnetic gearbox assembly includes a permanent magnet array, while a different one of the first or second magnetic gearbox assemblies includes a rotor winding separated from the permanent magnet array by an air gap; and the speed controller is configured to selectively couple and decouple the first and second magnetic gearbox assemblies with each other via controlling a switch in a winding circuit with the rotor winding.
US11988150B2
A bypass turbine engine includes a fixed casing, a first shaft (low-pressure shaft), a second shaft (high-pressure shaft), at least one accessory to be driven by a motor powered with electrical energy, a first intermediate shaft tapping mechanical power off the low-pressure shaft, a second intermediate shaft tapping mechanical power off the high-pressure shaft, and an electrical energy generator assembly coupled to the first and second intermediate shafts so as to receive mechanical power from the first and second intermediate shafts. The generator assembly converts the mechanical power received from the first and second intermediate shafts into electrical energy to power the motor or motors, which comes simultaneously from the mechanical power tapped off the low-pressure shaft and the mechanical power tapped off the high-pressure shaft. The generator assembly is housed in an arm in the lower part of the turbine engine and extending vertically into a bypass flow duct.
US11988138B2
The present disclosure provides air cooling systems and methods for propulsion systems (e.g., aviation or aerospace propulsion systems). More particularly, the present disclosure provides integrated air cooling systems and methods utilizing air cycle machine cooling for hybrid-electric aircraft or aerospace propulsion systems or the like. The present disclosure provides integrated air cycle machine cooling into the hybrid propulsion system (e.g., into the wing-mounted hybrid propulsion system). As such, the air cooling systems and methods of the present disclosure can minimize weight while improving electric motor/generator cooling.
US11988132B2
A fan control system for a variable pitch fan of a work vehicle includes a blade pitch module that adjust a pitch of a plurality of blades of the variable pitch fan to generate airflow in a first direction. A reversing module selectively commands a fan reversal that includes instructing the blade pitch module to temporarily adjust the pitch of the plurality of blades to generate airflow in a second direction. A first timer module, in response to the reversing module commanding the fan reversal, resets and increments a first timer and compares the first timer to a first threshold. A first reversal prevention module, in response to the first timer being less than the first threshold, prevents the reversing module from commanding a fan reversal by indicating that a first type of fan reversal is not permitted.
US11988119B1
Apparatuses, systems and methods are disclosed including an internal combustion engine. The internal combustion engine can include an engine block defining a combustion chamber and a crankcase in fluid communication with the combustion chamber. The internal combustion engine can include an auxiliary device in fluid communication with the crankcase of the engine block. The auxiliary device is driven by the internal combustion engine to supply air to the crankcase of the engine block at a desired pressure range and a desired mass flow rate range to ventilate the crankcase.
US11988118B2
A dipstick assembly includes a first handle attached to an end of the rod, a second handle including a second handle opening configured to receive the first handle and the rod, and a cleaning pad disposed at the bottom end of the second handle. The cleaning pad is configured to receive the rod and contact the rod to clean the rod when the first handle and rod are moved vertically relative to the second handle and the cleaning pad.
US11988113B2
A system may include a first duct including an air inlet end and an air outlet end, and a valve within the first duct and configured to open to allow or close to prevent fan duct air from the air inlet end to pass through to the air outlet end of the first duct. The system may also include a second duct including a first end and a second end. The first end of the second duct may be coupled to a sidewall of the first duct and configured to allow the fan duct air to flow from the first duct to the second duct. The system may also include a resonance chamber coupled to the second end of the second duct and configured to allow the air in the resonance chamber to act as a spring causing the air in the second duct to oscillate at a predefined frequency.
US11988108B2
A turbine vane of a turbine engine such as a turboprop or a turbojet, the vane comprising a root supporting a blade, the vane including at least one air-circulation duct for cooling the air during operation, the duct including, at the vane root, an inlet portion for collecting the cooling air, the inlet portion extending away from a lower surface of the vane root opposite the blade. At least one inlet portion is provided with a helical element for rotating the cooling air in order to improve the cooling efficiency thereof.
US11988084B2
A sealed enclosure can include a glass portion that can be positioned with respect to an electromagnetic component that is in an area defined by the sealed enclosure. The enclosure can prevent fluid from a wellbore environment from contacting the electromagnetic component and to allow the electromagnetic component to wirelessly communicate with a component external to the sealed enclosure. A second portion interfaces with the glass portion for preventing the fluid from the wellbore environment from contacting the electromagnetic component.
US11988083B2
A system for drilling a well may be adapted to process signals received from a fiber optic cable located in the casing of a previously drilled well or wells. The fiber optic cable may act as a distributed sensor receiving acoustic signals generated during the drilling of the well, and the system may be programmed to process the signals from the fiber optic cable to locate the borehole of the well being drilled, including its location relative to the previously drilled well or well. The system may be used to automatically update a well plan for the well being drilled responsive to information about the location of the borehole and also may be used to automatically adjust one or more drilling parameters or drilling operations responsive to the location of the second well borehole.
US11988081B2
Gravity assisted reservoir drainage systems and methods, which improve preexisting reservoir drainage systems and artificial lift methods using the interwell hydraulic communication that exists between closely spaced horizontal wells in certain fully developed leases completed with large multi-stage hydraulic fracture treatments in batch fashion.
US11988076B2
A method for assembling a liner system including disposing from an uphole end of the liner a first slip subsystem, disposing from the uphole end of the liner a seal, and disposing from the uphole end of the liner a second slip subsystem.
US11988073B2
A drill stem grease injector for a directional drill and associated methods are disclosed. Example drill stem grease injectors include a piston within an injection chamber, and a grease port in a side of the injection chamber, wherein grease port is configured to actuate before motion of the piston during an injection operation. Drill stem grease systems shown provide refill capabilities that reduce or eliminate a user's need to touch grease.
US11988069B2
Systems and methods include a computer-implemented method for providing a predictive pressure protection system. Flare sources, performance limits, and relationships between control valves and relief valves are established. A flare simulator is generated using piping isometric drawings. An emergency event is monitored, and information for the emergency event is filtered based on a control valve limit breach. Event start and finish time periods are divided into cases representing smaller time frames. Source max loads are determined for each case, and each case is run through the flare simulator. Flare/relief valve performance indicators are determined based on the source max loads after running each case.
US11988068B1
The invention relates to the technical field of oil and gas field development, in particular to a staged multi-cluster fracturing sliding sleeve system and method based on smart key label. The system includes at least one multi-cluster sliding correspondingly placed in each fracturing stage, an end sliding sleeve, and a smart key label. The method includes: step S1, performing fracturing stage by stage from a first stage to a last stage, placing the smart key label through a wellhead and pumping the smart key label to the target fracturing stage; step S2, opening the multi-cluster sliding sleeves of the current fracturing stage one by one through the smart key label, and finally blocking the smart key label in the end sliding sleeve when the multi-cluster sliding sleeve and the end sliding sleeve of the current fracturing stage are opened; and step S3, repeating the steps S1 and S2 until the fracturing operations of all the stages are completed.
US11988066B2
A dynamic underbalance sub for use in a wellbore may include a sub housing, a first chamber provided in an interior of the sub housing, an opening extending through the sub housing and configured such that the first chamber is in fluid communication with an exterior of the sub housing, a second chamber provided in the interior of the sub housing, and a pressure-isolating wall provided between the first chamber and the second chamber.
US11988063B2
An improved wellhead stuffing box device is disclosed, having a coil spring, between a loading plate and the packing members of a stuffing box, and a housing threaded over the loading plate and the coil spring onto the outer wall of the stuffing box. The loading plate is adjacent the coil spring, which applies constant pressure on the packing members, causing the packing members to bulge continuously, as they wear out, thereby maintaining a seal between the packing members and a polish rod while in operation through the life of the packing members. The loading plate may be adjusted to adjust the spring force in the coil spring. The entire assembly has an aperture through its central longitudinal axis for the polish rod to oscillate there through. Embodiments include a stuffing box with an improved stuffing box cap.
US11988062B2
A method for adjusting the axial position of a first member relative to a second member, the first member being threadedly connected to the second member such that rotation of the first member relative to the second member results in axial movement of the first member relative to the second member. The method includes the steps of providing a piston assembly having an annularly extending cylinder and an annularly extending piston which is slidably received in the cylinder, the piston assembly being operable to extend and retract the piston relative to the cylinder; positioning the piston assembly coaxially relative to the first and second members such that the cylinder is engageable with one of the first and second members and the piston is engageable with the other of the first and second members such that, upon activation of the piston assembly, the piston assembly rotates the first member relative to the second member; and activating the piston assembly to thereby rotate the first member relative to the second member and thereby move the first member axially relative to the second member.
US11988055B2
A controllable downhole drilling and completion tool separating device and their method of use are provided. The device includes an upper mandrel connector, an outer sleeve, a claw clamp sleeve, a claw clamp locking ring, a mandrel sleeve, a lower connector, a piston ring and a pressure bearing ball. The upper end of the lower connector is on the outer side of the upper connector in a sleeving mode. A first annular cavity is between the lower connector and the upper connector. The piston ring is on the outer side of the upper connector in a sleeving mode and located in the first annular cavity. The claw clamp sleeve and the outer sleeve are sequentially arranged on the outer side of the upper connector in a sleeving mode. A second annular cavity is communicated with the first annular cavity and formed between the claw clamp sleeve and the upper connector.
US11988053B2
A body defines a central flow passage. A check valve is located within the central flow passage. The check valve is supported by the body. The check valve is arranged such that a fluid flow travels in a downhole direction during operation of the float collar. An auxiliary flow passage is substantially parallel to the central flow passage and is defined by the body. The auxiliary flow passage includes an inlet upstream of the check valve and an outlet at a downhole end of the float collar. A rupture disk seals the inlet of the auxiliary flow passage. The rupture disk is configured to burst at a specified pressure differential.
US11988049B2
A perforating gun assembly may include a first perforating gun housing, a first shaped charge provided within the first perforating gun housing, and an alignment sub coupled to the first perforating gun housing. The alignment sub may include a first sub body and a second sub body rotatably coupled to the first sub body.
US11988043B2
Ladders, ladder components and related methods are provided including embodiments of a hinge that may be used in a combination ladder. In one embodiment, a hinge mechanism includes a first hinge assembly and a second hinge assembly. The first and second hinge assemblies are coupled together for relative rotation about a defined axis. An adjustment mechanism enables the two hinge assemblies to be selectively locked or unlocked to prohibit or permit relative rotation, respectively. In one embodiment, the adjustment mechanism includes a lock plate displaceable along a first axis and a retainer displaceable along a second axis. The retainer is configured to hold the lock plate in a disengaged state until a release structure displaces the retainer away from the lock plate. The release structure may be configured to be actuated and displace the retainer upon relative rotation of the hinge assemblies to (or through) a predetermined angular configuration.
US11988041B2
A scrolling system for a window curtain includes a transmission device connected between a shaft to which the curtain is wrapped, and a fixed frame fixed. The transmission device includes a housing in which a first transmission unit and a second transmission unit are accommodated. The first transmission unit includes a first bevel gear which is engaged with a second bevel gear of the second transmission unit. The shaft is connected to the second transmission unit. The first transmission unit includes a loop which is located beyond the housing. A driving rod is hooked to the loop and drives the first bevel gear which drives the second bevel gear so that the second transmission unit is rotated, such that the shaft is rotated to operate the curtain up and down.
US11988040B2
A roller shade comprising a shade drive unit having a counterbalancing spring connected to and extending between a stationary spring carrier and a rotating spring carrier over an output mandrel, wherein the output mandrel comprises a length that maintains the spring in a stretched state such that the plurality of coils at the active portion of the spring do not contact each other when the shade material is at the rolled down position to reduce friction in the counterbalancing spring.
US11988035B2
A press-fit window insert configured to provide secondary protection to an existing window, having a carrier, a fin, and a fastening clip. The carrier includes a substantially rigid framework having channels within the framework configured to securely accept one or more attachments. The fin extends from the carrier and includes a substantially flexible blade extending from a base portion of the fin. The base portion of the fin is configured to interlock the fin to the carrier. The fastening clip includes a substantially rigid brim extending from a base portion of the fastening clip. The base portion of the fastening clip is configured to interlock the fastening clip to the carrier.
US11988025B2
The invention relates to a concealed door handle and a vehicle. The concealed door handle comprises: a handle body; a handle base fixed in a body of a vehicle, the handle body being concealed in the handle base, and the handle body being rotatably connected to the handle base; and a deployment microswitch arranged on the handle base and configured to detect a deployed position of the handle body and to maintain communication with a vehicle control module, wherein when the deployment microswitch jumps from a triggered state into an untriggered state, the deployment microswitch sends an input signal for unlocking an electronic lock to the vehicle control module. The concealed door handle of the invention has a simple structure and low costs, and a signal source can be arranged in a limited structural space.
US11988024B2
An anti-theft merchandise hook that includes a top wire connected to a housing at a first end of the top wire, and to a mounting portion, used to mount the anti-theft merchandise hook to a stationary surface, at a second end of the top wire opposite the first end. A bottom wire is attached to the mounting portion and extends from the mounting portion towards the housing. The bottom wire is configured to hold retail merchandise. A hanger is at least partially disposed within the housing. The hanger is configured to move between a closed position in which the hanger abuts the bottom wire, and an open position in which the hanger is spaced some distance from the bottom wire. A motor is configured to move the hanger between the closed position and the open position.
US11988020B2
The present invention relates to a door-lock system (S) for a household appliance, in which said household appliance is of the type comprising a frame and a door hinged to said frame, and in which said lock-door system (S) comprises: an engaging member (2), which can be fixed to said door of said household appliance, and comprising a prong (22) and a security member (23) arranged substantially parallel to said prong (22); and a door lock device (1). The present invention also relates to an oven.
US11988013B2
A wall segment for use in a wall system may comprise: a first sidewall; a second sidewall disposed opposite the first sidewall, the first sidewall and second sidewall defining a cavity therebetween; and a webbing system disposed between the first sidewall and the second sidewall.
US11988011B2
A raking barrier panel includes a plurality of pickets, each defining a pivot pin hole. A channel member includes a web wall defining a plurality of spaced apart openings that each receives a respective one of the plurality of pickets therethrough. A plurality of picket pivot members are in snap-fit engagement with the channel member, and each one of the plurality of picket pivot members includes a pair of opposed end walls and a pair of opposed side walls together forming a box-like shape. A pivot pin extends from at least one of the pair of opposed side walls and is received by the pivot pin hole of a respective one of the plurality of pickets to define a pivot axis with respect to the channel member.
US11988006B1
Disclosed is a popup camper having a base, a top, a first sidewall having a first edge, a second sidewall having a second edge, a third sidewall connected to the first sidewall at the first edge, connected to the second sidewall at the second edge, connected to the top at a third edge, and connected to the base at a fourth edge, a hinge connecting the base and the top, the hinge opposite the third sidewall, wherein the top can be disposed in an open position or a folded position, wherein in the open position the top is hingedly rotated away from the base to form an interior space between the top, base, first sidewall, second sidewall, and third sidewall, and wherein in the folded position the top is hingedly rotated towards the base collapsing the interior space.
US11988003B2
A post comprises a first end and a second end. The first end comprises a connection arrangement for fixing the post to the ground or the bottom under water and wherein the post is tubular. A first layer of the post is made of a plastic and a second layer is made of a composite material having a higher e-modulus than that of the plastic and wherein the first layer comprises at least one hole which the composite material of the second layer extends at least partly into.
US11987999B2
A support head mountable on a support post for supporting a beam in a formwork system is provided. The support head includes a top member for contacting and supporting the beam, a base member mountable on top of the support post, and a pin. Each of the top and base members has a tube with opposing pin holes. The tubes are configured to form vertically extending telescopic tubes, with the pin holes aligned along a horizontal axis. The pin is insertable into the pin holes, and has spaced apart depressions thereon. The pin is slidably moveable in the pin holes from a first position to a second position. In the first position, the depressions are offset from the pin holes. In the second position the depressions are aligned with the respective pin holes thus lowering the first tube and the top member in height.
US11987989B2
A concrete wall has a back surface supported by a back panel while a decorative material is applied to an opposing front surface of the wall by hand or by pneumatic projection while the surface is still plastic, and without using bonding agents. The decorative material may be further exposed by a surface treatment before or after the front surface is floated and finished, with a sealant optionally applied thereafter. The front surface may be created by pneumatic methods or by pouring concrete into forms and removing the front panel to expose the front surface while it is still plastic but hydrated enough not to slump.
US11987988B2
A floor element for forming a floor covering, wherein the floor element comprises a decorative layer made of a ceramic material; a support layer arranged below the decorative layer; and a reinforcing layer arranged in between the decorative layer and the support layer, wherein the support layer comprises edges provided with coupling elements configured to realize a mechanical coupling with coupling elements of an adjacent floor element.
US11987985B2
A metal roofing system contains, in order a roof deck, a fire resistant (FR) fleece, and a metal sheeting system. The second side of the FR fleece faces the roof deck. The FR fleece contains a plurality of FR staple fibers and a plurality of first char scaffold fibers. The FR fleece has a fleece thickness defined as the distance between the first side and the second side. The metal sheeting system contains a plurality of metal sheets having an upper and lower side, where the lower side of the metal sheeting system faces the first side of the FR fleece. The metal sheets have an average metal sheet thickness defined as the distance between the upper and lower sides, where the thickness of the FR fleece is at least about 3 times the average metal sheet thickness. The FR fleece has a density of less 0.5 g/cm3.
US11987974B2
A portable expandable device with a contracting mechanism which allows for many forms of recreational products and structures to be expanded, reinforced in the expanded shape, and then contracted easily to regain its portable form. The expansion means is exercised by the use of at least one of the following, resiliently extending, unfolding, inflating, as to become an expanding form which can then be easily retracted to the redeployed form. The retraction mechanism reverses the expansion process utilizing a mechanism which sequentially exerts the forces needed in the proper locations in order to ensure proper contraction. Disclosed embodiments utilized supplemental structural reinforcement of the expanded form through the use of joints, releasable interlocks, latching mechanisms, air bladders, to ensure the form is stable and usable. The objective being a stable structure with a rapid and easy deployment and a supplemental retraction means as to be easily transportable.
US11987969B2
A toilet assembly includes a toilet body and a fluidic oscillator. The toilet body defines a toilet bowl that is configured to receive a volume of fluid therein. The fluidic oscillator is coupled to the toilet body in a rim area of the toilet bowl. The fluidic oscillator is positioned to direct a fluid onto an inner surface of the toilet bowl. The fluidic oscillator is configured to continuously redirect the flow of fluid to different locations along the inner surface of the toilet bowl.
US11987968B2
The present invention provides a flush toilet device (1) including: a flush toilet (2); a flush water tank (10); a discharge valve (12) that discharges the flush water stored in the flush water tank; a branching portion (33) that splits flush water supplied from a water supply source into first and second branched flow paths; a first on-off valve (19) provided in the first branched flow path and switches between spout and stop of the flush water from the upper spout port; a second on-off valve (17) provided in the second branched flow path and switches between supply and stop of the flush water into the flush water tank; and a controller (28) that controls the first and second on-off valve so that water is spouted from the upper spout port and is supplied into the flush water tank at a time by opening the first and second on-off valves.
US11987964B2
A sanitary faucet having a faucet body; a mixing valve for mixing cold water and warm water to form a mixed water; and a thermostatic mixing valve for mixing cold and hot water to generate the warm water, containing an expansion material element and a gate valve operated by the expansion material element for adjusting a mixing ratio between the cold water and the hot water, wherein the expansion material element and the gate valve are arranged non-coaxially to each other, wherein the expansion material element can be used to operate the gate valve via a connection element, and wherein the connection element can be attached to the gate valve or the expansion material element and can subsequently be rotated into a closed position, in which the gate valve and the expansion material element are interconnected by the connection element. A method of installing a sanitary faucet is proposed.
US11987961B2
Embodiments described herein provide systems and methods for preventing and mitigating collisions between components of an industrial machine. The industrial machine includes an electronic controller, having an electronic processor and a memory, that is configured to receive dipper position data indicative of a position of the dipper and determine a distance between the dipper and tracks of the industrial machine based on the dipper position data. The electronic controller is further configured to set a motion command limit for a dipper motion based on the distance, the dipper motion being selected from a group of a swing motion, a crowd motion, and a hoist motion and control the dipper motion according to a dipper motion command limited by the motion command limit.
US11987959B2
A shovel includes a lower traveling structure, an upper swing structure mounted on the lower traveling structure via a swing mechanism, an image capturing device attached to the upper swing structure to capture an image of an area surrounding the upper swing structure, and a display device. The display device is configured to display the image captured by the image capturing device such that distortion in a part of an edge of the upper surface of the upper swing structure is reduced compared with distortion in another part in the image.
US11987958B2
A housing of a multi-control valve includes an arm parallel passage, an arm crowding supply passage, an arm pushing supply passage, a boom parallel passage, a boom raising supply passage, and a boom lowering supply passage. The housing further includes: a slide hole; a head-side passage that is branched off from the boom raising supply passage and extends to the slide hole; a rod-side passage that is branched off from the boom lowering supply passage and extends to the slide hole; and a regeneration passage that extends from the slide hole to the arm parallel passage. The slide hole receives a boom sub spool therein. The boom sub spool is either a boom recycling spool or a boom regeneration spool.
US11987955B2
It is made possible to prevent damage to hydraulic parts of a work machine due to a decrease in performance of a hydraulic fluid even when the hydraulic fluid of a hydraulic system is changed and the hydraulic fluid becomes a mixed oil in which a mineral oil and a biodegradable oil are mixed with each other. For this purpose, a storage device stores, in advance, oil change history information of the hydraulic fluid, oil kind determination values for determining whether the hydraulic fluid is either the mineral oil or the biodegradable oil or the mixed oil of the mineral oil and the biodegradable oil, and abnormality determination values for respective kinds of the hydraulic fluid. A controller checks whether the oil change history information includes oil change information for which oil kind determination has not been made. When there is oil change information for which oil kind determination has not been made, the controller determines a kind of the hydraulic fluid on the basis of the respective values of a plurality of oil properties detected by an oil sensor and the oil kind determination values. The controller determines an abnormality in the hydraulic fluid by using abnormality determination values corresponding to a result of determination of the kind of the hydraulic fluid.
US11987948B2
Disclosed is a pumping method of a large-diameter horizontal pressurized long dewatering well for inexhaustible pumping strata. Clay layers and sand soil layers are determined according to construction positions of foundation pits, horizontal holes are drilled in the sand soil layers with a drill rig with simultaneous casing, and after the designed depth is reached, horizontal wells are placed, the horizontal wells are located above the junction of the clay layers and the sand soil layers, and the horizontal wells comprise drain pipes and air ducts, the drain pipes and the air ducts are located at the same elevation, each air duct is located between the two drain pipes, and the air duct is connected with the air pipe of the air compressor to deliver and pressurize, so as to facilitate water in the strata of aquifer to gather into the drain pipes.
US11987945B2
Certain aspects of the present invention are directed to an assembly comprising a series of rods for collecting water or transporting water which is structured to result in capillary spaces between it and other similar-shaped rods when such rods are adjacent to another. Each rod has a cross-sectional shape with one surface portion of the rod being a greater distance from the center of the rod than another surface portion of the rod. The rods are configured to be laid together in parallel in an assembly or prefabricated into an assembly to create a network of channels for the collection and transport of water by capillary action that is free from soil and debris, wherein the rods are partially in contact to create non-uniform hallow spaces.
US11987944B2
A mat washer includes: a body adapted for highway transport; a loading platform adapted to receive a stacked pair of mats from, for example, a forklift, and adapted to pivot the pair of mats to an upright position; a splitter adapted to receive the mats from the loading platform and to separate the mats from one another; a transporter adapted to transport each of the mats longitudinally relative to the body from the splitter; a uniter adapted to receive the mats from the transporter and urge them together; an unloading platform adapted to receive the pair of mats from the uniter and pivot them downwardly for retrieval by, for example, the forklift; and a washing facility disposed between the loading and the unloading platform and adapted to wash the mats.
US11987938B2
The present invention is manufactured to prevent the difficulties that may arise when installing a drainage system into a trench that has been cut into a sidewall of a building containing a network of structural members. The present invention is developed to produce a secure and effective connection between the structural member(s) of a drainage system and the structural members in the sidewall of a building in order to increase the stability of the drainage system within the sidewall.
US11987937B1
A composite embankment structure includes an embankment, an airflow-enhanced embankment ventilation structure, and a heat pipe system. The embankment includes an embankment filler layer, a ventilation slab lower leveling layer, a ventilation slab upper cushion, and a pavement structure layer arranged in sequence from bottom to top. The ventilation slab in the airflow-enhanced embankment ventilation structure is arranged between the ventilation slab lower leveling layer and the ventilation slab upper cushion. The heat pipe system includes a heat pipe, and one end of the heat pipe is inserted into the embankment from an embankment slope and is located under the ventilation slab.
US11987935B2
The present disclosure describes methods of treating fibrous cellulosic materials with sucrose fatty acid ester containing particles (carrier systems) that allow for modifications of surfaces, including making such surfaces water resistance and/or oil/grease resistance. The methods as disclosed provide combining at least one saccharide fatty acid esters (SFAE) with a polymer (e.g., latexes) to form micellular particles and applying such particles to substrates including fibrous cellulose-based materials (e.g., pulp) to form, inter alia, molded products. Compositions comprising combinations of SFAE, a latex and optionally a mineral or other additives are also disclosed.
US11987918B2
A cutting system includes a sewing machine and a cutting device. The sewing machine includes a sewing portion, a sewing communication portion, a sewing processor, and a sewing memory. The sewing machine acquires an embroidery data stored in the sewing memory. The sewing machine sends, via a network line, the acquired embroidery data. The cutting device includes a cutting portion, a cutter communication portion, a cutter processor, and a cutter memory. The cutting device receives, via the network line, the embroidery data sent by the sewing machine. The cutting device generates a cutting data based on the received embroidery data. The cutting device drives the cutting portion based on the generated cutting data, and cuts the object to be cut.
US11987910B2
Provided are a base cloth for a material and a manufacturing method therefor, the base cloth suppressing opening of a boundary portion between an expanding part and a non-expanding part when used in a bag body, having low dynamic air permeability, and being capable of exhibiting the characteristic of being unlikely to burst even at high temperatures. A fabric base cloth for a material according to the present invention is composed of fibers having a prescribed thread breaking strength value, and for which the cloth surface is not subjected to resin coating, laminating, or a resin impregnation treatment.
US11987905B2
A monofilament yarn (10) has a polygon cross-section having a width and a height, which width is greater than the height, and four corners (11, 12, 13, 14) of which the first two opposite corners (11, 13) have angles of over 90 degrees, and the second two opposite corners (12, 14) have angles under 90 degrees, said width being 0.1 to 3 mm. The rounded first two opposite corners have a radius of 0.1 to 0.15 mm, and the rounded second two opposite corners have a radius of 0.075 to 0.1 mm. The yarn may be used to fabricate an industrial textile, which may be a papermaking fabric such as a dryer fabric or a forming fabric, or a filter fabric, such as a disc filter, a horizontal vacuum belt filter, a belt filter press, a twin wire press, a drum filter, a pan filter, a gravity table or a filter press.
US11987889B2
A boring bit or other component for horizontal directional drilling is provided which includes a hard faced layer that is preferably made by a laser cladding bead. A subsequent or post heat treatment is applied to modify the heat affected zone (HAZ) to eliminate or reduce the hard brittle regions and/or softer regions in the base iron or steel material of the HAZ. Further, the hard faced layer may be applied in combination with carbide insert teeth that are embedded within the steel base of the boring bit body, such as by press fitting.
US11987887B2
The present invention relates to a method for adjusting a passivation composition by determining the redox potential of a passivation composition as well as to a method for passivating metallic substrates by treatment with a passivation composition.
US11987885B2
A gas supply apparatus supplies a gas to a processing space where a gas processing is performed on a substrate. The gas supply apparatus includes: a gas supply source configured to supply a gas; a gas supply path configured to supply the gas to the processing space; an opening/closing valve configured to supply/stop the gas and provided in the gas supply path; a detector configured to detect a detectable index correlated with a Cv value of the opening/closing valve; an opening degree adjustment mechanism configured to adjust an opening degree of the opening/closing valve when the opening/closing valve is opened; and a controller configured to: store a relationship between the Cv value and the index; and control the opening degree by the opening degree adjustment mechanism such that when the index deviates from an appropriate range corresponding to an appropriate Cv value, the index falls within the appropriate range.
US11987881B2
A thin film deposition system is disclosed in order to form a thin film on a substrate. The thin film deposition system comprises a hydrogen peroxide source. The hydrogen peroxide source comprises an electrochemical cell that converts a hydrogen gas to a hydrogen ion gas. The electrochemical cell converts an oxygen gas and water into a liquid phase complex. The liquid phase complex reacts with the hydrogen ion gas to form hydrogen peroxide.
US11987879B2
Disclosed are approaches for forming semiconductor device cavities. One method may include providing a set of semiconductor structures defining an opening, wherein the opening has a first opening width along an upper portion of the opening and a second opening width along a lower portion of the opening, the first opening width being greater than the second opening width. The method may further include forming a blocking layer along the set of semiconductor structures by delivering a material at a non-zero angle of inclination relative to a normal extending perpendicular from a top surface of the set of semiconductor structures. The blocking layer may be formed along the upper portion of the opening without being formed along the lower portion of the opening, and wherein an opening through the blocking layer is present above the opening.
US11987862B2
A method for liquefying niobium and tantalum and a method for producing a niobium solution and a tantalum solution, which can liquefy niobium and tantalum or produce a niobium solution and a tantalum solution safely and efficiently from a smelting raw material containing niobium and tantalum. Ammonium hydrogen sulfate is mixed as a reaction agent into a powdered substance containing at least one element of niobium or tantalum, and the mixture is melted under predetermined conditions to form a molten substance. A suspension formed by dissolving the molten substance having been solidified in an aqueous solution is subjected to solid-liquid separation to recover a precipitate. The precipitate is composed of niobium and/or tantalum with few impurities, and the precipitate is dissolved in one type of acid solution selected from hydrochloric acid, sulfuric acid, or nitric acid, whereby 90% or more of niobium and/or tantalum can be leached out.
US11987859B2
Energy-efficient production of a ferritic hot-rolled strip (6) in an integrated casting-rolling plant (1), which modifies the known processes for producing a ferritic hot-rolled strip (6) in an integrated casting-rolling plant (1) so that the ferritic hot-rolled strip (6) can be produced significantly more energy-efficiently but nevertheless has good metallurgical properties and a good surface quality.
US11987855B2
The invention relates to a method and a system for determining the steel-tapping quantity of a converter, which consider that the working environment of the steel-making process of the converter is severe, the measurement is difficult and the interference of other factors is large, and provide a data-driven prediction model based on data, combine a Principal Component Analysis (PCA) with a RBF neural network, find the relation and the internal relation among variables by carrying out mathematical analysis on the related internal structure of the original variables, can quickly and accurately realize the prediction of the steel-tapping quantity of the converter, improve the component hit rate and the product stability in the steel-making process of the converter, are beneficial to realizing the control of narrow regions of steel-making components, save the alloying cost and have good application prospects in the field of ferrous metallurgy.
US11987846B2
The disclosure provides a pair of isolated biomarkers selected from the group consisting of IBP4/SHBG, IBP4/PSG3, IBP4/LYAM1, IBP4/IGF2, CLUS/IBP3, CLUS/IGF2, CLUS/LYAM1, INHBC/PSG3, INHBC/IGF2, PSG2/LYAM1, PSG2/IGF2, PSG2/LYAM1, PEDF/PSG3, PEDF/SHBG, PEDF/LYAM1, CD14/LYAM1, and APOC3/LYAM1, wherein the pair of biomarkers exhibits a change in reversal value between pregnant females at risk for pre-term birth and term controls. Also provided is a method of determining probability for preterm birth in a pregnant female, the method comprising measuring in a biological sample obtained from the pregnant female a reversal value for at least one pair of biomarkers selected from the group consisting of IBP4/SHBG, IBP4/PSG3, IBP4/LYAM1, IBP4/IGF2, CLUS/IBP3, CLUS/IGF2, CLUS/LYAM1, INHBC/PSG3, INHBC/IGF2, PSG2/LYAM1, PSG2/IGF2, PSG2/LYAM1, PEDF/PSG3, PEDF/SHBG, PEDF/LYAM1, CD14/LYAM1, and APOC3/LYAM1 to determine the probability for preterm birth in the pregnant female.
US11987842B2
A method of preparing reagents includes inserting a cartridge into an instrument. The cartridge includes a plurality of reagent enclosures disposed in a cavity of the cartridge and exposing a port to an exterior of the cartridge. Each reagent enclosure includes a reagent container including a reagent and an internal cavity defining a compressible volume, an opening defined through the reagent container to the internal cavity. The method further includes connecting a plurality of fluid ports to the openings of the plurality of reagent enclosures; applying a solution through the fluid ports to at least partially fill the plurality of reagent enclosures; and cycling a pressure of the cavity, whereby for each of the reagent enclosures, during increasing pressure, the solution enters the internal cavity of the reagent container, combines with the reagent, and compresses the compressible volume, and during decreasing pressure, the compressible volume decreases and the reagent is ejected through the opening.
US11987838B2
Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.
US11987834B2
The present disclosure relates to acetaminophen protein adducts and methods of diagnosing acetaminophen toxicity using the acetaminophen protein adducts.
US11987833B2
The present invention relates to a novel enzyme capable of producing multi-hydroxy derivatives from polyunsaturated fatty acids and a method for producing multi-hydroxy derivatives of polyunsaturated fatty acids using the same.
US11987832B2
Provided herein are compositions, methods, systems associated with propagation and fermentation, and co-products of biochemical production processes, for example, a DCO co-product resulting from converting oil containing grains into bio chemicals via fermentation in the presence of endogenous esterase. The DCO resulting from the processes exhibits lower metal ion content relative to a DCO obtained in the absence of endogenous fermentation with an esterase such as a lipase. The DCO is useful as a feedstock for the production of renewable diesel.
US11987830B2
Provided herein are cell free protein synthesis (CFPS) systems comprising a plurality of ribosomes attached to or encapsulated within a structure, or a plurality of structures, and, optionally, a solid support. Also provided are related kits and uses of the CFPS systems. Methods of producing a protein and methods of treating a disease are provided herein.
US11987827B2
Described herein are compounds and methods for tethering proteins. For example, dimers of proteins, including SOD1 and DJ-1, are described, where the dimers are formed by the covalent bonding of a cysteine on the first monomer to a cysteine on the second monomer via a cyclic disulfide linker. The covalently attached dimers exhibit increased stabilization.
US11987819B2
The subject disclosure features, in one aspect, a method for producing lipids enriched for EPA, comprising modifying a microalga to increase expression of PFA1, and/or PFA3, and culturing the modified microalga under conditions which allow the expression of PFA1, and/or PFA3, wherein lipids enriched for EPA are produced. Also featured is a recombinant microalga in which PFA1, and/or PFA3, is overexpressed. Such recombinant microalgae have been demonstrated herein to produce very favorable fatty acid lipid profiles (e.g., increased levels of EPA, increased ratio of EPA:DHA, decreased levels of DPA n-6, etc.).
US11987818B2
The present application provides engineered polypeptides having imine or oxime reductase activity, polynucleotides encoding the engineered polypeptides, host cells capable of expressing the engineered polypeptides, and methods of using these engineered polypeptides with a range of ketone and amine substrate compounds to prepare secondary and tertiary amine product compounds.
US11987817B2
Disclosed is a process of manufacturing cell spheroids using a bioink. More particularly, provided is a method of manufacturing a cell spheroid, the method including extruding a first bioink including an alginate; extruding a second bioink including cells into the extruded first bioink; adding a calcium chloride (CaCl2) solution to the alginate included in the first bioink; and dissolving the second bioink, present in the first bioink, in a cell culture medium to form a cell spheroid from the cells.
US11987813B2
Human pluripotent stem cells (hPSCs) are promising cell source to produce therapeutic endocrine cells for diabetes treatment. A gel solution made by decellularized tissue-specific extracellular matrix (dpECM) significantly promotes three-dimensional (3D) islet-like organogenesis during induced hPSC differentiation into endocrine lineages. Islet organoids are self-organized even in a two-dimensional (2D) culture mode. Cells derived from hPSCs differentiated on such ECM coated substrates exhibit similar cellular composition to native pancreatic islets. These cells express islet signature markers insulin, PDX-1, C-peptide, MafA, glucagon, somatostatin, and pancreatic polypeptide, and secrete more insulin in response to glucose level compared to a traditional matrix substrate (Matrigel). The dpECM facilitates generating more C-peptide+/glucagon− cells rather than C-peptide+/glucagon+ cells. Remarkably, dpECM also facilitated intra-organoid vascularity by generating endothelial cells and pericytes. Furthermore, dpECM niches also induced intra-organoid microvascularization during pancreatic differentiation.
US11987809B2
Methods and compositions for the treatment of a corneal dystrophy in a subject in need thereof are provided. In one aspect, the method includes the step of obtaining a plurality of stem cells comprising a nucleic acid mutation in a corneal dystrophy target nucleic acid from the subject and manipulating the nucleic acid mutation in one or more stem cells of the plurality of stem cells to correct the nucleic acid mutation, thereby forming one or more manipulated stem cells. The manipulated stem cells are isolated and then transplanted into the subject. In some embodiments, the nucleic acid mutation is manipulated using CRISPR system.
US11987808B2
The present invention relates to the field of stem cell biology, in particular the linage specific differentiation of pluripotent or multipotent stem cells. Specifically described are methods to direct the lineage specific differentiation of hiPSC to sensitive neurons or neuronal fibers innervating the human skin, such as neural crest stem cells (NCPCs) and here called peripheral sensory neurons (PSNs) using novel culture conditions. It is also described a method for screening a biological agent in vitro. The PSNs obtained using the methods of the present invention are further contemplated for various uses including, but limited to, use in in vitro tests or disease modelling, such as drug discovery assays, cell therapy on a higher scale, detecting a range of skin irritants and other compounds of interest, for studying skin aging mechanism, and for producing a dermocosmetic product. Also, it is contemplated the use of ligands in vitro for checking the differentiation and/or activation of the PSN cells, produced by the method of the invention, and the PSN cells, produced by the method of the invention.
US11987807B2
Provided herein are methods and compositions relating, in part, to the generation of human progenitor cells committed to the lung lineage and uses of such cells for treatment of lung diseases/disorders or injury to the lung. Whether an adult stem cell can be isolated from human adult lung remains controversial in the art and at present, methods for isolating and using adult lung stem cells from humans lack reproducibility. Thus, the methods and compositions described herein are advantageous over the present state of knowledge in the art and permit the generation of human lung progenitor cells for treatment, tissue engineering, and screening assays.
US11987805B2
A genetically modified mammalian cell and genetically modified mammalian cell line comprise a recombination sequence inserted in a target locus on a chromosome of the mammalian cell genome, wherein the recombination sequence comprises Bxb1attB sequence from Mycobacterium smegmatis. A transgenic mammalian cell and transgenic mammalian cell line comprise a heterologous nucleic acid stably integrated in a target locus on a chromosome of the mammalian genome, wherein the heterologous nucleic comprises a heterologous gene configured for expression by the transgenic mammalian cell.
US11987804B2
The present application relates to, inter alia, compositions including proteins for expression in host cells to render them resistant to rapamycin. The application further relates to methods of using the proteins, cells, and compositions disclosed therein for modulating cell signaling and for selective expansion of cells.
US11987803B2
In various embodiments, method and devices for delivering large cargos (e.g., organelles, chromosomes, bacteria, and the like) into cells are provided. In certain embodiments method of delivering a large cargo into eukaryotic cells, are provided that involve providing eukaryotic cells disposed on one side of a porous membrane; providing the cargo to be delivered in a solution disposed in a reservoir chamber on the opposite side of the porous membrane; and applying pressure to the reservoir chamber sufficient to pass the cargo through pores comprising said porous membrane wherein said cargo passes through cell membranes and into the cells.
US11987797B2
The present disclosure belongs to the technical field of biology, and in particular relates to an attenuated strain of African swine fever virus (ASFV) with IPTG-induced deletion of a D1133L gene and use thereof. In the present disclosure, it is firstly found that the D1133L protein of ASFV can inhibit production of IFN-β and downstream cytokines ISG-15 and ISG-56, and can be used as an immunosuppressant with a relatively strong immunosuppressive effect. In addition, the attenuated strain of ASFV with IPTG-induced deletion of the D1133L gene is constructed. Specifically, a screening expression cassette is inserted into a position before the non-structural protein gene D1133L of the ASFV using an Escherichia coli lac operator-repressor system, to obtain a recombinant virus. In the presence of the IPTG, the recombinant virus has similar characteristics to a wild-type virus; and in the absence of the IPTG, the expression of the D1133L protein is inhibited.
US11987793B2
A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
US11987790B2
Embodiments disclosed herein provide a general, scalable, high-throughput, and high-resolution approach for experimental dissection of regulatory regions and driver nucleotides in the context of human biology and disease. Applicants present HiDRA, a novel high-resolution global screen for transcriptional regulatory activity in accessible chromatin regions, enabling high-efficiency, high-throughput, and high-resolution inference of regulatory activity.
US11987784B2
The present application is directed to a sampling system for sampling a fluid from a vessel, where the sampling system includes a sterile dispenser assembly operatively connected to the vessel, the sterile dispenser assembly including a valve operatively connected to the vessel, a membrane, and a needle, and a detachable sterile sampling container assembly operatively connected to the sterile dispenser assembly, the detachable sterile sampling container assembly including a sampling container, a membrane attached to the sampling container, and a sampling container housing enclosing the sampling container, where the sampling container housing includes a compressible portion having a deflated configuration and an expanded configuration.
US11987780B2
Described herein is functionalized glass allowing for robust attachment of extracellular matrix proteins (ECM) withstanding extended culturing periods. By first treating glass with a sulfur silane reagent, the treated glass can be activated via an amine-sulfur linker, after which ECM proteins are attached to the linker. The Inventors observed that this glass treatment combination (sulfur silane-linker-ECM) resisted degradation when compared to conventional surface coatings, such as poly-L-orthinine coated glass.
US11987763B2
Some variations provide a process for producing biocarbon pellets, comprising: pyrolyzing a biomass-containing feedstock in a first pyrolysis reactor to generate a first biogenic reagent and a pyrolysis vapor; introducing the pyrolysis vapor to a separation unit, to generate a pyrolysis precipitate in liquid or solid form; contacting the first biogenic reagent with the pyrolysis precipitate, thereby generating an intermediate material; pelletizing the intermediate material, to generate intermediate pellets; optionally, drying the intermediate pellets; separately pyrolyzing the intermediate pellets in a second pyrolysis reactor to generate a second biogenic reagent and a pyrolysis off-gas; and recovering the second biogenic reagent as biocarbon pellets. Some variations provide a similar process that utilizes a carbon-containing condensed-matter material, which is not necessarily a pyrolysis precipitate. The disclosure provides improved processes for producing biocarbon compositions, especially with respect to carbon yield and biocarbon properties, such as reactivity.
US11987757B2
Described herein are processes for hydroisomerising an unconventional feedstock using a hydroisomerisation catalyst comprising zeolite SSZ-91, zeolite SSZ-32, or zeolite SSZ-32x to provide a diesel fuel.
US11987753B2
Apparatus for treating a wetted proppant including a device to estimate fraction of water in a wetted proppant feed of a frac proppant processing plant; a system for determining an environmental temperature at which the wetted proppant will be exposed to in the frac proppant processing plant or in storage holding an output from the frac proppant processing plant; and an additive system to apply a freezing point suppression additive to the wetted proppant in proportion to the fraction of water such that a mixture of the wetted proppant plus the freezing point suppression additive does not solidify at the environmental temperature. Also, a method for treating a wetted proppant.
US11987752B2
A method of inhibiting corrosion of metal during acid stimulation of an oil and gas well that involves treating the oil and gas well with an acidic treatment fluid that includes 10 to 28 wt. % of an acid, based on a total weight of the acidic treatment fluid, and a corrosion inhibitor composition containing gelatin, wherein the gelatin is present in the acidic treatment fluid in a concentration of 0.1 to 10% by weight per total volume of the acidic treatment fluid.
US11987751B2
A method of treating a subterranean formation by contacting the formation with the following: (a) ammonium compound; (b) an oxidizing agent selected from a perchlorate or a nitrite or combinations thereof; and (c) sulfamic acid.
US11987745B2
Solvent mixtures for downhole elemental sulfur removal and formation stimulation, and methods for utilizing such solvent mixtures, are described herein. One method includes providing a solvent mixture that includes an elemental sulfur solvent fraction and an odorant fraction that includes a lactate ester solvent. The method also includes injecting the solvent mixture into a hydrocarbon well such that the elemental sulfur solvent fraction of the solvent mixture dissolves elemental sulfur deposited on well components, and contacting the solvent mixture with water such that the lactate ester solvent within the odorant fraction reacts with the water to generate lactic acid. The method further includes stimulating a formation through which the hydrocarbon well extends by flowing the solvent mixture including the lactic acid through the hydrocarbon well and into the formation.
US11987741B2
The present disclosure provides a method of biocementation comprising contacting a granular, cohesionless soil with a solution, wherein the solution comprises urea, urease, a source of calcium ions, and a source of non-urease proteins, wherein the urea, urease, source of calcium ions, and source of non-urease proteins are provided in effective amounts suitable to cause crystallization of calcium carbonate.
US11987740B2
Provided are a silicon nitride film etching composition, a method of etching a silicon nitride film using the same, and a manufacturing method of a semiconductor device. Specifically, a silicon nitride film may be highly selectively etched as compared with a silicon oxide film, and when the composition is applied to an etching process at a high temperature and a semiconductor manufacturing process, not only no precipitate occurs but also anomalous growth in which the thickness of the silicon oxide film is rather increased does not occur, thereby minimizing defects and reliability reduction.
US11987736B2
Embodiments of the present disclosure provide a quantum dot ligand, a quantum dot material, and a quantum dot light emitting device. In a quantum dot ligand of general formula (I), n is 1, 2, 3, or 4; two of X, Y, and Z are G1 group and G2 group, respectively, and the remaining one is selected from the group consisting of G1 group, G2 group, and hydrogen, wherein the G1 group, for each occurrence, is independently selected from —(CH2)m-L-(CH2)n—R1, wherein R1 is a coordination group, m is 0 to 6, n is 0 to 6, and L is a divalent group or absent; the G2 group, for each occurrence, is independently selected from a C4-20 alkyl having a carbon chain with more than 4 carbon atoms.
US11987734B2
The present disclosure provides an anti-PID encapsulation adhesive film, a photovoltaic module, and a photovoltaic module manufacturing method. The anti-PID encapsulation adhesive film includes a base adhesive film layer, an insulating layer, and a conductive layer. The insulating layer is located on one side surface of the base adhesive film layer. The insulating layer has a grid structure. The grid structure includes grid lines and a plurality of hollow portions defined by the grid lines. The grid lines have a structure corresponding to gaps between cell pieces. The conductive layer includes a plurality of conductive portions. The conductive portions are arranged in the hollow portions in one-to-one correspondence. The volume resistivity of the conductive portions is less than 100 Ω·cm.
US11987732B2
A polarizing plate includes: a polarizer and an optical film, in which the optical film is laminated on at least one surface of the polarizer with an adhesive containing at least one or more polymerizable compounds, and the at least one or more polymerizable compounds are not substantially infiltrated into the optical film.
US11987731B2
A curable organopolysiloxane composition is provided which forms a pressure sensitive adhesive (PSA) layer having a low storage elastic modulus (G′), excellent curability, and sufficient adhesion, along with applications thereof. A PSA layer-forming organopolysiloxane composition comprises: (A) a chain organopolysiloxane having alkenyl groups; (B) an organopolysiloxane resin wherein the weight average molecular weight (Mw) thereof is less than 4500 and the sum of the content of hydroxyl groups, etc. is 9 mole % or less; (C) an organohydrogenpolysiloxane; and (D) a hydrosilylation reaction catalyst; and optionally, (A′) a chain organopolysiloxane which does not contain a carbon-carbon double bond-containing reactive group in the molecule. The mass ratio of the organopolysiloxane resin (B) to the chain organopolysiloxane (A) is within a specific range and the shear storage elastic modulus G′ at −20° C. of a PSA layer obtained by curing the composition is within a range of 0.01 to 1.0 MPa.
US11987726B2
The present disclosure relates to agents, compositions, and methods for inhibiting corrosion in various substrates, for example in metal substrates. The present disclosure also relates to compositions for inhibiting corrosion comprising at least one organic heterocyclic compound and at least one metal salt or mixed metal salt selected from rare earth, alkali earth and transition metals.
US11987721B2
A heat shielding member includes a base, and a heat shielding membrane on the base. The heat shielding membrane includes a porous layer including at least a closed pore. The porous layer includes resin and carbon-based filler. The heat shielding member has both of low thermal conductivity and low heat capacity and improves the fuel economy performance.
US11987717B2
A low temperature sinterable copper nanoparticle or nanowire, comprising gold, zinc, nickel, tin, or aluminum as an alloying metal, and a capping agent. The nanoparticles or nanowires may be deposited on porous or fibrous substrates, the capping agent desorbed, and sintered at low temperature to form conductive traces or sensing elements. The nanoparticles or nanowires may be deposited by aerosol jet, inkjet or dispenser printers, for example.
US11987695B2
A resin composition for forming a magnetic member of the present invention, which is used for compression molding, includes a thermosetting resin, magnetic particles, and non-magnetic particles having a lower specific gravity and a smaller cumulative 50% particle diameter D50 than the magnetic particles, in which the resin composition for forming a magnetic member is solid at 25° C.
US11987694B2
Disclosed herein are compositions comprising polysaccharide particles with an average size of about 0.1-10 mm. These particles comprise at least (i) about 50%-90% by weight water or an aqueous solution, and (ii) about 10%-50% by weight insoluble alpha-glucan, or an insoluble cationic ether thereof, comprising alpha-1,3-glycosidic linkages and having a weight-average degree of polymerization (DPw) of at least about 100. Further disclosed are methods of preparing these compositions, as well as systems for storing and/or moving them.
US11987688B2
A photocurable composition including the following components (A) to (D), (A) a monomer having one (meth)acryloyl structure, (B) a crosslinking agent having two or more (meth)acryloyl structures, (C) an inorganic ultraviolet-blocking agent having a 50% volume cumulative particle size of 1 to 50 nm, and (D) a photopolymerization initiator in an amount of 0.05 to 1 part by weight, relative to total 100 parts by weight of components (A) and (B), wherein a part or all of component (A) is a hydrophilic monomer, and a content of the hydrophilic monomer is 70% by weight or more, relative to the total weight of components (A) and (B).
US11987681B2
An anion exchange membrane is provided by converting carbon-carbon double bonds in the backbone of polystyrene-block-polybutadiene-block-polystyrene (SBS) into epoxide groups. Unmodified SBS is first partially hydrogenated to remove about 65% to about 90% of carbon-carbon double bonds. The remaining double bonds are then converted to epoxide groups to form an epoxidized SBS. UV-initiated ring opening reactions between the epoxidized SBS and haloalkyloxiranes are then employed to simultaneously functionalize and crosslink the epoxidized SBS. The halide groups in the crosslinked polymer network can be replaced via nucleophilic substitution to offer anion conductivity, e.g., via reaction with trimethylamine. Further ion exchange reactions can then be performed to make the membrane hydroxide conductive. The crosslinked membranes described herein exhibit a mechanical strength improvement of 200% compared to unmodified SBS, while maintaining high hydroxide conductivity. This synthetic platform is advantageous to provide mechanically robust anion exchange membranes for fuel cell applications.
US11987677B2
A mechanically and piezoelectrically anisotropic polymer thin film is formed from a crystallizable polymer and an additive configured to interact with the polymer to facilitate chain alignment and, in some examples, create a higher crystalline content within the polymer thin film. The polymer thin film and its method of manufacture may be characterized by a bimodal molecular weight distribution where the molecular weight of the additive may be less than approximately 5% of the molecular weight of the crystallizable polymer. Example polymers may include vinylidene fluoride, trifluoroethylene, chlorotrifluoroethylene, hexafluoropropylene, and vinyl fluoride. Example additives may occupy up to approximately 60 wt. % of the polymer thin film. The polymer thin film may be characterized by a piezoelectric coefficient (d31) of at least approximately 5 pC/N or an electromechanical coupling factor (k31) of at least approximately 0.1.
US11987669B2
The present disclosure provides compositions, articles thereof, and methods of forming compositions. In at least one aspect, a composition includes (1) an epoxy, (2) an amino or amido hardener, (3) a polyaniline, (4) a dopant selected from a triazolyl, a thiazolyl, a quinolinyl, a salicylate, a benzoate, a glycolate, a phosphate, a sulfonate, an oxalate, or combination(s) thereof; and (5) a pigment selected from titanium dioxide, silica, talc, mica, aluminium stearate, or combination(s) thereof. The polyaniline+dopant comprises greater than 6 wt %, by weight of the composition. In at least one aspect, a method includes introducing an acid form of a polyaniline to a hydroxide to form a polyaniline hydroxide. The method includes introducing a dopant to the polyaniline hydroxide to form a doped polyaniline.
US11987666B2
Disclosed are a thermoplastic resin composition and a molded product including the same, and based on 100 parts by weight of a base resin including (A) 70 wt % to 90 wt % of a polybutylene terephthalate resin and (B) 10 wt % to 30 wt % of an acrylate-based graft copolymer, the thermoplastic resin composition includes: (C) 1 part by weight to 5 parts by weight of an epoxy group-containing methacrylate-aromatic vinyl-unsaturated nitrile copolymer; (D) 15 parts by weight to 20 parts by weight of a carbon fiber; (E) 1 part by weight to 5 parts by weight of carbon nanotubes; and (F) 18 parts by weight to 20 parts by weight of aluminum diethyl phosphinate (ADEP).
US11987665B2
The present invention provides a novel polymer comprising repeating unit represented by the following Chemical Formula 1, and an organic light emitting device including the same: Wherein L1, L2, Ar1, Ar2, Ar3, R1 to R8, o, p and n are described herein.
US11987661B2
The present invention relates to new modified polymer polyols comprising at least one polyol and a stable dispersion of polymeric particles in the at least one polyol. The dispersed polymeric particles having a high content of P and N. There are also disclosed processes for the preparation of the herein described modified polymer polyols, and processes for preparing polyurethane materials containing them.
US11987656B2
To provide a method for producing a fluorinated polymer, in which it is possible to efficiently and easily control the molecular weight to be proper when polymerizing a perfluoromonomer having a dioxolane ring containing a polymerizable double bond in the ring skeleton, and in which the obtainable fluorinated polymer is less susceptible to a decrease in molecular weight even when contacted with a base. A method for producing a fluorinated polymer, comprising polymerizing a raw-material mixture which contains at least one of a monomer composition M11 which comprises a perfluoromonomer represented by the formula m11 and a fluorinated monomer m11H having at least some of fluorine atoms of said perfluoromonomer substituted by hydrogen atoms, and a monomer composition M12 which comprises a perfluoromonomer represented by formula m12 and a fluorinated monomer m12H having at least some of fluorine atoms of said perfluoromonomer substituted by hydrogen atoms, wherein the total amount of the fluorinated monomer mil H and the fluorinated monomer m12H is from 10 to 1,100 ppm to the total amount of the monomer composition M11 and the monomer composition M12.
US11987651B2
A catalyst composition and a method for preparing a hydrocarbon resin using the same are disclosed herein. In some embodiments, a catalyst composition includes an oxonium ion-based catalyst and an additive. In some embodiments, a method includes polymerizing a monomer mixture in the presence of a catalyst composition, wherein the monomer mixture comprises a C5 unsaturated hydrocarbon monomer, a C9 unsaturated hydrocarbon monomer, or a mixture thereof, wherein the catalyst composition comprising a catalyst represented by the following Formula 1 and an additive represented by the following Formula 2.
US11987632B2
The present invention generally relates to antibodies that bind to HLA-A2/MAGE-A4, including multispecific antibodies e.g. for activating T cells. In addition, the present invention relates to polynucleotides encoding such antibodies, and vectors and host cells comprising such polynucleotides. The invention further relates to methods for producing the antibodies, and to methods of using them in the treatment of disease.
US11987627B2
The present disclosure relates to the technical field of antibody drugs, and in particular, to an anti-CD47 antibody or an antigen-binding fragment thereof, a pharmaceutical composition comprising the anti-CD47 antibody or the antigen-binding fragment thereof, and applications thereof. The anti-CD47 antibody or the antigen-binding fragment thereof has significant antitumor activity and high affinity with human CD47 protein, can eliminate the capability of SIRPa to bind to CD47 on a surface of a cell, and does not have significant hemoagglutination activity and thus can be applied to the preparation of an anti-tumor drug.
US11987623B2
The invention provides novel compositions of antibodies based on liquid vehicles selected from semifluorinated alkanes. The use of these vehicles provides for improved stability and shelf-life of antibodies and their derivatives. The compositions are useful for topical administration or for parenteral injection.
US11987621B2
The present invention provides antibodies or antibody fragments binding to human IL-17C. In particular, it relates to antibodies or antibody fragments that have combined beneficial properties and are therefore useful for the treatment of humans having, for example, atopic dermatitis or psoriasis.
US11987620B2
Methods of treating a subject suffering from an autoimmune disease, disorder, or condition with an alternative to anti-TNF therapy.
US11987613B2
Provided are isolated TCRs, TCR-like molecules, and portions thereof that bind to phosphopeptide-HLA-A2 complexes. The isolated TCRs, TCR-like molecules, or portions are optionally soluble TCRs, TCR-like molecules, or portions. Also provided are isolated nucleic acids encoding the disclosed TCRs, TCR-like molecules, or portions; host cells that contain the disclosed TCRs, TCR-like molecules, or portions; pharmaceutical compositions that include the disclosed TCRs, TCR-like molecules, portions, nucleic acids, and/or T cells; kits; and methods of using the same.
US11987606B2
The disclosure features compounds comprising an antigen portion, a soluble Major Histocompatibility Complex (MHC) molecule portion (e.g., all or an antigen-binding portion of a soluble MHC class I molecule), and a dynamic anchor portion (e.g., an agent, such as Annexin V, that binds to phosphatidylserine). The featured compounds are useful for a variety of therapeutic applications, including, e.g., enhancing a T cell response to an antigen of interest or enhancing a T cell-driven immune response by a subject to an antigen of interest (e.g., a cancer antigen or a microbial antigen).
US11987604B2
A fusion protein, a nanoparticle composed by a plurality of monomers of said fusion protein, and uses thereof. A fusion protein based on the heavy chain of human ferritin is de-scribed, which includes at the N terminus of the protein at least one metalloproteinase cleavage sequence and a modified PAS polypeptide that acts as a masking polymer that in-creases the protein drug stability, as well as a nanoparticle composed of multiple monomers of said fusion protein, a nucleic acid encoding for said fusion protein, and diagnostic and therapeutic applications thereof.
US11987603B2
Nucleotide sequences are disclosed that encode novel chimeric insecticidal proteins exhibiting Lepidopteran inhibitory activity. Particular embodiments provide compositions and transformed plants, plant parts, and seeds containing the recombinant nucleic acid molecules encoding one or more of the chimeric insecticidal proteins.
US11987599B2
Disclosed herein are embodiments of a solid support suitable for synthesizing nucleic acid sequences. The solid support may have a structure according to Formula I, where CPG is controlled pore glass, and m, n, x, y, R1 and R2 are as defined herein. Also disclosed are methods for making and using the solid support, kits including solid support, and a universal linker phosphoramidite suitable for use in the solid support.
US11987598B2
Methods and compositions using E-selectin antagonists are provided for the treatment and prevention of diseases and disorders treatable by inhibiting binding of E-selectin to an E-selectin ligand. Described herein are E-selectin antagonists including, for example, glycomimetic compounds, antibodies, aptamers and peptides that are useful in methods for treatment of cancers, and treatment and prevention of metastasis, inhibiting infiltration of the cancer cells into bone marrow, reducing or inhibiting adhesion of the cancer cells to endothelial cells including cells in bone marrow, and inhibiting thrombus formation.
US11987592B2
Provided is a compound of Chemical Formula 1: wherein: A is a benzene ring; X1 and X2 are each independently O or S; Y1 to Y3 are each independently N or CH, provided that at least one of Y1 to Y3 is N; Ar1 and Ar2 are each independently a substituted or unsubstituted: C6-αaryl or C2- 60 heteroaryl containing at least one of N, O, and S; R1 to R3 are each independently hydrogen, deuterium, halogen, cyano, nitro, amino, or a substituted or unsubstituted: C1-60 alkyl, C3-60 cycloalkyl, C2-60 alkenyl, C6-60 aryl, or C2-60 heteroaryl containing at least one of N, O, and S; and R∝and R5 are each independently hydrogen, deuterium, halogen, cyano, nitro, amino, or a substituted or unsubstituted: C1-60 alkyl, C3-αcycloalkyl, C2-60 alkenyl, C6-60 aryl, or C2-60 heteroaryl containing at least one of N, O, and S, and an organic light emitting device including the same.
US11987591B2
Provided are salts of (S)-(4,5-dihydro-7H-thieno[2,3-c]pyran-7-yl)-N-methylmethanamine and various of crystal forms thereof, and compositions, medicaments, pharmaceutically acceptable formulations thereof, and methods of making same. In addition, provided are compounds comprising specific particle size distributions of crystalline (S)-(4,5-dihydro-7H-thieno[2,3-c]pyran-7-yl)-N-methylmethanamine HCl and methods of making and modulating the particle size distributions.
US11987581B1
Novel imidazo[1,2-c]pyrido[3,4-e]pyrimidine-2-carboxylic acid compounds, a method of synthesizing said compounds, a pharmaceutical composition comprising said compounds and a suitable carrier, and a method of using the compounds. The imidazo[1,2-c]pyrido[3,4-e]pyrimidine-2-carboxylic acid compounds, identified as CK2 inhibitors, are useful as anticancer and/or antitumor agents, and as agents for treating other kinase-associated conditions including inflammation, pain, and certain immunological disorders, and other types of diseases such as diabetes, viral infection, neurodegenerative diseases.
US11987578B1
A 7-(4-((5-(2-chlorobenzylideneamino)-2-thioxo-1,3,4-thiadiazol-3(2H)-yl)methyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid compound, its synthesis, and its use as an anticancer and/or anti-inflammatory agent.
US11987573B2
Compounds of formula (I), and related aspects.
US11987571B1
A ethyl 2-[9-(6-chloro-2-hydroxyquinolin-3-yl)-3,6-diphenyl-1,8-dioxo-3,4,9,10-tetrahydroacridine-10-yl]-acetate compound, its synthesis, and its use as an antimicrobial agent.
US11987570B1
An 10-(2-hydroxyethyl)-9-(2-hydroxypyridin-3-yl)-3,4,6,7,9,10-hexahydroacridine-1,8(2H,5H)-dione compound, its synthesis, and its use as an antimicrobial agent.
US11987569B2
The invention relates to imidazoquinoline derivatives and to pharmaceutical compositions containing the imidazoquinoline derivatives. The imidazoquinoline derivatives of the invention are useful as toll-like receptor agonists, in particular agonists of TLR7, and promote induction of certain cytokines.
US11987566B2
The present invention provides a novel compound for effectively preventing nerve damage and protecting nerves, and a preparation method thereof. Besides, the present invention also provides a pharmaceutical composition comprising the novel compound, and a use of the novel compound for preventing nerve damage and protecting nerves.
US11987560B2
The present invention relates generally to compositions and methods for treating cancer and neoplastic disease. Provided herein are substituted heterocyclic derivative compounds and pharmaceutical compositions comprising said compounds. The subject compounds and compositions are useful for inhibition of lysine specific demethylase-1. Furthermore, the subject compounds and compositions are useful for the treatment of cancer.
US11987556B2
The present disclosure provides a compound configured to release nitric oxide (NO) and inhibit the activity of a phosphodiesterase (PDE) when administered to a subject. The compound may include L1 and L2. L1 may include a functional group that is part or all of a NO releasing agent. L2 may include a functional group that is part or all of a PDE inhibitor. The compound may further include a bond or a biradical that connects L1 and L2. The present disclosure further provides a method of treating or preventing a disease using the compound or a composition including the compound.
US11987552B2
A phenol compound comprises a phenyl group, a hydroxy group directly bonded to the phenyl group, and at least one polymeric substituent bound to the phenyl group. The polymeric substituent comprises three or more monomers units. A method for producing a polyurethane polymer comprises the steps of (a) providing a polyol; (b) providing a polyisocyanate compound; (c) providing the phenol compound described above; (d) combining the polyol, the polyisocyanate compound, and the phenol compound to produce a reaction mixture; and (e) allowing the polyol and the polyisocyanate compound to react to produce a polyurethane polymer.
US11987548B2
The invention provides methods of preparing 8-hydroxy-2,2,14,14-tetramethylpentadecanedioic acid and methods of making a pharmaceutical material comprising a purified amount of 8-hydroxy-2,2,14, 14-tetramethylpentadecanedioic acid. Also provided are compositions and pharmaceutical materials including a purified amount of 8-hydroxy-2,2,14,14-tetramethylpentadecanedioic acid as well as methods of treating various diseases and conditions using the compositions and pharmaceutical materials.
US11987544B2
Described is an extraction device for extracting compounds from plant material and a method for using such an extraction device. The extraction device comprises an extraction tank receiving plant material and dissolving soluble compounds inside the plant material into a solvent to form a micelle. A series of fluidly connected separation chambers separate purified compounds from the micelle, resulting in purified compounds in each of the separation chambers and solvent. A heat exchanger and a chilled reservoir are used for cooling and storing the solvent. A pump is used for pumping and circulating the solvent into the extraction device. Finally, a control system automatically controls temperature and flow in the extraction device.
US11987541B2
In the embodiments, an aqueous hydrochloric acid solution instead of hydrogen chloride gas and solid triphosgene instead of phosgene gas may be used in the process of preparing a diisocyanate from a diamine through a diamine hydrochloride. In addition, the embodiments provide processes for preparing a diisocyanate composition and an optical lens, which are excellent in yield and quality with mitigated environmental problems by controlling the size of the diamine hydrochloride composition, the b* value according to the CIE color coordinate of the diamine hydrochloride composition, or the content of water in the diamine hydrochloride composition within a specific range.
US11987538B2
Provided is a method for producing a cyclic olefin compound, including a step of producing a cyclic olefin compound by acting a divalent nickel complex represented by General Formula (1) to decarbonylate and decarboxylate an alicyclic dicarboxylic acid anhydride, in which the divalent nickel complex includes at least one specific anionic ligand Y: Ni(Y)m(L)n (1) wherein Ni is divalent nickel, Y is an anionic monodentate or polydentate ligand and has at least one Ni-E covalent bond, E is a heteroatom or a n-bonding group, m is 1 or 2, L is a neutral ligand, and n is a real number of 0 to 6.
US11987532B1
An ion-modified microwave dielectric ceramic is provided and a chemical formula thereof is Zn0.15Nb0.3[Ti1-x(W1/3Zr1/2)x]0.55O2. In the chemical formula, x is in a range of 0.01 to 0.03. The ion-modified microwave dielectric ceramic includes the following components in parts by weight: 12.58-12.67 parts of ZnO, 41.11-41.39 parts of TiO2, 43.93-45.14 parts of Nb2O5, 0.44-1.31 parts of WO3, and 0.35-1.05 parts of ZrO2. A preparation method of the ion-modified microwave dielectric ceramic can be applied to different industrial requirements, such as electronic components, communication equipment, and microwave components; and the obtained ion-modified microwave dielectric ceramic expands a practical value of a Zn0.15Nb0.3Ti0.55O2 series microwave dielectric ceramic in electronic ceramic manufacturing.
US11987527B1
A green concrete comprising: a binder component comprising Portland cement (C), volcanic ash (VA), microsilica (MS) and colloidal nano-silica (CNS); an aggregate component comprising fine aggregates (FA) and coarse aggregates (CA); water (W); and a super plasticizer.
US11987523B2
A hot-formed, chemically prestressable glass article having a low percentage of crystals or crystallites, in particular a plate-shaped, chemically prestressable glass article, as well as to a method and a device for its production are provided. The glass article has a composition including the components SiO2, Al2O3, and Li2O and a content of seed formers (ZrO2, SnO2, and TiO2) of at least 0.8 wt %, as well as at most ten crystals, including crystallites, per kilogram of glass, which have a maximum diameter greater than 1 μm and up to at most 5 μm.
US11987521B2
In order to reduce the degree of relaxation after an optical substrate has been compacted, in particular after a longer period, substrates (51) or reflective optical elements (50), in particular for EUV lithography, with substrates (51) of this type, are proposed. These substrates (51), which have a surface region (511) with a reflective coating (54), are characterised in that, at least near to the surface region (511), the titanium-doped quartz glass has a proportion of Si—O—O—Si bonds of at least 1*1016/cm3 and/or a proportion of Si—Si bonds of at least 1*1016/cm3 or, along a notional line (513) perpendicular to the surface region (511), over a length (517) of 500 nm or more, a hydrogen content of more than 5×1018 molecules/cm3.
US11987516B2
Embodiments of a laminate including a first curved glass substrate comprising a first viscosity (poises) at a temperature of 630° C.; a second curved glass substrate comprising a second viscosity that is greater than the first viscosity at a temperature of 630° C.; and an interlayer disposed between the first curved glass substrate and the second curved glass substrate, are disclosed. In one or more embodiments, the first curved glass substrate exhibits a first sag depth that is within 10% of a second sag depth of the second curved glass substrate. In one or more embodiments, the first glass substrate and the second glass substrate exhibit a shape deviation therebetween of about ±5 mm or less as measured by an optical three-dimensional scanner or exhibit minimal optical distortion. Embodiments of vehicles including such laminates and methods for making such laminates are also disclosed.
US11987510B2
Method and apparatus pertaining to the production of hydrogen sulfide using sodium salts recycle. Sodium sulfate is reacted with a carbon containing stream to produce sodium sulfide and carbon dioxide. The sodium sulfide is blended with elemental sulfur and water. The blend is subjected to elevated temperatures and pressures to result in the production of hydrogen sulfide and sodium sulfate. A mixing apparatus, such as a bubble column reactor, has been found to be especially useful. The hydrogen sulfide can be used for removing metal from effluents.
US11987508B2
A UV reactor for disinfecting water and including a UV source printed circuit board assembly transfers heat to a heat sink in the form of a water facing thermal coupler. The UV source printed circuit board assembly may include a metal clad printed circuit board having a thermal contact region in thermal communication with the heat sink.
US11987504B2
A garnet compound represented by a general formula (I): Ln3In2Ga3-XAlXO12 (I) (in the formula, Ln represents one or more metal elements selected from La, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb and Lu; and X satisfies an expression 0≤X<3).
US11987499B2
The present invention relates to entangled-type carbon nanotubes which have a bulk density of 31 kg/m3 to 85 kg/m3 and a ratio of tapped bulk density to bulk density of 1.37 to 2.05, and a method for preparing the entangled-type carbon nanotubes.
US11987481B2
A hoist attachment which includes a base member; a positioning guide extending from the base member; a positioning member; and an endless sling. The endless sling extends from the base member and cooperates with the positioning guide, the positioning member and the hook member. The hoist attachment remains in position when lifting a load but is easily adjustable when no load is applied. The hoist attachment may be used with the forks of a forklift truck.
US11987473B2
An escalator device includes a plurality of steps, wherein both sides of each step are provided with mounting portions and step wheels rotatably mounted to the mounting portions; step wheel guide rails fixedly arranged on both sides of the escalator device for guiding the step wheels of each step, during the operation of the escalator device, the step wheels of each step move along the step wheel guide rails on both sides respectively; and anti-detachment guide rails arranged on both sides of the escalator device, during the movement of the step wheels of each step along the step wheel guide rails on both sides respectively, the anti-detachment guide rails are located above and spaced apart from anti-detachment portions of each step, a piezoelectric sensor is provided on the surface of the anti-detachment guide rail facing the anti-detachment portion.
US11987472B2
A method of monitoring a direction of motion of a conveyance apparatus within a conveyance system including: detecting a first height at a first time; detecting a second height at a first selected time period prior to the first time; detecting a height change of a conveyance apparatus within the conveyance system in response to the first height and the second height; determining whether the height change is greater than a first selected height change; and determining that the conveyance apparatus is moving in an upward direction when the height change is greater than the first selected height change.
US11987470B2
Sheet collating device for accumulating sheets from at least one hopper, comprising: a lower transport path and an upper transport path; a switchable guide for directing the sheets from the at least one hopper to the lower or the upper transport path; left and right upper drive shafts connected to a right and a left upper drive pulleys supporting a pair of upper belts, a drive direction of the pair of upper belts being changed dependent on what transport path of the upper and lower transport paths is selected; first and second lower drive shafts connected to a right and a left lower drive pulleys supporting first and second pairs of lower belts; and a first series of right paddles mounted on the first pair of lower belts and a first series of left paddles mounted on the second pair of lower belts for registering a collated set of sheets.
US11987469B2
A sheet folding device includes a sheet conveyance path, first and second side plates, a first folding roller pair, a first folding guide, and a guide drive mechanism. The first folding guide is reciprocatable between a folding position and a retracted position, and includes a guide main body and first and second arms provided respectively at both ends of the guide main body. The guide drive mechanism includes a drive source provided on the first side plate, a first drive transmission portion that transmits a drive force of the drive source to the first arm, a second drive transmission portion that transmits the drive force to the second arm, and a drive coupling portion that couples the first drive transmission portion to the second drive transmission portion and transmits the drive force from the first drive transmission portion to the second drive transmission portion.
US11987453B2
A method of automatically moving a dolly apparatus from an initial location to a downstream location is provided. The method includes engaging a component being carried along an elevated conveyor with a synchronization arm of a dolly apparatus such that the dolly apparatus moves with the component. The dolly apparatus includes a base frame and an actuation member movably mounted to the base frame. A synchronization arm is movably mounted to a top of the base frame. The actuation member is operatively connected to the synchronization arm such that actuating the actuation member lowers the synchronization arm to a disengaged position. The actuation member is actuated thereby lowering the synchronization arm to a disengaged position and releasing the component.
US11987451B2
A motorized drive roller conveyor includes an upstream zone and a downstream zone, with each zone having a drive roller, an idler roller that is driven by the drive roller, and a sensor. The upstream zone and the downstream zone are controlled by a card, which measures a gap between a first item on the conveyor and a second item on the conveyor by beginning a counter when a trailing edge of the first item passes the sensor of the upstream zone and stopping the counter when a leading edge of the second item passes the sensor of the upstream zone to generate a counter value. If the first item is stopped in the downstream zone, the card of the upstream zone causes the drive roller of the upstream zone to advance the second item into the downstream zone for a distance derived from the counter value before stopping the transportation of the second item.
US11987442B2
A collapsible storage system for flowable material, for example granular material, includes a base frame and an upper frame which is movable between a collapsed position and a working position spaced above the collapsed position. A plurality of storage silos are supported in a row, each including a hopper discharge cone on the base frame and a collapsible tubular wall assembly connected between the discharge cone and the upper frame. Redundant loading conveyors are provided in communication with the silos across the upper frame for loading and redundant unloading conveyors are provided in communication with the silos across the base frame.
US11987441B2
A storage facility. The facility comprises a plurality of load-bearing containers located at a single facility. The facility further comprises a climate controlled enclosure comprising a skin and providing a volume around the plurality of load-bearing containers. The climate controlled enclosure further comprises a ceiling above and positioned to shield an uppermost level of the plurality of load-bearing containers from outdoor environmental exposure.
US11987437B1
A beverage insulator includes a first portion adapted to insulate a first surface of beverage container, and an attachment point arranged to attach the beverage insulator to an apparatus when the beverage insulator is not in use. The attachment point may include a slit that is adapted to stretch over the handle of a cooler, thereby attaching the beverage insulator to the cooler. The beverage insulator may be adapted to remain substantially flat when attached to the cooler, thereby providing an area for branding or other display.
US11987432B2
The invention provides a device (900) for containing a liquid or semi-liquid cosmetic or pharmaceutical product, the device comprising: a closure (902) comprising a product withdrawing conduit; a rigid container (901) having a first means for engaging with the closure, thereby closing the container; and a cartridge (905) enclosed within the rigid container, the cartridge having a second means for engaging with the closure, thereby forming a substantially airtight seal between the cartridge and the closure; wherein the cartridge comprises a biodegradable or recyclable rigid outer (906) enclosing a collapsible liner (907), the collapsible liner defining a cavity for containing the product, wherein the product withdrawing conduit extends inside the cavity. Also related methods, products and kits.
US11987431B2
A top-opening substrate carrier comprises a container body, a door member and at least one latching mechanism. The latching mechanism includes a rotary drive member, a first driven cam, a second driven cam, a first connecting rod, a second connecting rod, two longitudinal latching arms and two lateral latching arms. The first driven cam and the second driven cam are disposed at two sides of the rotary drive member. When the rotary drive member is rotated by force, it links and activates the first connecting rod and the second connecting rod to synchronously drive the first driven cam and the second driven cam to rotate, thereby driving the two longitudinal latching arms and the two lateral latching arms to project towards locking holes of the container body and locked, or retract from the locking holes of the container body and unlocked.
US11987420B2
A packaging assembly for a home appliance includes a base frame including a first plank and a second plank provided parallel to the first plank, and a pair of spring clips attached to the base frame. The pair of spring clips includes a right spring clip attached to a top surface of the first plank, and a left spring clip attached to a top surface of the second plank, wherein an axial extension direction of the right spring clip is parallel to an axial extension direction of the left spring clip, and wherein the pair of springs are configured to selectively accept a base rail of the home appliance therein.
US11987418B2
A folded post support system for supporting a pallet, comprising a hollow elongated enclosure and an insert disposed with the interior of the enclosure. The insert is made from a hollow cylindrical structural post that has been folded in an accordion fashion to form a series of post segments. Each post segment is connected to at least one adjacent post segment along a living hinge.
US11987410B2
A sterile procedure for the filing of solids into pharmaceutical containers and the sealing thereof under sterile conditions is provided. Exemplary containers include syringes, vials, capsules, ampoules, single-dose devices or cartridges. The containers can be filled with powder, granules, nanoparticles or microparticles. After sealing, the containers are airtight. More specifically, the procedure minimizes adherence of those solids to the interior surfaces of the containers during the filling and sealing steps, thus ensuring airtightness of the seal and precision of the weight of the solid dispensed into the containers.
US11987408B2
A component mounting system including: a component mounting device group in which a plurality of component mounting devices that mount components supplied to a board transported in from an upstream side by a tape feeder and transport out the board to a downstream side, and cut a carrier tape after supplying the components by a cutter device and discharge scraps of carrier tape, are installed on a floor surface while being arranged in a direction of conveying the board; a main conveyor that is installed along an arrangement direction of the plurality of component mounting devices in a region on the floor surface under the component mounting device group, and transports the scraps of carrier tape discharged from each of the plurality of component mounting devices; and a scraps storage that is installed outside the region and stores the scraps of carrier tape transported by the main conveyor.
US11987399B2
An offshore rocket transport and launch method includes S1: assembling a rocket horizontally; S2: loading the assembled rocket as a whole into a transport cage; S3: transporting, by a transport vehicle, the transport cage loaded with the rocket to a wharf by land horizontal transport; S4: transferring the transport cage loaded with the rocket to a transport ship, and transporting the transport cage loaded with the rocket to an offshore rocket launch pad by sea transport; S5: hoisting, by a hoisting device, the transport cage loaded with the rocket to the rocket launch pad; S6: opening the transport cage, transferring the rocket to a launching position, and hoisting the transport cage away from the rocket launch pad; and S7: launching the rocket. The method effectively facilitates the offshore rocket transport and launch process, and prevents the rocket from being affected by the external environment during the launch process.
US11987398B2
Method and apparatus to efficiently launch spacecraft from underwater. Unfortunately, the prior art processes of launching spacecraft from sea either make no use of water buoyancy or waste use rocket fuel to overcome water resistance. As a result, payloads are smaller than are ideal. The instant invention however adds water buoyancy to increase the overall thrust of the spacecraft and therefore makes the spacecraft more efficient than if launched outside of water.
US11987392B2
A method and apparatus for the control of the attitude of earth orbiting satellites and the orbit and attitude control of a novel gravitational wave detection satellite configuration located near the sun-earth Lagrangian points L3, L4 and L5, utilizing the control of solar radiation pressure by the use of electrically controllable variable reflection glass panels to provide the torques and forces needed.
US11987387B2
An aerial vehicle electrical power system for use with a tethered aerial vehicle, and related methods are provided. The aerial vehicle electric power system includes a plurality of light-emitting diodes (LED) carried by an aerial vehicle. At least one electrical circuit is carried by the aerial vehicle. The at least one electrical circuit has a DC buck converter electrically in series with at least a portion of the plurality of LEDs. A tether is connected between the aerial vehicle and a power source positioned remote from the aerial vehicle. Electrical power is transmitted to the aerial vehicle and at least a portion of the plurality of LEDs through the tether. The electrical circuit minimizes variances in power supplied to the aerial vehicle and the plurality of LEDs.
US11987386B2
A baggage drop system is disclosed for depositing and checking of baggage into airline flights. The baggage drop system can include a substantially horizontal frame member. The frame member can be mounted above a first conveyor equipped with a static or dynamic weighting scale. The frame member can also be mounted away from an end of the first conveyor at a distance from an upper surface of the first conveyor substantially equal to a maximum allowable height of baggage thereby forming a physical barrier for oversized baggage. A computer can be configured to compare an output of the weighing scale with allowable baggage weights.
US11987377B2
Aircraft propulsion systems include aircraft systems having at least one hydrogen tank and an aircraft-systems heat exchanger and engine systems having at least a main engine core, a high pressure pump, a hydrogen-air heat exchanger, and a turbo expander. The main engine core includes a compressor section, a combustor section having a burner, and a turbine section. Hydrogen is supplied from the at least one hydrogen tank through a hydrogen flow path, passing through the aircraft-systems heat exchanger, the high pressure pump, the hydrogen-air heat exchanger, and the turbo expander, prior to being injected into the burner for combustion. The turbo expander includes a rotor separated into a first expander portion and a second expander portion arranged about an output shaft and the output shaft is operably connected to a generator configured to generate electrical power.
US11987373B2
A latch mechanism is disclosed. In various embodiments, the latch mechanism includes a T-bolt body and a T-bolt comprising a longitudinal rod extending in a longitudinal direction from the T-bolt body and a transverse rod disposed at an end of the longitudinal rod. A safety keeper defining a load slot may be configured to receive the transverse rod whereby the T-bolt is configured to secure the T-bolt body with respect to the safety keeper.
US11987372B2
An assembly including a nacelle element, such as a cover, a device for locking the nacelle element, a key for locking/unlocking the locking device and an indicator for indicating the position of the locking device. This assembly includes a control device which is configured to be actuated by the key when the key is withdrawn from the locking device so as to make the indicator move from a first state to a second state, the state of the indicator being representative of the locked or unlocked position of the locking device.
US11987365B2
A device for attaching an object to an attachment rail, particularly a seat rail, in an aircraft or spacecraft. A base part has a support surface to be placed onto an outer surface of the rail, and a locking element to partially protrude from the support surface along a line of protrusion. The base part and locking element are coupled or configured to be coupled wherein the locking element can be moved relative to the base part along the line of protrusion and rotated with respect to the base part. An end section of the locking element has a tip portion shaped in a dovetail-type manner. The device includes a tensioning arrangement for tensioning the locking element with respect to the rail. An arrangement includes such a device as well as an attachment rail with a rail main body and a plurality of bushes. A method for attaching an object, and a seat rail are disclosed.
US11987362B2
A system and a method for securing and stabilizing one or more galley carts within a stowage compartment within an internal cabin of a vehicle include one or more dampers configured to be secured to one or more surfaces of the stowage compartment. The one or more dampers are configured to exert a spring force into the one or more galley carts to stabilize the one or more galley carts between the one or more dampers and one or more other surfaces of the stowage compartment.
US11987341B2
A controller for a watercraft changes a rudder angle of a marine propulsion device by controlling a steering actuator based on a target yaw rate. The controller determines which of rightward turning and leftward turning is being made by the watercraft. The controller imposes a limitation on the leftward target yaw rate when the rightward turning is being made by the watercraft. The controller imposes a limitation on the rightward target yaw rate when the leftward turning is being made by the watercraft.
US11987324B2
A rear derailleur includes a base member mountable to a bicycle frame, a movable member movably coupled to the base member, and a pivot member rotatably coupled to the movable member. The rear derailleur also includes a chain guide assembly rotatably connected to the movable member via the pivot member. The rear derailleur includes a damper device disposed within the movable member. The damper device is operable to apply a damping force to the chain guide assembly when the chain guide assembly rotates. The damper device includes a friction member having a friction surface. A first portion of the friction surface is in frictional engagement with the pivot member, and a second portion of the friction surface is in frictional engagement with the movable member. The friction device is disposed within the movable member at a distance relative to the biasing device in an axial direction along the pivot member.
US11987319B2
A crank quick-connection structure is used for connecting a crank with a main shaft, and includes an adapter and a connecting assembly. The adapter is connected to the main shaft, one end of the crank is provided with a cooperating cavity extending in a thickness direction thereof, and the adapter penetrates the cooperating cavity from one end of the cooperating cavity. The connecting assembly is connected to the adapter, and the connecting assembly has a locking position and a releasing position. In the locking position, the crank cooperates with the connecting assembly so that the cooperating cavity and the adapter are locked and connected; and in the releasing position, the crank is disengaged from the connecting assembly so that the crank can be disengaged from the adapter in an axial direction of the adapter.
US11987312B2
A fluid device for a bicycle may be provided to vent fluid from a hydraulic chamber of a seating component such as an adjustable seating assembly for a bicycle. The fluid device may be operable to vent a compressible fluid or a mixed combination flow of compressible and non-compressible fluids in a metered volume. The fluid device may recycle fluids preferentially.
US11987306B2
A system for modifying the range capability of an electric vehicle includes a vehicle body having a front axle and a rear module secured to the vehicle body. The rear module includes a rear axle and the rear module is detachable from the vehicle body and replaceable with another rear module. The rear modules may include different range extension capabilities. The rear modules may include a battery or a combustion engine that may supplement the standard battery and electric motor of the vehicle. A pair of laterally translatable pins of the rear module may be moveable into and out of engagement with the vehicle body. The rear module may also include vertically extending posts that engage with the vehicle body. The vehicle body may be raised to disengage the posts from the vehicle body.
US11987300B2
A snow vehicle is disclosed comprising a vehicle frame, a propulsion unit coupled to the frame, and a front ski steered by a steering mechanism. The snow vehicle has a chain coupling the sprocket of the propulsion unit and a chain tensioning device to take up the chain tension. The chain has a chain guide positioned below a lower run of the chain which directs the chain towards an upper run of the chain.
US11987291B2
An embodiment floor structure of a vehicle includes a pair of side seals disposed to face each other in a vehicle width direction, and respectively disposed in a vehicle length direction, a floor frame disposed between the pair of side seals and including a pair of longitudinal frames respectively arranged along the pair of side seals and at least one transverse frame mounted between the pair of longitudinal frames in the vehicle width direction, and at least one core structural member disposed in a space provided by the floor frame and including a material for absorbing impact.
US11987287B2
A method for autonomously parking a vehicle-trailer system is provided. The method includes receiving sensor system data from a sensor system supported by the vehicle. The sensor system data includes images of surroundings along a driving path of the vehicle-trailer system. The method includes determining a local map based on the sensor system data. The local map includes surroundings along the driving path. The method includes receiving a user selection of an image location within the images. The image location representing a position in the local map associated with a selected location within the surroundings. The method includes determining a parking path from a current location of the vehicle-trailer system to the position based on the local map and instructing a drive system to execute an autonomous parking behavior causing the vehicle-trailer system to autonomously drive along the parking path and autonomously park in the selected location.
US11987272B2
Systems and methods for predicting user interaction with vehicles. A computing device receives an image and a video segment of a road scene, the first at least one of an image and a video segment being taken from a perspective of a participant in the road scene and then generates stimulus data based on the image and the video segment. Stimulus data is transmitted to a user interface and response data is received, which includes at least one of an action and a likelihood of the action corresponding to another participant in the road scene. The computing device aggregates a subset of the plurality of response data to form statistical data and a model is created based on the statistical data. The model is applied to another image or video segment and a prediction of user behavior in the another image or video segment is generated.
US11987262B2
A method for automated driving of a vehicle, comprising: provide function modules, wherein the function modules each comprise at least one subfunction for automated driving, and wherein the function modules are each assigned at least one module validity attribute that defines the context of the surroundings in which the particular function module is valid, provide at least one system configuration, wherein the at least one system configuration comprises at least one of the function modules, and wherein the at least one system configuration is assigned at least one configuration validity attribute that defines the context of the surroundings in which the at least one system configuration is valid, select one of the at least one system configurations, wherein the selection depends on a context of the surroundings and the at least one associated configuration validity attribute, control the vehicle, wherein controlling is based on the selected system configuration.
US11987245B2
A method for controlling a vehicle including: based on map information including information of an installation position of a traffic light and information of a lane controlled by the traffic light and a range of the angle of view of a camera mounted on the own vehicle, calculating an imaging-enabled area in which an image of the traffic light can be captured on the lane by the camera; determining whether or not the own vehicle is positioned in the imaging-enabled area; and when the own vehicle is positioned in the imaging-enabled area, controlling the own vehicle in such a way that the traffic light is not shielded from the range of the angle of view of the camera by a preceding vehicle of the own vehicle.
US11987241B2
An autonomous vehicle and a system and method for operating the autonomous vehicle. The system includes a sensor and a processor. A disturbance force or yaw moment is received on the autonomous vehicle. The sensor measures a position of the autonomous vehicle within a lane of a road with respect to road boundaries and lane markings. The processor is configured to resist an effect of a disturbance force or yaw moment received on the autonomous vehicle. The processor minimizes a tracking error between a path of the autonomous vehicle and an initial track lane, wherein resisting the effect creates an inflection point in the path of the autonomous vehicle, establishes a final track lane at a closer of a lateral position of the inflection point and a lane center to the initial track lane, and tracks the path to the final track lane.
US11987237B2
A computer-implemented method is provided that involves determining, based on map data, an approaching merge region comprising an on-ramp merging with a road comprising one or more lanes, wherein a truck is traveling on an initial lane of the road according to a navigation plan. The method involves an indication of movement of a vehicle on the on-ramp, wherein the indication of movement is based on data collected by one or more sensors configured to capture sensor data from an environment surrounding the truck. The method involves determining, for the on-ramp and the one or more lanes, respective avoidance scores indicative of a likelihood of an interaction between the truck and the vehicle based on the approaching merge region. The method involves updating the navigation plan based on the respective avoidance scores. The method also involves controlling the truck to execute a driving strategy based on the updated navigation plan.
US11987230B2
Disclosed are a vehicle including an electric motor and a method of controlling the same for providing a notification function to an occupant of the vehicle by controlling a pitching motion of a vehicle body. The method includes calculating a first torque value for providing the pitching motion based on driving state information including a vehicle speed, a driving mode, and an environment of a driving road; calculating a second torque value based on a request of a driver; and calculating a final torque value for controlling the electric motor based on the first torque value and the second torque value.
US11987229B2
A method of controlling and optimizing braking and directional control of a vehicle operated on a contaminated, compliant, or non-compliant surface. The method includes steps of: collecting data from a plurality of sensors, the data being indicative of a condition of the contaminated, compliant, or non-compliant surface; sending the data to a neural controller having an algorithm configured to process the data. The algorithm includes: determining optimum braking and directional control instructions for the vehicle, generating warnings and alerts based on the calculated optimum braking and directional control instructions, and sending the optimum braking and directional control instructions to a braking and steering system of the vehicle and the warnings and alerts to an alert and warning system of the vehicle. The method further includes adjusting the steering and directional control of the braking and steering system in accordance with the optimum braking and directional control instructions provided by the neural controller.
US11987227B2
A brake system may include an actuating device, in particular a brake pedal; a first piston-cylinder unit having two pistons subjecting the brake circuits to a pressure medium via a valve device, wherein one of the pistons can be actuated by the actuation device; a second piston-cylinder unit having an electric motor drive, a transmission at least one piston to supply at least one of the brake circuits with a pressure medium via a valve device; and a motor pump unit with a valve device to supply the brake circuits with a pressure medium. The brake system may also include a hydraulic travel simulator with a pressure or working chamber which is connected to the first piston-cylinder unit.
US11987225B2
The disclosure relates to a driver assistance method, in which a vehicle performs a driving manoeuvre automatically, and a braking device, in particular a parking brake, is at least partially actuated during the performance of the driving manoeuvre so that a braking action is constantly exerted on the wheels of at least one axle so that a drive of the vehicle operates counter to the braking action of the braking device in order to move the vehicle. According to the disclosure, during the driving manoeuvre at least one operating parameter which is related to an undesired increase in the braking action exerted on at least one wheel is detected and evaluated, and a braking action on at least one wheel is reduced in accordance with the result of said evaluation.
US11987219B2
An integrated jack system for a vehicle is provided. The system includes a plurality of jack assemblies disposed within a vehicle frame, wherein each of the plurality of jack assemblies is disposed adjacent to a vehicle wheelbase. Each of the jack assemblies includes a plurality of telescopic, wherein a plurality of controls actuates the plurality of jack assemblies between the extended position and the retracted position. A display is operably connected to a weight sensor disposed within each of the plurality of jack assemblies to display a weight supported by each jack assembly. A width of each telescopic member increases in width from a proximal end of the jack assembly to a distal end of the jack assembly. Each of the jack assemblies terminates in a foot member, wherein a lower surface of the foot member frictionally engages a ground surface when the jack assembly is in the extended position.
US11987218B2
A method and system for supporting trailers carrying mechanical equipment, such as hydraulic fracturing oil and gas equipment are provided. One, two or at least three supports extend from the trailer toward ground and are configured to partially support the trailer when in contact with ground, in addition to any axle groups that exist on the trailer. At least one device configured to absorb, damp, or both absorb and damp vibrations from the mechanical equipment during operation is provided. Each device is operatively coupled to, for example integrated with, a corresponding one of the support structures.
US11987217B2
A method for treating a vehicle having at least one outer surface, includes (a) adjusting an angle of a treatment brush relative to the vertical in at least one predetermined angular range parallel and/or perpendicular to the outer surface, (b) guiding the treatment brush along the at least one outer surface on a path during the treatment process, (c) monitoring the angle of the treatment brush to the vertical parallel and/or perpendicular to the outer surface during step (b), and (d) adapting the path of the treatment brush if a deviation of the monitored angle of the treatment brush from the at least one predetermined angular range is determined in step (c). An apparatus for treating a vehicle having at least one outer surface, a use of the apparatus for treating a vehicle having at least one outer surface, and a computer program product are further disclosed.
US11987208B2
Systems and method are provided and include ultra-wide band (UWB) modules located within a vehicle at module locations that are located at known distances relative to each other. The UWB modules perform UWB distance ranging with a portable device and with each other. A control module instructs each UWB module to perform distance ranging with every other UWB module of the plurality of UWB modules, receives a set of measurements associated with each UWB module, performs a comparison of the measurements with the known distances, and determines locations for each UWB module based on the comparison, the locations being one of the plurality of module locations.
US11987207B2
A vehicle including a powered running board, a motor for positioning the powered running board between a stowed position and a deployed position, a sensor configured to capture data of activity around the vehicle, and an electronic control unit configured to process the data captured by the sensor to detect an unauthorized event around the vehicle, and operate the motor to repeatedly move the powered running board in a predetermined pattern based on at least one of position and a speed in response to the sensor detecting an unauthorized event around the vehicle.
US11987190B2
A wire harness including: a wire harness main body that includes an electric wire and an exterior tube that covers an outer circumferential surface of the electric wire; a first path restrictor that is attached to an outer circumferential surface of the exterior tube and is configured to restrict a path of the wire harness main body; and an attachment that is attached to an outer circumferential surface of a portion of the first path restrictor in a lengthwise direction thereof.
US11987185B2
A vehicle windscreen has a bracket for a sensor including a camera, the bracket being attached to the windscreen and comprising a baseplate and at least three retaining elements mounted on the baseplate. The sensor is accommodated within a sensor housing that comprises at least three mounting stubs projecting from the sensor housing. Each retaining element comprises a fixed support portion and a resilient limb fixed at one end and free at the other end, with a guideway extending between each resilient limb and its respective fixed support portion, the guideway being provided to guide the respective mounting stub when inserted in the bracket. Each resilient limb and fixed support portion defines a retaining portion, whereby the mounting stub when inserted in the bracket and having passed along the guideway is stopped and retained in the retaining portion by the biasing action of the resilient limb.
US11987180B2
A shovel includes a lower traveling body, an upper turning body turnably mounted on the lower traveling body, a cab mounted on the upper turning body, multiple image capturing devices mounted on the upper turning body, a display device provided in the cab, and an operation part provided in the cab. The display device includes an image display part configured to display a captured image captured by at least one of the image capturing devices and a menu screen. The image display part is configured to display the menu screen while displaying the captured image, in response to the operation part being operated.
US11987172B1
Methods, systems, and non-transitory computer readable media are configured to perform operations comprising determining a plurality of predetermined situations in which lighting operation of an ego vehicle should automatically transition; determining occurrence of a predetermined situation of the plurality of predetermined situations; and causing an automatic transition in lighting operation of the ego vehicle.
US11987170B1
A gear shift adjusting mechanism includes: an adjustment unit including a first slider; an adjustment target module including a second slider; and a switch unit including a first rotation shaft and a link member supported rotatably with respect to a fixing member about the first rotation shaft. The link member includes a first engaged part that is engaged with a first engaging part of the first slider and a second engaged part that is engaged with a second engaging part of the second slider. The switch unit moves at least one of the first rotation shaft, the first engaging part, or the second engaging part so that at least one of a first distance between the first rotation shaft and the first engaging part or a second distance between the first rotation shaft and the second engaging part is changed.
US11987164B2
A cargo restraint system a locking ring coupled to an extension tube, wherein the locking ring comprises an annular body and one or more tabs extending from the annular body. The cargo restrain system also includes a locking tube coupled to the main body. The locking tube comprises one or more grooves complementary to the shape and size of the tabs on the locking ring. The grooves of the locking tube inhibit rotational movement of the locking ring.
US11987161B2
A wheeled device for increasing the mobility of a snowmobile or ski-bound vehicle, wherein the wheeled device, having a cylindrical axle, is attached to the bolt on the interior of a sled ski underneath the snowmobile sled, which raises the skis off the ground and does not increase the snowmobile sled width. The wheeled device surrounds the interior sled ski bolts and nuts thereon and is tightened onto said bolts and nuts by way of a tightening wheel. The snowmobile is thus able to drive on the wheeled devices so that it can conveniently move from one location to another without damaging the bottom of the skis if on rough or unstable terrain.
US11987155B2
A child safety seat assembly for use in a rear facing position. The child safety seat assembly includes: a child safety seat, and a base portion, to be placed on a vehicle seat and for holding the child safety seat. The base portion includes at least one rail, a pair of ISOFIX latches, connected to the at least one rail and for connecting the base portion to the vehicle seat, and a sledge connected to the at least one rail and for holding the child safety seat. The sledge is, with the child safety seat mounted thereon, movable along the at least one rail such that the position of the child safety seat is adjustable when the child safety seat assembly is connected to the vehicle seat.
US11987147B2
A method and system for operating a battery system includes storing battery charge usage data for a plurality of days in a memory, obtaining usage data for a current day based on a past corresponding day, comparing the usage data for the current day to a plurality of threshold, when the usage data is less than a first usage threshold, setting an operating state of charge range for the current to a first state of charge range, when the usage data is between the first usage threshold and a second usage threshold, setting the operating state of charge range for the current to a second state of charge range greater than the first state of charge range, when the usage data is greater than the second usage threshold, setting the operating state of charge range for the current to a third state of charge range greater the second state of charge range, and charging and discharging the battery system based on the state of charge range during the current.
US11987141B2
A charging system for a vehicle includes a connector suspended on a flexible cable and movable along at least one of a plurality of axes perpendicular to one another and a charging port fixed to the vehicle. The connector is movable into a mated position with the charging port.
US11987140B1
The present solution provides a digital first responder cut loop. The present solution can include a system comprising a control unit executing instructions and configured to generate a signal through a harness of an electric vehicle. The signal can be indicative of a state of a cut loop of the electric vehicle. The control unit can be electrically connected to restraint control module and a battery pack associated with the electric vehicle. The controller can be configured to detect an event associated with the vehicle or a change in the signal above a threshold level. The controller can be configured to, responsive to the detection of one of the event or the change in the signal, facilitate electrical disconnection of the restraint control module of the electric vehicle or the battery pack of the electric vehicle.
US11987139B2
There are described herein methods and systems for operating an electric motor of a watercraft. In one method, the electric motor of the watercraft is controlled based on commands received from an accelerator of the watercraft, a sensor signal is received from at least one sensor of the watercraft while the electric motor is in operation, the sensor signal indicative of an undesirable condition of a water intake of the watercraft, and a change is effected to the controlling of the electric motor in response to receiving the sensor signal.
US11987136B2
A system in a vehicle includes a current regulator to obtain current commands from a controller based on a torque input and provide voltage commands and an inverter to use the voltage commands from the current regulator and direct current (DC) supplied by a battery to provide alternating current (AC). An electric traction motor provides drive power to a transmission of the vehicle based on injection of the AC from the inverter. A current observer obtains measured input current signals based on the AC for a current control cycle and provides predicted current signals for a next control cycle to the current regulator using a model. The current observer includes a controller to check output of the model against the measured input current signals. The current observer tunes parameters of the controller and the model used to generate the predicted current signals based on the measured input current signals.
US11987135B2
An electric drive train for a pure electrically operated vehicle includes an electric motor with a motor shaft and a start-up support unit mechanically connected to the motor shaft configured to convert a motor speed and a motor torque of the motor shaft into an output speed and an output torque such that the output speed is lower than the motor speed and/or the output torque is higher than the motor torque. Also, a method of operating an electric drive train during a start-up process includes increasing a start-up motor speed and a start-up motor torque of a motor shaft of an electric motor, converting the start-up motor speed and the start-up motor torque into a start-up output speed and a start-up output torque with a start-up support unit, and closing a lock-up clutch of the start-up support unit.
US11987133B2
A variable setting drivetrain for use with a vehicle including a controller in operable communication with an electric motor and configured to provide signals to the motor representative of a target output torque vector, where the controller is configured to calculate the target output torque vector by taking the weighted average of a first torque vector determined using a first output map, a second torque vector determined using a second output map, and a third torque vector determined using a third output map.
US11987123B2
A method includes detecting a direction of view of at least one passenger as an occupant of the motor vehicle; and providing a display with information about at least one object in a landscape of the motor vehicle viewed by the at least one passenger, the at least one object not being relevant to road traffic, such that said information is provided in an area in the direction of view of the at least one passenger, wherein, when multiple passengers of the motor vehicle are detected, a direction of view of each passenger is detected, such that a display with information about the at least one object in the landscape of the motor vehicle viewed by at least two passengers is provided in an area in which the direction of view of the at least two passengers intersect.
US11987119B2
A tire failure detection device includes a steering angle sensor for sensing a steering angle, a yaw rate sensor for sensing a yaw rate, and a control unit. The control unit calculates side-slip energy based on the output signal of the steering angle sensor and the output signal of the yaw rate sensor, and determines that a failure has occurred in a tire when the side-slip energy exceeds a first threshold.
US11987117B2
Methods and systems for an electric drive assembly are provided herein. In one example, an electric drive system is provided that includes two multi-motor drive units with associated planetary gear reductions that have asymmetric gear ratios. The planetary gear reduction in each drive unit includes a ring gear and a sun gear that are rotationally coupled to a pair of motors and a carrier rotationally coupled to an output gear that interfaces with a gear reduction of an axle assembly.
US11987108B2
A vehicle roof roller blind arrangement having roller blind web, windable to form a roller blind fabric roll in a winding area, and two guide rails disposed on either side of the web and which have respective guide tracks in which lateral guide strips of the web are guided, the guide rails connected to each other via a transverse frame part in which the winding area for the roller blind web is formed. Each guide rail has a clean-cut end adjacent to the transverse frame part. The transverse frame part has a strip infeed element for each guide rail, the strip infeed elements forming infeed tracks for the guide strips, each infeed track being defined by at least one inner retaining rib and at least one outer retaining rib for the guide strip, and the infeed tracks ending in the guide tracks of the guide rails.
US11987096B2
An indirect heat pump system includes a refrigerant unit, a cold water handling unit, and a hot water handling unit. A cold water inlet of the cold water handling unit communicates with an evaporator; a cold water outlet of the cold water handling unit communicates with the evaporator; the cold water handling unit is connected to a plurality of loads in parallel. A hot water inlet of the hot water handling unit communicates with a condenser; a hot water outlet of the hot water handling unit communicates with the condenser; the hot water handling unit is connected to the loads in parallel; and a plurality of hot water two-way valves are disposed in pipelines of the hot water handling unit and are configured to control the on and off of the hot water in the loads.
US11987089B2
An electrically powered suspension system includes: an actuator that is provided between a vehicle body and a wheel of a vehicle and generates a load for damping vibration of the vehicle body; an information acquisition part that acquires information on a sprung state amount and a road surface state; a target load calculation part that calculates a first target load related to skyhook control based on the sprung state amount and calculates a second target load related to preview control based on the road surface state; and a load control part. The target load calculation part calculates a third target load related to pitch generation control based on a target pitch angle and calculates a combined target load into which the first target load, second target load, and third target load have been combined. The load control part performs load control of the actuator using the combined target load.
US11987088B2
A method for operating at least one electromechanical actuator of a motor vehicle, wherein the actuator is designed to convert mechanical power into electrical power during operation of the motor vehicle in stochastic feed-in processes as a function of a feed-in efficiency predetermined by a feed-in operating point of the actuator, which electrical power is fed into an energy storage device of the motor vehicle, includes detecting the start of a feed-in process by a means of detection and, at the start of the feed-in process, setting a feed-in operating point of the actuator, wherein the feed-in efficiency is 50% or less.
US11987084B2
A materials handling vehicle comprising a hitch system, and a drive mechanism. The hitch system comprises a hitch and a hitch controller. The hitch comprises a latch, one or more sensors, an actuator, and a receiving member. The latch is positionable between open and closed positions. The actuator is positionable between retracted, intermediate, and extended positions. The receiving member is configured to lead a cart hook to engage the latch when in the closed position. The one or more sensors are configured to detect a position of the latch and a presence of the cart hook received within the receiving member. The hitch controller is configured to position the actuator in one of the retracted position, the intermediate position, and the extended position, and to position the latch in one of the open position and the closed position in response to signals received from the one or more sensors.
US11987071B2
A device for displaying images having variable colors comprises a substrate; a light-transmissive coloring layer painted or laminated on the substrate, the coloring layer comprising colorants of different colors and having a rear side in contact with the substrate and a varnished front side; a display layer comprising a silvering material directly plated on the varnished front side of the coloring layer, the display layer comprising a display pattern forming a visible displayed image, the silvering material comprising a metal, a metalloid, or an oxide thereof to form a one-way-mirror; an illuminator configured and positioned to illuminate the coloring layer from the rear side of the coloring layer. When the coloring layer is unilluminated by the illuminator, the unilluminated coloring layer is hidden behind the one-way-mirror. When the coloring layer is illuminated by the illuminator, the illuminated coloring layer visibly colorizes the displayed image through the one-way-mirror.
US11987068B2
A marking pen, comprising: a shaft cylinder; a porous pen core accommodated in the shaft cylinder, and configured to project from, and retract into, an opening part provided at a tip end of the shaft cylinder; an inner cotton accommodated in the shaft cylinder, and filled with an aqueous ink composition to be fed to the pen core, the aqueous ink composition including a water soluble organic solvent in an amount of from 20 mass % to 60 mass %; and a delivery mechanism configured to cause a tip end of the pen core to project from, and retract into, the opening part.
US11987064B2
A cassette includes a printing tape roll being rotatable and into which a printing tape as a medium to be printed is wound, and an outer peripheral wall disposed on one side in a first direction relative to the printing tape roll. The first direction is a width direction of the printing tape. The outer peripheral wall includes a first side wall extending in a second direction orthogonal to the first direction, a second side wall extending in a third direction orthogonal to the first direction and intersecting with the second direction, and a recess wall defining a recess extending from the second side wall toward one side in the second direction. The recess extends in the third direction on one side in the second direction further than the second side wall. At least a portion of the recess overlaps the printing tape roll in the first direction.
US11987062B2
A method for correcting an image includes: moving first and second ink jet heads and a medium relative to each other, each of the first and second ink jet heads including nozzles and drive elements corresponding to the nozzles respectively; discharging ink droplets from the nozzles of the first and second ink jet heads, by connecting each of the drive elements to one of power supply circuits and by applying voltage to each of the drive elements, the power supply circuits having different output voltage values each other; determining a density difference between a first image region and a second image region; and switching the voltage to be applied to first drive elements to a first voltage by switching the power supply circuits to be connected to the first drive elements based on the density difference.
US11987053B2
A liquid discharge apparatus includes a holder, a fixing member, multiple liquid dischargers, and multiple couplings. The fixing member is detachably attached to the holder. The multiple liquid dischargers are secured to the fixing member and arranged side by side in a vertical arrangement direction. The multiple liquid dischargers include respective liquid conveyors. The multiple couplings couple the respective liquid conveyors and respective liquid containers. One of the liquid conveyors of a lower one of the multiple liquid dischargers is longer in a direction intersecting the vertical arrangement direction than another one of the liquid conveyors of an upper one of the multiple liquid dischargers above the lower one.
US11987050B2
A droplet ejection device includes a processor; and a memory device configured to store a program, the program executed by the processor to cause the processor to: acquire information of a droplet ejection unit including a plurality of nozzles, the plurality of nozzles moving in a first direction toward an object and ejecting a droplet; and set ejection conditions of the droplet in each of the plurality of nozzles based on the acquired information of the droplet ejection unit. The droplet ejection device further may include an inspection unit configured to inspect the nozzle. The information of the nozzle may include information of a shape in a tip of the nozzle. It is possible to eject a droplet in a stable and consistent manner at a predetermined position by using one embodiment of the present disclosure.
US11987045B2
A printing apparatus includes a conveyance unit including a pair of rotation members that nip a roll sheet, and configured to convey the sheet by rotation of the pair of rotation members, a printing unit, and a control unit configured to, upon executing a new print job, cause the conveyance unit to perform a preparatory operation in which the sheet is conveyed in a forward direction and then conveyed in a reverse direction and stopped. If a predetermined condition is met after completion of a previous print job, the control unit causes the conveyance unit to perform the preparatory operation, and if the predetermined condition is not met after completion of a previous print job, the control unit does not cause the conveyance unit to perform the preparatory operation.
US11987034B2
A metal-resin joining method of joining a metal member to a composite material member including a fiber reinforced plastic composite material includes an applying step of applying a first adhesive that is a thermosetting adhesive to a first region between the metal member and the composite material member, and applying a second adhesive that is a thermosetting adhesive to a second region between the metal member and the composite material member, a provisional bonding step of irradiating a first irradiation region of the metal member opposed to the first region with a laser light, and heating and curing the first adhesive to provisionally bond the metal member and the composite material member together, and a main bonding step of curing the second adhesive after the provisional bonding step to bond the metal member and the composite material member together.
US11987033B2
A system and method for dielectric bonding including a dielectric heater having a pair of opposing electrode plates, a nest removably coupled to a first electrode plate of the pair of electrode plates, and an interchangeable electrode assembly removably coupled to a second electrode plate of the pair of electrode plates. The nest having a plurality of cooling channels defined in a body thereof in which a cooling fluid circulates to cool a material assembly that is supported by the nest. The interchangeable electrode assembly having a plurality of concentrator members that are configured to concentrate energy from a voltage source in predetermined locations on the material assembly.
US11987032B2
A resin sheet having hair-like bodies arranged regularly on at least one surface of a base layer containing a thermoplastic resin, the surface with the hair-like bodies having a coefficient of friction, as measured according to KES, of 0.5 or more and 1.0 or less, a deviation of the coefficient of friction, as measured by KES, of 0.010 or more and 0.025 or less, and a deviation of roughness, as measured by KES, of 0.2 or more and 1.5 or less.
US11987028B2
A moisture permeable composite material for a wide variety of applications including without limitation prosthetic liners, orthotic liners, clothing, space suits and environmental suits comprising: an inner layer comprising a hydrogel, a thin tough hydrogel membrane, or dual network hydrogel; and an outer layer comprising a porous elastomer or an open cell foam.
US11987022B2
A tile-type decorative flooring material includes a surface-processed layer, a clear layer, a design-print layer, an underlayer, and a micro-embossed plastic foam part having a plastic foam layer and an adhesive film layer with micro-embossing. The flooring material provides a significant improvement in terms of slippage between the product and the floor surface in a construction process not using an adhesive.
US11987019B2
A bale compression device for receiving and compressing a bale of material. The device includes a press configured to compress the bale of material to a required compressed dimension, a binding applicator configured to apply a plurality of bindings around the bale of material prior to the bale being compressed, and a connector for connecting ends of each of the bindings to form a plurality of complete loops around the perimeter of the bale so that the plurality of loops act to hold the bale in a compressed state. The binding applicator acts to withdraw excess binding as the press compresses the bale, prior to the connector connecting the ends of each of the bindings, such that the complete loops are formed when the bale reaches its required compressed dimension.
US11987015B2
In an example, a method is described. The method comprises forming a single hole into a bond gap repair area. The method also comprises evacuating, via an adhesive injection apparatus attached to the single hole, the bond gap repair area and an injection channel of the adhesive injection apparatus. The method also comprises forcing adhesive through the evacuated injection channel and into the evacuated bond gap repair area.
US11987012B2
A construct for a hockey blade formed from layers of sheet molding compound material. The sheet molding compound material may be manufactured to have longer average fiber lengths entrained within the sheet molding compound material with random orientation in order to enhance the mechanical properties of the formed hockey stick blade.
US11987007B2
A three-dimensional shaping device includes: a discharge unit configured to discharge a plasticized material toward a shaping region of a stage; a camera configured to capture an image of the shaping region; and a control unit configured to control the discharge unit based on shaping data for shaping a three-dimensional shaped object. When the control unit acquires setting information for setting whether to display an image or a moving image captured by the camera on an external display unit in at least one of a period before starting shaping of the three-dimensional shaped object, a period during shaping of the three-dimensional shaped object, and a period after shaping of the three-dimensional shaped object, the control unit executes, based on the setting information, for each of the shaping data, first processing of transmitting or not transmitting the image or the moving image to the display unit, second processing of activating or stopping the camera, and third processing of transmitting, to the display unit, output instruction information for instructing whether to display the image or the moving image on the display unit.
US11987003B2
A method of making a three-dimensional object, including the steps of: (a) providing a carrier platform; (b) producing the three-dimensional object adhered to the carrier platform; (c) immersing the object in a wash liquid with the object remaining adhered to the carrier platform; (d) agitating the object in the wash liquid and/or the wash liquid with the object immersed therein to at least partially remove residual resin from the object; (e) separating the object from the wash liquid, with the object remaining adhered to the carrier platform; (f) agitating the object at least partially remove residual wash liquid; and (g) repeating steps (c) through (f) at least once to remove additional polymerizable resin, steps (c) through (f) are carried out in the same vessel, the immersing step (c) includes filling the vessel with the wash liquid, and the separating step (e) includes draining the wash liquid from the vessel.
US11986995B2
The disclosure provides methods of additive manufacture of components in layers in a powder bed by at least two laser beams that can be deflected two-dimensionally over the same powder bed region. Each laser focal spot is projected onto the power bed and is or is set to a diameter of less than or equal to 300 μm. Components to be produced in the powder bed region are manufactured by each of the laser beams, and each individual surface contour of the component is manufactured solely by one of the laser beams.
US11986994B2
The present disclosure relates to the use of occluding fluids, such as a high-density fluid (a “z-fluid”) or a low-density fluid (an “a-fluid”), to displace resin within a vat during 3D printing. Further, an a-fluid may act as a protective boundary for a 3D printing resin wherein the a-fluid sits on top of the printing resin. Another embodiment of the disclosure provides a process of assessing which regions of a computer-aided design (CAD) model take advantage of a buoying force supplied by the occluding fluid, such that fewer support structures are needed for printing a final CAD model compared to printing the CAD model without the occluding fluid.
US11986993B2
The disclosure relates to methods of forming three-dimensional (3D) polymeric articles and additive manufacturing apparatuses for the same. The methods include providing a polymeric solution comprising a polymer dissolved in a solvent; providing a non-solvent, wherein the solvent is miscible in the non-solvent, and the polymer is insoluble in the non-solvent; and injecting the polymeric solution into the non-solvent in a pre-determined 3D pattern to provide a 3D polymeric article.
US11986992B2
Methods for forming polyolefin films using a model including a multivariate adaptive regression splines (MARS)-derived algorithm are provided. Related computing devices are also provided.
US11986990B2
A wood-grained polymer substrate includes a plurality of layers of different colors. The substrate is formed into elongated boards and used in the production of various end products similar to natural wood. Methods for producing the wood-grained polymer substrate are also provided.
US11986986B2
Provided is an injection molding system capable of improving usability for a user. The injection molding system determines a combination of a mold and an injection molding machine and a specific molding condition specific to the combination of the mold and the injection molding machine, and outputs the determined specific molding condition in a predetermined form for manual input to the injection molding machine.
US11986983B2
A fish model to replace the use of live fish in hydroelectric studies is provided. The fish model is cast from ballistic gel to include the density, dimensions, and weight distribution of a selected species of living fish. The fish model is formed by additively manufacturing a mold based on a three-dimensional scan of an actual fish. The mold is then used to mass produce fish models for force measurement testing at various blade speeds, thickness, and impact angles. Each fish model includes a surrogate skin and an internal sensor for strike force measurements. Optional additional sensors include strain gauges, temperature probes, pressure probes, and load sensors, for example.
US11986982B2
An injection molding system including an injection nozzle that injects resin into a mold and a conveying device that conveys the injection nozzle between a first position where the injection nozzle injects resin into a first mold and a second position where the injection nozzle injects resin into a second mold.
US11986981B2
A method for forming a silicone container having a reinforced rim. A layer of adhesive is applied to the outer surface of a metal ring. The adhesive layer is covered with a first plug of unvulcanized silicone. The first plug of unvulcanized silicone is then vulcanized to form a vulcanized silicone covered metal ring. The vulcanized silicone covered metal ring is then inserted into a mold along with a second plug of unvulcanized silicone. The second plug of unvulcanized silicone is then vulcanized so that it binds with the vulcanized silicone covered metal ring to form a silicone container having a reinforced rim. In one preferred embodiment the silicone container having a reinforced rim is a bowl. In another preferred embodiment the silicone container having a reinforced rim is a cup.
US11986975B2
A method for plugging a subset of cells of a honeycomb structure that includes: covering a first end face of the honeycomb structure with a mask that comprises a body and a plurality of openings, wherein the plurality of openings of the mask is coincident with a plurality of cells of the honeycomb structure; providing a plenum, a movable plunger and a flow plate; positioning a cylinder between the honeycomb structure and the plenum; dispensing a plugging material into the plenum; moving the plunger toward the flow plate with a force to push the plugging material through the flow plate into the cylinder, the moving generating a pressure in the plenum and the cylinder that forces the plugging material through the mask into the plurality of cells of the honeycomb structure to a predetermined depth; and determining the pressure within the cylinder during the moving of the plunger.
US11986964B2
A path determination device and so forth are provided which can determine a path of a robot such that an autonomous mobile robot smoothly moves to a destination while avoiding an interference with a traffic participant even under a traffic environment such as a crowd. A path determination device (1) determines a temporary moving velocity command v_cnn, by using a CNN, such that an interference between a robot (2) and a traffic participant is avoided and determines a moving velocity command v of the robot (2), by using a DWA, such that in a case where the robot (2) is assumed to move from a present position by the temporary moving velocity command v_cnn, an objective function G(v) including a distance dist to the traffic participant closest to the robot (2) and the temporary moving velocity command v_cnn of the robot (2) as independent variables becomes a maximum value.
US11986959B2
More natural communication and interaction are enabled. The autonomous system (100) includes an action decision unit (140) that decides, based on an attention level map (40) in which an attention level indicating the degree of attention for each position in a predetermined space is set, the action which a drive mechanism is caused to perform.
US11986953B2
A mobile robot includes a driver configured to provide a traveling function, a body disposed at an upper side of the driver and configured to include a head coupling hole formed at an upper portion thereof, and a head configured to include a head bracket inserted into the head coupling hole of the body. The body includes a head fixing frame fastened to the head bracket, a first bolt configured to fix the head fixing frame and the head bracket, and a repair cover coupled to an opening formed in a backward direction. The head is separated from the body when the first bolt is released by opening the repair cover.
US11986948B1
A flexure having six degrees of freedom is disclosed. The constraint and compliance of the flexure in all six degrees of freedom may be independently tuned for an application. The flexure may include various combinations of sections including, for example, straight arm and curvilinear sections. The constraint and compliance of the flexure is determined by the geometry, cross-sectional area, cross-sectional shape, and material used to form the various sections. A coupling mechanism and a corresponding method for using the coupling mechanism for automated or autonomous assembly of elements using tuned flexures is disclosed. The automated or autonomous assembly of elements employs a coupling mechanism having a motor driven grip and a coupler, in which the coupler includes a six degrees of freedom flexure. The motor driven grip and coupler may optionally include electrical or optical interconnections and self-aligning features.
US11986947B2
An autonomous traverse tire changing bot includes a carriage having a carriage frame with a carriage drive section effecting autonomous traverse of the carriage, along a traverse path, relative to a traverse surface or a floor on which the bot rests, and a bot frame including at least one actuator mounted to the carriage and a bot drive section with a motor defining an actuator degree of freedom, wherein the at least one actuator has an end effector having a tire engagement tool disposed so that articulation of the at least one actuator with the actuator degree of freedom effects engagement contact of the tire engagement tool and a tire mounted on a vehicle, and a controller effects traverse of the bot along the traverse path effecting dynamic positioning of the at least one actuator relative to a variable position of the vehicle with the tire mounted thereon.
US11986920B2
According to one embodiment, a polishing method includes supplying a polishing agent to be between a polishing pad and to-be-polished surface, then polishing the to-be-polished surface with the polishing agent while rotating at least one of the to-be-polished surface and the polishing pad. The polishing agent includes abrasive grains and an organic polymer. The organic polymer makes a reversible phase transition between a gel state and a sol state depending on temperature.
US11986914B2
A system for disengaging a drive shaft from a bearing support. An assembly formed by the drive shaft and the bearing support is placed above a cylinder, which pushes on the drive shaft by passing by the central hole of the bearing support. The bearing support is driven upwards, but is blocked by a first and a second force transfer device, which allows the drive shaft to be disengaged from the bearing support.
US11986913B1
A tool or bit with narrow metal pins is disclosed. When the tool is attached to a vibrational source such as a multitool, the pins enter non adjacent grooves, typically grooves every eight fins. The tool is vibrated and advanced through the area of bent fins. The groups of 8 fins are straightened at the margins. The partially straightened fins can then be fully straightened by finishing the area with a standard fin comb.
US11986908B1
The present invention includes an improved transducer wedge assembly for inspecting welds and other formations. According to a first preferred embodiment, the transducer wedge assembly includes a central spacer wedge fixed between a first transducer wedge and a second transducer wedge. The central spacer wedge is preferably formed from cork or other insulating material. Additionally, the central spacer wedge preferably includes a wave direction side and a back side, with the back side of the spacer wedge producing an offset angle between the first transducer wedge and the second transducer wedge.
US11986890B2
A hole saw is disclosed herein. The hole saw can include a cylindrical body having inner and outer cylindrical surfaces concentric to each other about a first axis. The body can also extend along the first axis between first and second opposite ends. The hole saw can also include a plurality of teeth each including a tooth body and a carbide tip positioned on the tooth body and forming a tooth face. Each of the tooth faces can define one or more cutting edges. The teeth can be arranged in an alternating pattern including a first tooth in the form of a chisel tooth, a second tooth immediately behind the first tooth and in the form of an offset grind tooth, and a third tooth immediately behind the second tooth and in the form of a triple chip grind tooth.
US11986881B2
An apparatus and method for filtering molten metal (M), such as aluminum or an aluminum alloy includes at least one ceramic foam filter or any other type of filtration media such as porous tube or alumina balls disposed in a receptacle (12) for the molten metal (M). A vibrator vibrates at least one of the filter, the receptacle (12) or the metal and may be used to induce priming, filtering and/or drainage of the filter. The vibrator may be retrofitted to an existing filter system and may be adjustable in frequency and amplitude. The vibration may be continuous over a given period or produced in a single shock.
US11986858B2
A bin sorter for sorting lumber is provided. The bin sorter includes a plurality of bins disposed in a side-by-side configuration. Each bin includes a pair of spaced-apart walls defining a compartment therebetween for receiving lumber. Each compartment has a compartment inlet provided at a top end thereof, and a compartment outlet provided at a bottom end thereof. At least one of the plurality of bins has a support assembly for supporting one or more piles of lumber within the compartment. The support assembly includes a pair of support members having a support base vertically displaceable between the top and bottom ends of the compartment and a support arm connected to the support base and extending within the compartment towards the other support arm. Each support arm is adapted to support a respective pile of lumber or cooperate with one another to support a single pile of lumber.
US11986856B2
An ultrasonic transducer probe comprises an array transducer and a microbeamformer ASIC (46a, 46b) containing transmit amplifiers and receive circuitry for operation of the array transducer. For higher power operation, the drive current of the amplifiers is increased, rather than the transmit voltage. The elements of the array present a low impedance to the transmit amplifiers for increased drive current by their construction of thin layers (12) of piezoelectric material which are electrically coupled in parallel to an amplifier while being mechanically coupled in series for ultrasound transmission.
US11986846B1
An apparatus and method for displaying digital content onto a vehicle, the apparatus including a foam apparatus, a sensor configured to detect vehicle dimension data, at least a processor and a memory communicatively connected to the at least a processor, wherein the memory contains instructions configuring the at least a processor to receive the vehicle dimension data, calculate a concentration requirement based on the vehicle dimension data, transmit the concentration requirement to the foam apparatus, wherein the foam apparatus is configured to disperse foam onto the vehicle based on the concentration requirement, and a display device including a digital content projector, wherein the display device is configured to display a plurality of digital content onto the foam dispersed onto the vehicle.
US11986844B2
A method for controlling gas dynamic spraying includes providing a particle jet by using an accelerating nozzle, illuminating the particle jet with illuminating light pulses, capturing images of the particle jet illuminated with the illuminating light pulses, and determining one or more velocity values by analyzing the captured images, wherein the images are captured by using an imaging unit which includes imaging optics to form an optical image of an object plane on an image sensor by focusing light, wherein an optical axis of the imaging unit is inclined with respect to a central axis of the nozzle, and wherein the image sensor is inclined with respect to the optical axis such that the object plane is substantially parallel with a direction of movement of particles of the particle jet.
US11986843B2
A product dispenser with a reservoir for a product and a cap. The cap has a first assembly and a second assembly. The first assembly can include a button configured to dispense the product through a lower end orifice of the pipette, when the button is actuated. The second assembly can include a pipette rigidly connected and in fluidic communication with a chamber configured to change its volume depending on the movement of the first assembly relative to the second assembly and the movement of the button.
US11986839B2
An electrostatic separator separates conductive particles from raw materials includes: a container with a raw material layer; a gas dispersion plate at the bottom of the raw material layer; at least one vibrating body in the raw material layer flush with the gas dispersion plate or above it; a fluidization gas supplier introduced from the container bottom into the raw material layer flows upward through the gas dispersion plate; an upper electrode above the raw material layer; a lower electrode in the raw material layer, the lower electrode being flush with the gas dispersion plate or above it; a power supply applies a voltage between the upper and lower electrode wherein one becomes a negative electrode, the other becomes a positive electrode, and an electric field is generated between them; and a capturer captures conductive particles that have flown out of the raw material layer surface toward the upper electrode.
US11986832B2
A comminuting apparatus for comminuting comminution stock like recyclable material, waste and product residues, including a comminuting rotor mounted rotatably to a machine frame and having comminuting tools arranged thereon, a receiving region for receiving comminution stock and a feed device having a ram device which is moveable in the direction towards the comminuting rotor by a drive device and which is adapted for feeding comminution stock to the comminuting rotor. The comminuting apparatus is distinguished in that the drive device of the feed device has at least two spaced electric actuators which are controlled by a control device and which are connected at the drive output side by a transverse member, wherein the transverse member is operatively connected to the ram device by a resilient damping device.
US11986822B2
Microfluidic devices for analyzing cellular components from biological samples which contain more than one cell type are provided. The microdevice separates cells by type, releases cellular components such as DNA (e.g. by cell lysis) and processes the cellular components (for example, by amplification) to generate products of interest for further analysis. Samples that can be analyzed using the microfluidic devices include forensic samples such as samples from sexual assault victims, and the products of interest include short tandem repeat (STR) amplicons for DNA profiling.
US11986821B2
A detection chip is disclosed. The detection chip includes a sample injection structure, a filter structure, and a reaction structure which are sequentially connected. The filter structure includes a first main body, and a first inlet portion and a first outlet portion respectively on two sides of the first main body. A width of the first inlet portion gradually decreases in a direction away from the first main body, and a width of the first outlet portion gradually decreases in a direction away from the first main body.
US11986818B2
This disclosure provides systems and methods for the production of formulations of active pharmaceutical ingredients (APIs). In some embodiments, the disclosure provides an automated medicine formulation system comprising a portable and self-contained API formulating apparatus where the API and excipients are formulated to make a drug product meeting drug quality and safety specifications. The automated formulation system produces liquid formulations including, for example, injectable and intravenous medicines. The systems are capable of producing a plurality of individual sterile injectable doses of drug comprising a specific API and excipient(s), which can be formulated on demand in a GMP and FDA acceptable manner.
US11986816B2
The present invention relates to the extraction of lithium from liquid resources such as natural and synthetic brines, leachate solutions from clays and minerals, and recycled products.
US11986815B2
The present disclosure relates processes and systems for producing and/or purifying 68Ga from an irradiated substrate of 68Zn. In some embodiments, the process rely on the use two cation-exchange chromatography columns to separate 68Ga from 68Zn and other radionuclides and metallic impurities. The process achieves a high overall yield of 68Ga and a high effective molar activity while being implementable in a time compatible with the short half-life of 68Ga. In additional embodiments, the process is implemented by an automated system.
US11986814B2
A method for synthesizing and application embedded alkaline earth metal oxide solid alkali includes: firstly, synthesizing an alkaline earth metal organic skeleton with single or multiple alkaline earth metals (Mg, Ca and Sr) as central metal elements; and then controlling the heating process to carry out high-temperature pyrolysis in a non-oxidizing atmosphere, so that the alkaline earth metal oxide are embedded in the nano carbon sheet to obtain a solid alkali catalyst. Finally, the catalyst is used to catalyze the transesterification of palm oil and methanol to produce biodiesel. The active site of the solid alkali obtained by the method is anchored on the nano-like carbon sheet, so that the active site is directly exposed on the surface of the catalyst, the catalytic activity is improved, the loss of the active site is inhibited, and the stability of the solid alkali catalyst is enhanced.
US11986808B2
The disclosure relates to molecularly-imprinted cross-linked micelles that can selectively hydrolyze carbohydrates.
US11986806B2
A photocatalyst made of cuprous bromide, wherein the cuprous bromide expresses a photocatalytic property of decomposing a substance brought into contact with the cuprous bromide by irradiation with light.
US11986785B2
The present disclosure relates to a mixer having a mixer housing which encloses a mixing chamber, an input part which can be connected to the mixer housing and has at least two input openings for the components to be mixed, and a mixing element, at least some sections of which extend into the mixing chamber, wherein each of the input openings is flow-connected to the mixing chamber via at least one input duct, wherein there is also in the input part at least one compensation duct which connects the input openings to each other, and/or at least one holding chamber is provided in the mixing element.
US11986784B2
A mixer system comprising a sealed tube (2) provided with inlets and outlets (4,5) for a process fluid which is rotatable in arcs around the longitudinal axis of the tube (3) and contains one or more blades (11) mounted at each end on a blade carrier (10) supported within the tube (3) in a manner that allows the one or more blades (11) to rotate in the same direction and angular velocity (in degrees per second) as the tube (3) rotates in arcs and the use of such a system as a reactor and/or for mixing.
US11986782B2
The disclosed apparatus, systems and methods relate to devices, systems and methods for mixing particulate matter such as salt with moisture. In various implementations, the mixer is transportable. In various implementations the mixer comprises a hopper, at least one auger, and a mixing housing. Various implementations, additionally include at least one liquid tank.
US11986778B2
A gas separation apparatus includes a gas supply part and a zeolite membrane. The gas supply part supplies a mixed gas at a pressure greater than or equal to 10 atm and less than or equal to 200 atm. The mixed gas contains at least CH4, CO2, and N2. A water content of the mixed gas is made less than or equal to 3000 ppm. The zeolite membrane allows CO2 and N2 in the mixed gas to permeate therethrough, to thereby separate CO2 and N2 from CH4. The zeolite membrane is made of zeolite. The zeolite contains Al. A ratio of alkali metal to whole framework elements in the zeolite is less than or equal to 6.0 mol %. An amount of substance of the alkali metal in the zeolite is less than an amount of substance of Al.
US11986768B2
An air purification and recirculation system positioned within an animal rearing/sheltering facility. The system draws untreated air into an elongated air treatment apparatus having a dust scrubbing section, an ammonia scrubbing section, and acid scrubbing section, configured so that the treatment sections are positioned in series. At the end of the air treatment process, the treated air is exhausted back into the animal rearing facility so that the air is circulated within the facility. Acid and water used during the air treatment process are continuously recycled and directed back through the scrubbers in the air treatment apparatus.
US11986767B2
An improved regenerative separating device for separating impurities from an airflow, in particular a process exhaust airflow, provides a better distribution of the airflow in an annular gap between a rotary separating unit including a plurality of filter blocks for adsorbing impurities from the airflow and a circumferential wall of a housing incorporating the rotary separating unit. The airflow inlet provided in the circumferential wall for introducing the airflow into the annular gap and a regeneration system for regenerating the filter blocks of the rotary separating unit by a regenerating stream passing through the filter blocks to desorb impurities adsorbed in the filter blocks are both positioned in the same circumferential sector of maximum 180 degrees.
US11986766B2
An installation and method for recovering gaseous substances from gas flows comprising a first gas-treatment module (module 1) to receive a first inlet gas flow (1) in which the temperature and pressure are controlled in order to dry said flow by removing water, nitrogen and sulfur oxides, unburned substances and other solids in suspension, a second CO2 separation module (module 2) in which the first outlet flow (13) from module 1 is treated using a PSA adsorption/desorption process to separate the gases selected, thereby enriching the third outlet flow (27), and a third, optional module (module 3) in which the CO2 purification process is carried out and in which the third outlet flow (27) from module 2 is treated using a PSA adsorption/desorption process to separate the gases selected, thereby enriching the fifth outlet flow (44) from module 3.
US11986763B2
A remote control system for gas detection and purification is disclosed and includes a remote control device, a gas detection module and a gas purification device. The remote control device includes a gas inlet and a gas outlet. The gas detection module is disposed in the remote control device and in communication with the gas outlet to detect the gas located in an indoor space. The gas detection module provides and outputs a gas detection datum, and the remote control device transmits an operation command via wireless transmission. The gas purification device is disposed in the indoor space and receives the operating instruction transmitted from the remote control device to be operated. When the gas purification device is under the activated state, the gas in the indoor space is purified, and the purification operation mode of the gas purification device is adjusted according to the first gas detection datum.
US11986754B2
An alkanolamine gas treatment unit system that may comprise an absorber column, a regenerator column, and a once-through natural circulation vertical thermosyphon reboiler comprising a reboiler tube and a shell. The reboiler may be a steam driven one having a process side and a shell side, wherein the process side is inside the reboiler tube, the process side of the reboiler and the regenerator column are in fluid communication with one another, an inner surface of the reboiler tube, on the process side, has a surface roughness of 0.06 μm or greater, the shell side of the reboiler is in fluid communication to a steam source, and the regenerator column and the absorber column are in fluid communication with one another. An absorbent regenerator system that may comprise the regenerator column and the once-through natural circulation vertical thermosyphon reboiler.
US11986749B2
An immersive theater system includes a theater device having a projection room and a displaying screen unit, a multimedia audiovisual assemblage disposed in the projection room, and a central control device connected to the multimedia audiovisual assemblage. The multimedia audiovisual assemblage includes lighting units, speakers and projectors. The projectors are installed at different angles to face different display screens of the displaying screen unit. The central control device includes an audiovisual source coupled to the projectors and the speakers, and the audiovisual source is firstly divided and then displayed on the display screens to create an immersive environment whereby audience members in the projection room feel them to be immersed in lifelike surroundings caused by activating the multimedia audiovisual assemblage under the control of the central control device. The immersive theater system can be disposed in a mobile carrier to increase the mobility and the frequency of use.
US11986744B2
A top toy is used in a game table including a guide member having a guide surface on which first teeth are formed at an equal interval. The top toy includes a shaft part, a body being configured on the shaft, and a trunk part being configured on the shaft. The shaft includes second teeth that are engageable with the first teeth on an outer periphery thereof.
US11986743B2
A water ride system configured to provide passengers of boats new and exciting experiences via enhanced storytelling opportunities. The water ride system is designed to allow ride designers to provide 2-dimensional guiding of the boat traveling in a flume in a direction of travel (DOT) coinciding with the direction of water flowing in the flume. The water ride system uses a combination of a guideway (or track) within the flume and a new guide bogie. The guide bogie has a square body and four corner-mounted guide wheels, and the bogie is mounted on the bottom of the boat so as to ride within the guideway to provide guided boats with various headings. Specifically, the boats can be oriented in many different directions rather than having a single fixed orientation, such as with a front of the boat facing in the DOT, as was the case with traditional water rides.
US11986740B2
A method for gaming, including receiving from a client device of a user selection of a video recording of game play of a player for a gaming application, and streaming the video recording to the client device. The video recording is associated with a snapshot captured at a first point in the recorded game play. Selection of a jump point in the recorded game play is received from the client device. An instance of the gaming application is initiated based on the snapshot to initiate a jump game play. Input commands used to direct the game play and associated with the snapshot are accessed. Image frames are generated based on the input commands for rendering at the client device, the image frames replaying the game play to the jump point. Input commands from the client device are handled beginning from the jump point for the jump game play.
US11986730B2
Provided is an information processing program for causing a computer to function as: a game executing unit that executes a predetermined game on the basis of an operation of a player; a skip-game executing unit that executes the game while omitting at least a portion of functions of the game; a reward assigning unit that assigns a predetermined reward when the game is cleared; and a display control unit that displays a plurality of the games of each of which at least a portion of the functions can be omitted, wherein the skip-game executing unit collectively executes games selected from among the plurality of displayed games.
US11986721B2
An interactive exercise method includes streaming exercise content to an interactive video system for display via a mirror, the exercise content including a depiction of an instructor performing a repetitive movement. A video stream of a user performing the repetitive movement is received, via a camera of the interactive video system, and the user is detected in the video stream. The user or a body portion thereof is tracked in the video stream as the user performs the repetitive movement. The method also includes generating a measure of a difference between a form of the user performing the repetitive movement and a predetermined form for the repetitive movement. A corrective movement is displayed to the user, via the display and during the display of the instructor performing the repetitive movement, based on the measure, to conform the form of the user to the predetermined form for the repetitive movement.
US11986719B2
A software driven method for allowing amateur golfers to interact with a professional golfer utilizing inter alia, real life golf professional video footage, the method including a library of stored digitized video clips of a professional golfer hitting golf shots on a golf course while golf swing data of each shot is being taken by a launch monitor, video clips of the professional golfer discussing strategy for how his/her golf shot is or was attempted to be played, the professional golfer's golf swing data converted to a golf ball path that gets displayed against the backdrop of a virtual golf hole replicating the physical golf hole the golf shot was taken on, the software user's golf swing data, taken by a launch monitor and converted to a golf ball path displayed against the backdrop of the same virtual golf hole that the professional golfer's golf ball path is displayed on, and wherein the simulator software is configured to allow the user to play a simulated game of golf in tandem with the professional golfer and compare results to that of the professional golfer. The digitized archive of video clips includes clips taken from many years of professional golf play, allowing for clips from retired golfers or golf professionals.
US11986712B2
An apparatus for mounting accessories to a golf cart roof that includes an elongated attachment member extending between the front and rear or the left and right side of the roof and secured to the roof by a slotted base, fasteners, or compression connectors. The apparatus allows accessories, such as curtains or wind screens to be quickly and easily attached to or detached from a golf cart.
US11986710B2
A golf club head includes a body, a first polymeric insert, and a second polymeric insert. The body includes a face, a sole, and a rear wall that collectively define an undercut volume. The first polymeric insert is provided within the undercut volume to define a sealed cavity within the undercut volume; and, the second polymeric insert is secured to the body and defines an open cavity extending from the rear wall toward the face.
US11986709B2
A golf club head that is capable of preserving the metallic acoustic signature of an entirely metallic golf club head all while utilizing a lightweight composite material is disclosed herein. More specifically, the golf club head in accordance with the present invention creates a frontal acoustic chamber in conjunction with a rear weight saving chamber via a panel member barrier is disclosed. The panel member may even be combined with an optimized thickness relationship at the transition region between the striking face portion and the panel member to further optimize the performance of the golf club head.
US11986707B2
A golf club may include a head having a body and a faceplate coupled to the body. The faceplate may have a maximum thickness at a central location and a cross-section intersecting the central location. The cross-section may have continuously variable wall thickness across the faceplate. The faceplate may have a closed non-convex contour curve defined by constant faceplate wall thickness that encloses the central location.
US11986704B2
A sports ball easy loading and unloading apparatus assists a user loading, unloading, and sorting balls in a container by selectively elevating the container holding the balls, which minimizes stooping repeatedly to access the sports balls. The apparatus provides a first container configured to contain sports balls. The first container is disposed inside a second container having a larger diameter. The first container can elevate and lower in relation to second container. A spring-loaded elevator is disposed inside the second container, and beneath the floor wall of first container. The spring-loaded elevator comprises a spring that biases to expand, and turntables configured to lock the spring at desired positions. In this manner, the spring-loaded elevator enables selective elevation, lowering, and positional locking of the first container for easy loading/unloading of balls. A user can also sit on a lid atop the first container when fully compressed inside second container.
US11986703B2
Buoyant dimpled golf ball having CoR ≥0.810, specific gravity <1.00 g/cc, initial velocity ≥250 ft/s, first aerodynamic coefficient magnitude between about 0.25 and about 0.30 and first aerodynamic force angle between about 29 degrees and 34 degrees at Reynolds Number of 230000 and spin ratio of 0.085; and second aerodynamic coefficient magnitude between about 0.26 and about 0.31 and second aerodynamic force angle between about 31 degrees and 36 degrees at Reynolds Number of 180000 and spin ratio of 0.101. Golf ball may additionally have third aerodynamic coefficient magnitude between about 0.27 and about 0.32 and third aerodynamic force angle between about 34 degrees and 39 degrees at Reynolds Number of 133000 and spin ratio of 0.133; and fourth aerodynamic coefficient magnitude between about 0.33 and about 0.38 and fourth aerodynamic force angle between about 38 degrees and 43 degrees at Reynolds Number of 89000 and spin ratio of 0.183.
US11986701B2
A resistance force is controlled such that a user's effort against the resistance force results in a first isokinetic seed movement. The resistance force required to effect the first isokinetic seed movement is associated with a force-velocity profile. It is determined whether a sufficient number of isokinetic seed movements have been performed by the user. In response to a determination that the sufficient number of isokinetic seed movements have been performed by the user, a strength determination of the user is made based on the isokinetic seed movements performed by the user.
US11986694B2
Systems and methods are disclosed for releasably securing items such as health, medical, fitness, and exercise equipment, in which anchor units are securely attachable directly or indirectly to a surface and are securely but releasably attachable to a plurality of items. The anchor unit may have a mounting base attachable to a surface, a fitting bracket that at one end may be permanently attachable or securely but releasably attachable to the mounting base, and an attachment subsystem for releasably, tightly, and securably attaching the mounting base to the fitting bracket. At its other end, the fitting bracket may be attachable to multiple items, or it may be permanently attachable to a selected item.
US11986693B2
The present invention relates to a wearable device using a flexible non-powered variable impedance mechanism, wherein the device can induce a user to have a correct posture during a squat exercise or lifting work, and can assist the user's muscular strength. According to the present invention, an angle between a (1-1)th lower string and a (1-2)th lower string and an angle between a (24)th lower string and a (2-2)th lower string change according to a knee angle depending on the user's posture, whereby an impedance mechanism that the user feels through the body changes.
US11986692B2
Disclosed is a mixture comprising the compound trans-1,1,1,4,4,4-hexafluoro-2-butene and at least one additional compound selected from the group consisting of HFOs, HFCs, HFEs, CFCs, CO2, olefins, organic acids, alcohols, hydrocarbons, ethers, aldehydes, ketones, and others such as methyl formate, formic acid, trans-1,2 dichloroethylene, carbon dioxide, cis-HFO-1234ze+HFO-1225yez, mixtures of these plus water; mixtures of these plus CO2; mixtures of these trans 1,2-dichloroethylene (DCE); mixtures of these plus methyl formate; mixtures with cis-HFO-1234ze+CO2, mixtures with cis-HFO-1234ze+HFO-1225yez+CO2, and mixtures with cis-HFO-1234ze+HFC-245fa. Also disclosed are methods of using and products of using the above compositions as blowing agents, solvents, heat transfer compositions, aerosol propellant compositions, fire extinguishing and suppressant compositions.
US11986691B1
Fire protection sprinkler assemblies and methods thereof having thermally responsive glass bulb trigger arrangements for suppression mode fast response fire protection in which the glass bulb trigger arrangements provide a consistent thermal response.
US11986689B2
Water mist fire protection systems and methods for the protection of data centers having a raised floor defining an interstitial space beneath the floor. The systems and methods include the location of a plurality of automatic water mist nozzles above and/or beneath the floor to generate a water mist for effectively addressing a fire in the presence of a flow of forced air ventilation through the interstitial space. The systems and methods of water mist fire protection include the interconnection of the automatic water mist nozzles to a water supply to provide for dry pipe or preaction systems and methods. Water mist fire protection of data cen-ters using fire propagating cable is also provided.
US11986688B2
The present invention relates to a cobra automatic fire extinguishing device capable of loading a fire extinguisher. The cobra automatic fire extinguishing device can automatically spray extinguishing fluid to a location of a fire by mounting a fire extinguisher inside, detecting the location of the fire, and directing the nozzle to the location of the fire. In addition, the cobra automatic fire extinguishing device can be installed economically since it does not require additional cost and time for manufacturing a separate, dedicated fire extinguisher and certification procedure. Furthermore, the cobra automatic fire extinguishing device can effectively extinguish a fire by precisely spraying the extinguishing liquid to the location of the fire, and can prevent conflagration by suppressing the initial fire.
US11986674B2
The present disclosure relates to a system and a method. The system may include a magnetic resonance imaging (MRI) apparatus configured to acquire MRI data with respect to a region of interest (ROI) and a therapeutic apparatus configured to apply therapeutic radiation to at least one portion of the ROI. The MRI apparatus may include a plurality of main magnetic coils arranged coaxially along an axis, a plurality of shielding magnetic coils arranged coaxially along the axis, and a cryostat in which the plurality of main magnetic coils and the plurality of shielding magnetic coils are arranged.
US11986672B2
Information that describes a target inside a patient to be treated with radiation is accessed from computer system memory. An arrangement of spots inside the target is determined. Each the spots corresponds to a location inside the target where a respective beam of radiation is to be directed during radiation treatment of the patient. A dose rate for each of the beams is determined. The dose rate for each beam is a dose delivered in less than one second to a spot corresponding to that beam. For example, each beam can deliver at least four grays (GY) in less than one second, and may deliver as much as 20 Gy to 50 Gy or 100 Gy or more in less than one second. A radiation treatment plan, that includes the arrangement of the spots and the dose rate for each of the beams, is stored in computer system memory.
US11986671B2
Methods are provided for permitting manipulation of an achievable dose distribution estimate deliverable by a radiation delivery apparatus for proposed treatment of a subject. One such method comprises: determining a dose modification voxel for which it is desired to modify the dose value and a corresponding magnitude of desired dose modification; for each of a plurality of beams: (i) characterizing the beam as a two-dimensional array of beamlets, wherein each beamlet is associated with a corresponding intensity value and a ray line representing the projection of the beamlet into space; and (ii) identifying one or more dose-change beamlets which have associated ray lines that intersect the dose modification voxel; modifying the intensity values of at least one of the dose-change beamlets; and updating the achievable dose distribution estimate to account for the modified intensity values of the at least one of the dose-change beamlets.
US11986666B2
Illumination devices for impinging light on tissue, for example within a body cavity of a patient, to induce various biological effects are disclosed. Biological effects may include at least one of inactivating and/or inhibiting growth of one or more pathogens, upregulating a local immune response, increasing endogenous stores of nitric oxide, releasing nitric oxide from endogenous stores, and inducing an anti-inflammatory effect. Biological effects may include upregulating and downregulating inflammatory immune response molecules within a target tissue. Wavelengths of light are selected based on intended biological effects for one or more of targeted tissue types and targeted pathogens. Light treatments may provide multiple pathogenic biological effects, either with light of a single wavelength or with light having multiple wavelengths. Devices for light treatments are disclosed that provide light doses for inducing biological effects on various targeted pathogens and tissues with increased efficacy and reduced cytotoxicity.
US11986662B2
Generally discussed herein are systems, devices, and methods for providing a therapy (e.g., stimulation) and/or data signal using an implantable device. Systems, devices and methods for interacting with (e.g., communicating with, receiving power from) an external device are also provided.
US11986661B2
Methods and devices for reducing ventricle filling volume are disclosed. In some embodiments, an electrical stimulator may be used to stimulate a patient's heart to reduce ventricle filling volume or even blood pressure. When the heart is stimulated in a consistent way to reduce blood pressure, the cardiovascular system may over time adapt to the stimulation and revert back to the higher blood pressure. In some embodiments, the stimulation pattern may be configured to be inconsistent such that the adaptation response of the heart is reduced or even prevented. In some embodiments, an electrical stimulator may be used to stimulate a patient's heart to cause at least a portion of an atrial contraction to occur while the atrioventricular valve is closed. Such an atrial contraction may deposit less blood into the corresponding ventricle than when the atrioventricular valve is opened throughout an atrial contraction.
US11986656B2
A cochlear implant including a cochlear lead, an antenna, a stimulation processor, and a magnet apparatus, associated with the antenna, including a case defining a central axis, a magnet frame within the case and rotatable about the central axis of the case, and a plurality of elongate diametrically magnetized magnets that are located in the magnet frame, the magnets defining a longitudinal axis and a N-S direction and being freely rotatable about the longitudinal axis relative to the magnet frame.
US11986653B2
A wireless implant and associated system for motor function recovery after spinal cord injury, and more particularly a multi-channel wireless implant with small package size. The wireless implant can further be used in various medical applications, such as retinal prostheses, gastrointestinal implant, vagus nerve stimulation, and cortical neuromodulation. The system also includes a method and its implementation to acquire the impedance model of the electrode-tissue interface of the implant.
US11986647B2
Autoinflammatory and mitochondrial disorders can be treated by positioning a plurality of electrodes in or on a subject's body, and applying an AC voltage between the plurality of electrodes so as to impose an alternating electric field through the tissue that is being affected by the autoinflammatory or mitochondrial disease. The frequency and field strength of the alternating electric field are selected such that the alternating electric field inhibits inflammation or mitochondrial disorders in the tissue.
US11986644B2
There is provided herein, a method for adjusting a VAD device parameters using a wearable device placed on the patient's hand, the method includes the steps of acquiring a set of signals from sensors in the wearable device, computing at least one quality metric, and adjusting at least one VAD operational parameter so as to optimize at least the one quality metric.
US11986639B2
An add-on device adapted to be releasably mounted on a drug delivery device, the add-on device comprising an outer assembly with an add-on dose setting member adapted to be coupled to the outer housing of a pen housing, as well as an inner sensor assembly engaging the pen dose setting member and being in rotational engagement with the add-on dose setting member during dose setting. The invention addresses the issue of providing a stable inner platform for the sensor means, which in accordance with the invention is realized by actuating a clutch between the pen housing and the pen dose setting member during dose sensing, this preventing to a high degree that the inner sensor assembly rotates relative to the drug delivery housing during actuation of the drug expelling means.
US11986637B2
The present disclosure relates to a state indicator designed for indicating at least three states (S1 to Sn) of a drug delivery device and formed as a single indicator for indicating a respective state (S1 to Sn) at least before injection, during injection and after injection.
US11986634B2
A medicament delivery device includes a device housing for placing on the skin of a patient, the housing including a needle aperture; a needle for injecting a medicament, the needle arranged to pass through the needle aperture; and sensors configured to provide a signal when the housing is placed on the skin of the patient. The sensors are arranged around the needle aperture.
US11986631B2
Techniques for modeling therapy fields for therapy delivered by medical devices are described. Each therapy field model is based on a set of therapy parameters and represents where therapy will propagate from the therapy system delivering therapy according to the set of therapy parameters. Therapy field models may be useful in guiding the modification of therapy parameters. As one example, a processor compares an algorithmic model of a therapy field to a reference therapy field and adjusts at least one therapy parameter based on the comparison. As another example, a processor adjusts at least one therapy parameter to increase an operating efficiency of the therapy system while substantially maintaining the modeled therapy field.
US11986627B1
The present invention relates to titration and delivery of anesthetic and sedative medications to a subject. Further, the present invention relates to a device and methods for titrating and delivering the medications in a semi-automated or fully automated manner and which can be monitored and controlled remotely. Even still further, the present invention relates to the device that can perform the titration and the delivery of the medications in a manner that minimalizes occlusion and prevents back flow of the medications. More particularly, the present invention relates to the device for the titration and the delivery of the medications using a non-concentric pumping mechanism that gradually or progressively increases and decreases occlusion in a medication delivery line within the pumping mechanism to minimize and/or prevent sudden formation and release of the occlusion in order to provide more steady and continuous flow of the medications through the device to the subject.
US11986623B2
A method and system for monitoring and managing a remote infusion regimen where a prescribed infusion regimen is provided and compared to subsequent infusion event data to determine if the data falls within predetermined parameters. If the data does not fall within predetermined parameters a monitoring technician, supportive caregiver, patient or some combination thereof are immediately notified so that corrective action may be taken.
US11986620B2
A fluid-fitting tool is disclosed that can align with and rotationally couple with a fluid fitting where the fluid-fitting tool can include a passage and an engagement feature for engaging against the fluid fitting such that when the fluid-fitting tool is spaced apart from the fluid fitting, the fluid-fitting tool can move in a longitudinal direction toward and away from the fluid fitting, and can rotate relative to the fluid fitting around a longitudinal axis of the passage, and when a portion of the fluid-fitting tool and the fluid fitting are rotationally aligned and longitudinally overlap, the fluid-fitting tool can move longitudinally relative to the fluid fitting, and the fluid fitting is rotated when the fluid-fitting tool is rotated around a longitudinal axis of the passage.
US11986617B2
A connector for medical fluid vessels includes a fluid-seal fitting such as a male plug defining a lumen and mating with a cooperating connector, a mechanical fastener such as a screw thread for mating with the cooperating connector, and an outer housing positioned around the plug to form an annular space. Optionally, a cap can be provided with a fluid-seal fitting such as a male plug for mating with the lumen of the connector. The connector includes one or more vent openings for drainage and air-drying of any residual fluid in the annular space when capped, as well as for breaking a vacuum to prevent fluid backflow and thus ensure more accurate dosing. In some embodiments, the vent openings are provided in the outer housing. And in some embodiments, the vent openings are provided in the cap.
US11986615B2
Embodiments of an actuating device for actuating a needle cartridge and puncturing an epidermis with controlled depth. The actuating device includes a motor housed in a motor housing, an actuating rod driven by the motor and configured to actuate in a reciprocating motion, and an adjustment mechanism. The actuating rod is housed in a rod housing, the rod housing forming a device aperture configured to receive a needle cartridge and to attach to the needle cartridge. The adjustment mechanism interfaces with the rod housing and is configured to adjust a position of the rod housing relative to the motor housing while not rotating the rod housing relative to the motor housing.
US11986610B2
Aspects of the present disclosure include catheter devices in which a bushing is disposed in an interior cavity of a catheter hub. The bushing has a flexible portion extending out a distal end of the catheter hub. A catheter tube is sleeved over the flexible portion. A needle hub with a needle projects through the flexible portion of the bushing and the catheter tube. The flexible portion is bendable to form at least one curve along the flexible portion. The at least one curve has a minimum bend radius when a first surface of the flexible portion is extended and a second surface opposite the first surface of the flexible portion is shortened.
US11986609B2
An external drive unit for an implantable heart assist pump is provided. The drive unit comprises a motor housing, a transcutaneous drive shaft and a motor for driving the heart assist pump. The motor is connectable to the heart assist pump via the drive shaft, and the motor is arranged inside the motor housing. The drive unit further comprises a catheter surrounding the drive shaft and a purge line for injecting a purge medium into a lumen of the catheter or into a space between the catheter and the drive shaft. The purge line is in thermal contact with an outer surface of the motor housing and/or with an outer surface of a proximal section of the catheter. Due to the thermal contact heat is transferred from the outer surface of the catheter in the proximal section and/or from the outer surface of the motor housing to the purge medium.
US11986606B2
An instrument (203; 204) for endoscopic applications. The instrument is able to be guided through a curved shaped tube (201; 202) and has an intermediate cylindrical element (3) with a handling end portion with a flexible portion and actuating means located at an actuating end portion. The intermediate cylindrical element (3) has a first cylindrical part (31; 151) at the handling end portion, a second cylindrical part (35; 155) at the actuating end portion and a number of longitudinal elements (38; 60; 70; 80; 90; 100; 110; 130; 153) for transferring the movement of the actuating means to the handling end portion. The longitudinal elements are separated by longitudinal slits in the intermediate cylindrical element.
US11986604B2
An intravascular blood pump for percutaneous insertion comprises a catheter (10) and a pumping device (1) attached to the catheter (10). The catheter (10) extends along a longitudinal axis and has a distal end (11) and a proximal end (12) opposite the distal end (11). The catheter (10) comprises an elongate stiffening structure (15) extending continuously longitudinally along the length of the catheter (10) between the proximal end (11) and the distal end (12) of the catheter (10). The stiffening structure (15) may comprise a shape-memory material, such as Nitinol. It may be in the form of a wire that extends loosely through the lumen of the catheter and helps to avoid or significantly reduce kinks in the catheter.
US11986601B2
Devices and methods are described that aid in harmonizing a person with their bodies and/or their environment.
US11986591B2
Methods and apparatus treat a respiratory disorder. For example, a pressure generator supplies a flow of air at positive pressure to a patient's airway through a patient interface. A sensor generates a signal representing respiratory flow rate of the patient. A controller controls the pressure generator to provide to the patient interface a ventilation therapy having a base pressure. The controller computes a measure of ventilation of the patient from the signal. The controller computes a measure of flow limitation from an inspiratory portion of the signal. The controller computes a ratio of the measure of ventilation and an expected normal ventilation. The controller adjusts a set point for the base pressure of the ventilation therapy based on the measure of flow limitation. The adjustment may further depend on a comparison between the ratio and a relative ventilation threshold that increases as the measure of flow limitation increases.
US11986590B2
A vaporization device is described that includes a cartridge having a wicking element that can efficiently and effectively draw vaporizable material contained in a reservoir of the cartridge to a heating element for vaporizing the vaporizable material. In some embodiments, the wicking element includes a hollow core or a thermally conductive core surrounded by a porous wicking material. Various embodiments of the wicking element are described, as well as related systems, methods, and articles of manufacture.
US11986586B2
To reduce the suffering of the patient and enable easier removal of excess fluid such as pleural effusion fluid from the chest space, the disclosure provides a catheter for chest drainage intended for removal of excess fluid from a chest space of a living body and to be placed in the living body in such a manner as to extend from an inside of the chest space to an outside of the living body. The catheter includes a passage member formed of a flexible sheet and having a passage through which the excess fluid is to be drained, and an indwelling member formed of an elastic body and provided at a proximal end of the passage member. The indwelling member has an inlet that allows the excess fluid to flow through. The indwelling member includes a retaining portion spreading in a flange shape and being retainable at a chest wall.
US11986580B2
The present disclosure provides a wearable breast pump, including a host machine, a cup and a flowing channel unit. The host machine includes a variable pressure chamber. The cup is detachably connected to the host machine through the variable pressure chamber. The flowing channel unit is detachably arranged inside the cup and separates an internal space of the cup into a flowing channel and a milk storage bowl. The flowing channel is communicated with the variable pressure chamber, the milk storage bowl and the outside. The wearable breast pump has the flowing channel unit arranged inside the cup, achieving structural optimization, whereby making the structure more concise and the shape more beautiful, as well as increasing the integration level and reducing the occupied space.
US11986576B2
An air-treating apparatus for dispensing a volatilizable material, such as air freshener fragrance, into the atmosphere of an enclosed area. The apparatus includes a housing and a reservoir of the volatilizable material therein, and also includes a multiple-configured air flow path arrangement which enables air-flow through the apparatus in multiple configurations. The apparatus enables use of the consistent delivery rates of a volatilizable material producing a more consistent delivery rate than normally achieved with such devices.
US11986573B2
A device includes a substrate and a hydrophilic polymer layer made of a hydrophilic polymer having a hydroxyl group. The hydrophilic polymer layer having a hydroxyl group is fixed to at least a part of a surface of the substrate and the hydrophilic polymer further has an amide group. A liquid film retention time of the device is 15 seconds or more. The device has a surface of a substrate which is hydrophilized. A method for producing the device by a simple method is also disclosed.
US11986565B2
A system and method for sterilizing a wheelchair, stretcher or the like, that comprises an intravenous (IV) pole attaching to the wheelchair or stretcher having an electrical connector at the pole top, and a reflective drape having an interior lined with UV LED lights that electrically connects to the connector on top of the IV pole when draped over the wheelchair or stretcher. The UV LED lights sterilize the wheelchair or other equipment that is under the drape after a period of exposure to UV radiation without using disinfectant chemical sprays or wiping with disinfectant cloths and without staff attention.
US11986564B2
A steam sterilizer having a door movable relative to an opening between a first open position and a second closed position. A plurality of spaced-apart roller assemblies are aligned along edges of the door to align the door relative to the opening as the door moves between the open and closed position. Each of the roller assemblies are comprised of a cylindrical roller having an outer annual recess extending along the periphery thereof. The recess is dimensioned to receive a lateral edge of the door. The roller is mounted on a shaft and is movable against a biasing force axially along the axis of the shaft.
US11986562B2
Disclosed herein are composite materials, ionic liquid compositions for preparing the composite materials, and methods for using the composite materials prepared from the ionic liquid compositions. The composite materials typically include structural polymers and nitric oxide releasing agents, and preferably photo-reactive nitric oxide releasing compounds or complexes. The composite materials may be prepared from ionic liquid compositions comprising the structural polymers and the nitric oxide releasing agent, where the ionic liquid is removed from the ionic liquid compositions to obtain the composite materials. The composite materials may be used in applications include dressing for wounds, where the nitric oxide releasing agents may be induced to release nitric oxide in order to inhibit microbial growth and promote healing.
US11986560B2
The system invention describes a support and improved method of application and removal. The support, comprised of a network of flexible, non-porous, multi-lumen tubing interlaces at a plurality of junctions to form a lattice structure. Apertures designed to accommodate boney prominences also permit air or water to reach the skin underneath and encourage rapid fluid flow internally through the lattice. A hydrophobic, thermal-resistant, flowable padding layer is injected within a secondary lumen to the lattice structure, spanning its complete surface area. As a result, the breathability of the support is not affected by this padding layer because it mirrors the apertures of the lattice. At least one liquid is injected into the structure and configured to transform into a solid when acted on by an external mechanical stimulus.
US11986558B2
The present invention relates to a drug delivery system, in particular for a controlled administration of one or more active pharmaceutical ingredients to a body, and further in particular for oral administration of one or more active pharmaceutical ingredients to a body. The system thereby comprises a base component soluble in body fluids and a separate first component soluble in body fluids. The first component thereby comprises a therapeutically effective amount of a first active pharmaceutical ingredient.
US11986552B2
A cosmetic active principle including a hydrolysate of Pichia minuta comprising at least peptides. Additionally, the use of the cosmetic active principle including a hydrolysate of Pichia minuta comprising at least peptides for controlling hair loss and stimulating regrowth. Also, compositions containing same and a cosmetic hair treatment method.
US11986550B1
A lip composition. The lip composition may include at least 40% by weight of one or more emollients, at least 20% by weight of waxes, the waxes including a hard wax and a soft wax, and a plurality of fillers including silica silylate and cellulose. The lip composition may be free of water and silicones, and may be vegan. The lip composition preferably includes no more than 6% by weight of fillers, and preferably includes no more than about 3% by weight of colorants.
US11986543B2
A rinse-off cleansing composition with improved viscosity. The rinse-off cleansing composition contains a surfactant system with an anionic surfactant, an amphoteric surfactant, and a non-ionic surfactant. The surfactant system is substantially free of sulfate-based surfactants
US11986535B2
The present invention relates to a method of producing an immunoligand/payload conjugate, which method encompasses conjugating a payload to an immunoligand by means of a sequence-specific transpeptidase, or a catalytic domain thereof (Fig. 6b).
US11986532B2
Bifunctional compounds, which find utility as modulators of B-cell lymphoma 6 protein (BCL6; target protein), are described herein. In particular, the bifunctional compounds of the present disclosure contain on one end a cereblon ligand that binds to the respective E3 ubiquitin ligase and on the other end a moiety which binds the target protein, such that the target protein is placed in proximity to the ubiquitin ligase to effect degradation (and inhibition) of target protein. The bifunctional compounds of the present disclosure exhibit a broad range of pharmacological activities associated with degradation/inhibition of target protein. Diseases or disorders that result from aggregation or accumulation of the target protein are treated or prevented with compounds and compositions of the present disclosure.
US11986530B2
Provided is a curcumin pharmaceutical preparation that is highly water soluble, can maintain the concentration of free curcumin in the blood sufficiently high by being administered parenterally, can effectively obtain a pharmacological action of curcumin, and is highly safe. A pharmaceutical composition for parenteral administration, including a water-soluble substance conjugate of curcumin as an active component.
US11986529B2
The pharmaceutical compositions described herein include a suspension which comprises an admixture in solid form of a therapeutically effective amount of a therapeutic agent and at least one salt of a medium chain fatty acid and a hydrophobic medium, e.g. castor oil or glyceryl tricaprylate or a mixture thereof. The pharmaceutical compositions described herein contain medium chain fatty acid salts and are substantially free of alcohols. The pharmaceutical compositions may be encapsulated in a capsule. Methods of treating or preventing diseases by administering such compositions to affected subjects are also disclosed.
US11986525B2
Provided herein is a method of treating a traumatic brain injury in a subject in need thereof, the method including administering to the subject a therapeutically effective amount of radiation. The methods can improve motor function recovery and reverse motor function deficits after traumatic brain injury and/or ischemic stroke in a subject.
US11986524B1
Biochemical scaffolds for treating menopausal symptoms. The biochemical scaffolds include a base liquid medium, a bioenergetic platform and a vibrational platform. The bioenergetic platform includes at least one Krebs cycle modulator and/or neurotransmitter modulator and/or nuclear hormone receptor modulator. The vibrational platform includes at least one energy signature component, e.g., an herb. The biochemical scaffold is subjected to sequential harmonic oscillation for a defined, predetermined period of time, wherein the energy signature of the energy signature component is imparted to, captured, replicated, and retained by the liquid medium, and, when the biochemical scaffolds are delivered to and, thus, in communication with biological tissue, the biochemical scaffolds induce specific biochemical activities via the resonant transfer of the retained energy signature to the biological tissue and, hence, endogenous cells thereof.
US11986518B2
This invention relates to immunogenic compositions, particularly vaccine compositions, for use in providing protection against illness caused by bacterial infection with Shigella strains.
US11986511B2
The present invention provides methods for treating angiogenic eye disorders by sequentially administering multiple doses of a VEGF antagonist to a patient. The methods of the present invention include the administration of multiple doses of a VEGF antagonist to a patient at a frequency of once every 8 or more weeks. The methods of the present invention are useful for the treatment of angiogenic eye disorders such as age related macular degeneration, diabetic retinopathy, diabetic macular edema, central retinal vein occlusion, branch retinal vein occlusion, and corneal neovascularization.
US11986507B1
A micronutrient composition shown as Mix 1 comprises Rosemary extract at 1 mg-6,000 mg, Fenugreek extract 1 mg-50,000 mg and Fenugreek seed powder at 2 mg-8,000 mg, Cassia nomane seed extract powder 1 mg to 1,000 mg and dry extract 1 mg-300 mg, 3′3-di indolylmethylene 1 mg-800 mg, Zinc 0.1 mg-1,000 mg, Phosphatidylserine 1 mg-1,500 mg, Vitamin D 20 IU-10,000 IU, Vitamin C 10 mg-50,000 mg, Niacin 1 mg-3,000 mg, Theanine 0.1 mg-10,000 mg, Aspartic acid 10 mg-10,000 mg, Arginine 10 mg-50,000 mg and Dehydroepiandrosterone (DHEA) 1 mg-500 mg and Mix A comprising of all the ingredients of Mix 1 but does not contain DHEA and both are used improve men's health.
US11986506B2
The invention discloses synergistic compositions comprising extracts, fractions or pure compounds derived from at least two herbs selected from Punica granatum, Mangifera indica and Garcinia mangostana for inhibiting the expression/production/activity of Phosphodiesterase 5 (PDE5) enzyme or for increasing cGMP levels in a male subject. The invention further discloses a method of inhibiting the expression/production/activity of Phosphodiesterase 5 (PDE5) enzyme, increasing cGMP levels and sexual arousal, treating/alleviating various aspects of male sexual dysfunction or impotence such as erectile dysfunction, loss of libido, or orgasm/ejaculation disorders in a male subject by using a suitable dose of synergistic composition comprising extracts, fractions or pure compounds derived from at least two herbs selected from Punica granatum, Mangifera indica and Garcinia mangostana.
US11986503B2
The present invention relates generally to the fields of oncology, virology and immunotherapy. More particularly, it concerns the use of poxviruses, specifically the replication competent attenuated vaccinia virus with deletion of thymidine kinase (VC-TK−) with and without the expression of human Flt3L or GM-CSF as oncolytic and immunotherapy. The foregoing poxviruses can also be used in combination with immune checkpoint blocking agents. The foregoing poxviruses can also be inactivated via Heat or UV-treatment and the inactivated virus can be used as immunotherapy either alone or in combination with immune checkpoint blocking agents.
US11986500B2
This document discusses, among other things, receiving a plurality of donor fecal samples from a plurality of donors and storing and indexing each respective donor fecal samples using at least one characteristic of the respective donor fecal sample. In an example, the donor fecal sample can be screened and processed for subsequent use in fecal bacteriotherapy to displace pathogenic or undesired organisms in the digestive track of a patient with healthy or desirable gut microbiota.
US11986489B2
The present invention is directed to methods of enhancing toxicity of a glycolytic dependent compound towards a cancerous tissue and/or organ in a subject, the method being comprised of targeting the glycolytic dependent compound to the cancerous tissue and/or organ by placing oxidized regenerated cellulose (ORC) and/or oxidized cellulose (OC) in direct connection with the cancerous tissue and/or organ, and administering the glycolytic dependent compound to the subject by a systemic route.
US11986485B1
Disclosed herein are compositions and methods for delivering compositions to a subject in need of treatment for epilepsy. The disclosed compositions are orally delivered. Further disclosed are kits comprising the disclosed compositions as part of a method of delivering cannabidiol and CBD-containing compositions to subjects in need of treatment for epilepsy.
US11986465B1
A 2-amino-4-(4-bromophenyl)-6-ethoxypyridine-3,5-dicarbonitrile as an antibacterial compound, its synthesis, and its use as an antibacterial agent.
US11986463B2
The present disclosure relates to the use of 1-[4-bromo-5-[1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl]-2-fluorophenyl]-3-phenylurea or 1-(5-(7-amino-1-ethyl-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-4-bromo-2-fluorophenyl)-3-phenylurea, or a pharmaceutically acceptable salt thereof, in combination with a MAPKAP kinase inhibitor for the treatment of cancers, including c-KIT-mediated cancers, such as GIST.
US11986454B1
The invention relates to methods for decreasing adverse effects associated with solriamfetol ([R]-2-amino-3-phenylpropylcarbamate) therapy in subjects with impaired renal function. In particular, the invention provides an optimized dose escalation scheme for subjects with moderate renal impairment which results in the subjects having increased tolerance to adverse effects associated with the administration of solriamfetol. The invention also provides adjusted dosing for safe therapeutic use of solriamfetol in subjects having severe renal impairment.
US11986452B2
In various embodiments, the present disclosure provides methods reducing the risk of heart failure in a subject on statin therapy by administering to the subject a pharmaceutical composition comprising about 1 g to about 4 g of eicosapentaenoic acid ethyl ester or a derivative thereof.
US11986448B2
A method of compounding a topical cream includes combining ingredients including lidocaine hydrochloride, 4%, topical solution, diclofenac sodium, 1.5%, topical solution, lidocaine hydrochloride USP powder, and diclofenac sodium powder.
US11986445B2
A synthetic nutritional composition comprising choline for use to promote, support or optimise de novo myelination, in particular the de novo myelination trajectory, and/or brain structure, and/or brain connectivity, and/or intellectual potential and/or cognitive potential and/or learning potential and/or cognitive functioning in a subject, in particular a formula fed subject.
US11986438B2
A myofascial release apparatus can include a head member and a shaft configured to couple to the head member and to releasably mount the head member to a weightlifting rack. This can be accomplished, for example, by threading the shaft of the apparatus through apertures on a support member of the weightlifting rack and placing a securing member or securing loop on the shaft to prevent the shaft from retreating through the support member during use. The apparatus can be included in a kit having one or more of the following additional components: a washer, a magnet, collars, two or more additional head members, or a handle. The head members can be any suitable shape, including a blunt nub head, a precision nub head, and/or a broad nub head.
US11986436B2
A jet pump has an impeller with a magnet that can be rotated by a shaft having a magnetic drive plate and wherein the impeller and the magnetic drive plate are separated from one another by at least one solid wall surface. The impeller can be located in a pump housing having a base and a cover. The base can have a surface bearing so that the impeller can contact therewith and rotated against the surface of the surface bearing.
US11986433B2
The invention relates to a shock wave apparatus for treating the human or animal body with an applicator which is intended to couple strokes into the body and has a hollow shape at a front area intended to be placed on the body and a relatively soft elastomeric material with a maximum Shore A hardness of 60 Sh.
US11986417B2
The present invention relates to a method of replenishing a system for injecting a substance into the patient's body, when the system is implanted in the patient's body. The method involves replenishing the implanted reservoir by a replenishing needle penetrating the patient's skin and injecting infusion liquid comprising the substance through the replenishing needle directly or indirectly into the reservoir.
US11986410B2
Devices for palliating gastrointestinal strictures using rapid exchange type enteral stent placement catheters. The catheter may include an inner member and an outer member, with the two members being slidable with respect to one another. In various device embodiments, a ramp for directing a guidewire out from within the catheter is provided using portions of the outer member or a shaped mandrel. The inner member may take a number of forms, including a tubular distal portion, a skived or integrally attached elongate midsection, and a proximal portion. A mandrel can be used in a portion proximal of the guidewire ramp, with the mandrel taking one of several disclosed forms.
US11986407B2
An illustrative stent may comprise an elongated tubular member having a first end and a second end and an intermediate region disposed therebetween. The elongated tubular member configured to move between a collapsed configuration and an expanded configuration. The elongated tubular member may comprise at least one twisted filament, such as a knitted filament having a plurality of twisted knit stitches with intermediate rung portions extending between adjacent twisted knit stitches, or a plurality of helical filaments twisted with a plurality of longitudinal filaments.
US11986400B2
A magnetic impactor assembly is described herein. The magnetic impactor assembly generally includes a guide receptacle, and an impactor guide magnetically coupled to the guide receptacle to form a magnetic interface therebetween. The guide receptacle is attachable to a surgical device such as a surgical robotic manipulator arm. The impactor guide receives and guides an impactor to permit a user to impact a prosthesis into a bone of a patient in a planned position and orientation. The magnetic impactor assembly reduces the transmission of excessive forces to a patient or the surgical device if an off-axis impaction force is generated on the impactor through the decoupling of the impactor guide from the guide receptacle.
US11986391B2
Mitral valve prolapse and mitral regurgitation can be treating by implanting in the mitral annulus a transvalvular intraannular band. The band has a first end, a first anchoring portion located proximate the first end, a second end, a second anchoring portion located proximate the second end, and a central portion. The central portion is positioned so that it extends transversely across a coaptive edge formed by the closure of the mitral valve leaflets. The band may be implanted via translumenal access or via thoracotomy.
US11986389B2
Systems, devices, and methods for treating a diseased native valve in a patient, the system comprising a compressible and expandable frame structure and an anchor. The anchor comprises a wire having a free end and is configured to be fully advanced from an atrial side of a native valve in a patient into a ventricle of the heart and anchor the frame structure to the native valve when the frame structure is in the expanded configuration adjacent the native valve.
US11986385B2
The present disclosure relates to holders for protecting intraocular lenses and methods of use. The holder includes a posterior wall and an annular wall extending anteriorly from the posterior wall and having an anterior edge. An internal space is defined by the posterior wall and the annular wall. The internal space is sized to receive a lens body of the intraocular lens. The holder also includes a locking feature configured to secure the intraocular lens. At least a portion of the locking feature is anterior to the intraocular lens when positioned in the holder.
US11986379B2
A composite includes a first substrate and a second substrate joined in a bonding region, wherein the first substrate comprises a first Peak Force Tensile Strength and the second Peak Force Tensile Strength. The first Peak Force Tensile Strength is greater than or equal to the second Peak Force Tensile Strength. The bonding region has a Bond Density of about 10% to about 22%; and a Composite Tensile Strength at Peak Force that is within about 15% of the second Peak Force Tensile Strength.
US11986373B2
A dental anchoring system for fastening prostheses having a male component, a female component which is coupled to the male component, and a connection element which is coupled to the female component and makes up the retaining element of the prosthesis configured to be joined to the connection element. The dental anchoring system is configured to achieve a self-adjustable fastening of the prosthesis which enables the mobility of prosthesis to be controlled when it is subjected to a load during the use thereof by a patient; and wherein the mobility is limited by a ring-shaped stop of the female component, when at least one portion of a ring-shaped plane of the connection element comes into contact with ring-shaped stop of the female component.
US11986370B2
Patterned dental positioning appliances including a shell including one or more cavities shaped to receive and exert repositioning forces on one or more teeth of a subject's dentition. An inner surface of at least a portion of the one or more cavities may include a raised mesh pattern arranged to contact one or more teeth within the at least a portion of the one or more cavities. The raised mesh pattern may be arranged to impart a contact force that affects one or more of a direction, a duration and a magnitude of the repositioning forces exerted on the one or more teeth. The raised mesh pattern may be is integrally formed with the shell and is made of the same polymer material as the shell.
US11986369B2
Methods and systems for determining a dental treatment difficulty in digital treatment planning. The methods may include calculating tooth position changes from an initial dental model to a target dental model in a mouth quadrant of a patient's dentition. The changes in position may be determined by projecting distances between initial positions and subsequent positions of teeth onto an arch line of the initial dental model. A treatment difficulty of anterior-posterior (A-P) correction may be determined for the mouth quadrant based on an average change in position, wherein a greater average change in position is associated with a higher treatment difficulty of A-P correction. The digital treatment plan may be adjusted so that a provider skill level meets or exceeds the treatment difficulty of A-P correction.
US11986368B2
A method of reducing counterfeit medicaments or reducing medicament abuse is provided, the method comprising making an oral appliance for delivering a medicament to teeth and/or soft tissue areas inside an oral cavity, the oral appliance comprising an interior surface having a medicament disposed in or on at least a portion of and/or all of the interior surface of the oral appliance, the interior surface being formed to fit contours of at least the portion of the teeth and/or soft tissue areas inside the oral cavity and being configured for holding the medicament in contact with at least the portion of the teeth and/or soft tissue areas inside the oral cavity to deliver the medicament thereto. In some embodiments, the oral appliance is used in a blockchain system.
US11986367B2
The invention relates to method of manufacturing a recess wall lined with bristles for a mouthpiece for simultaneously brushing at a plurality of dental positions, and to a recess wall and mouthpiece manufactured according to the method. In a providing step, an elongate, continuous, bristled sheet part having a first side lined with a plurality of bristles is provided. The elongate sheet part defines a length axis extending parallel to the sheet part and, viewed transverse to the length axis, a cross-sectional shape. The sheet part obtained in the providing step has an initial condition in which the cross-sectional shape has an initial shape, and the length axis is arch-shaped. In a transforming step, the sheet part of the providing step is transformed from the initial condition to a final condition to provide the recess wall. In the final condition the cross-sectional shape has a final U-shape, the length axis is arch shaped, and the first side is a concave inner side of the final U-shape. The first side is in the final condition more concave than in the initial condition.
US11986365B2
A coloring device for coloring a dental prosthesis by an inkjet method, the dental prosthesis coloring device includes an inkjet head having a nozzle that ejects ink droplets; a holding unit that holds the prosthesis; a drive unit that moves the inkjet head or the holding unit in a predetermined direction in an XYZ orthogonal coordinate system; and a control unit that controls the inkjet head and the drive unit, wherein the control unit is configured to control the inkjet head and the drive unit based on predetermined coloring data and three-dimensional data of the prosthesis.
US11986361B2
An exemplary device is indicated for use in physically debriding thrombus fragments from a stent retriever, using hospital-grade saline, or heparinized saline, for example. This device may be used in the sterile field, during a mechanical thrombectomy procedure. An exemplary cleaning device for cleaning a stent retriever within a sterile surgical field may include a chamber configured to receive and enclose a stent retriever to be cleaned, at least one port configured for connection with a fluid source to enable inflow and/or outflow of a fluid to or from the chamber, and one or more support structures configured to support the stent retriever in a fixed position inside the chamber.
US11986358B2
A device comprising: (a) one or more markers, some or all of which are expandable rounded members that are expandable from a stored state to an expanded state and when in the expanded state each of the expandable rounded members expand to move into contact with a lumen in an organ; and (b) one or more tissue tags connected to the expandable rounded members or the expandable rounded members being made of a magnetized material; and wherein the expandable rounded members are configured to be located within and deployed from an insertion mechanism into the lumen in the organ.
US11986354B2
An ultrasonic apparatus for medical examination using ultrasonic waves, comprising a movable transducer probe which includes a transducer array of electroacoustic transducers for transmitting ultrasonic signals into a patient body and receiving as analog raw data ultrasonic echoes; the transducer probe configured to generate digital raw data based on the received analog raw data which comprises measurement data sets for temporally consecutive measurement time intervals, and is configured to transmit the digital raw data via a digital data interface; a computer device configured to buffer the respective measurement data sets of the digital raw data and is configured to carry out a digital beamforming for each of the buffered measurement data sets, to obtain a reconstructed image of the tissue sector, and generate, based on the reconstructed images, an image stream with a predetermined image refresh rate and supply it to a display means which reproduces the image stream.
US11986352B2
A method of estimating lung motion includes collecting multiple ultrasound image data captured at one or more locations of a sample region of tissue. The method further includes comparing the multiple ultrasound image data and determining temporal correlation coefficients between each of the multiple ultrasound image data. The method still further includes displaying an image of the sample region of the tissue with the temporal correlation coefficients identified, thereby indicating lung motion. In further methods, the determined temporal correlation coefficients are used to determine an amount of decorrelation, which can be used to determine strain of the tissue over the sample region and to calculate lung displacements and lung shape changes representing ventilation.
US11986349B2
An ultrasound device is described. The ultrasound device may include a cavity, a membrane, and a sensing electrode. When an electrical signal is applied to the sensing electrode and a static bias is applied to the membrane, the membrane vibrates within the cavity and produces ultrasonic signals. The cavity, the membrane, and the sensing electrode may be considered a capacitive micromachined ultrasonic transducer (CMUT). The sensing electrode may be shaped as a ring, whereby the central portion of the sensing electrode is removed. Removal of the central portion of the sensing electrode may reduce the parasitic capacitance without substantially affecting the production of ultrasonic signals by the CMUT. This, in turn, can result in an increase in the signal-to-noise ratio (SNR) of the ultrasonic signals. The ultrasound device may further include a bond pad configured for wire bonding, and a trench electrically isolating the bond pad from the membrane.
US11986345B2
A system may include an ultrasound probe and a controller unit configured to communicate with the ultrasound probe. The controller unit may be further configured to select an aiming mode for an ultrasound probe; detect a target of interest; determine a centroid for the detected target of interest; display a center indicator based on the determined centroid; detect that the center indicator is within a threshold number of pixels or distance of a centerline of a field of view of the ultrasound probe; and highlight the generated center indicator, in response to detecting that the center indicator is within the threshold number of pixels or distance of the centerline.
US11986334B2
To provide a technique with which an operator, when talking into a microphone, can recognize whether or not his/her voice is being output from a speaker in a scan room, a CT apparatus 1 has: an operator microphone 41 installed in an operation room R2 for receiving a voice of an operator 81; a patient microphone 2 installed in a scan room R1 for receiving a voice of a patient 80; a speaker 50 installed in the operation room R2 for outputting the voice of the patient 80 received by the patient microphone 2; a speaker 5 installed in the scan room R1 for outputting the voice of the operator 81 received by the operator microphone 41; and a light-emitting section 31 for informing, in the case that the patient microphone 2 has received the voice of the operator 81 output from the speaker 5, the operator 81 that his/her voice is being output from the speaker 5.
US11986333B2
Medical imaging devices, systems, and methods thereof. The medical imaging system may include a movable station and a gantry. The movable station includes a gantry mount rotatably attached to the gantry. The gantry includes an outer C-arm slidably mounted to and operable to slide relative to the gantry mount, an inner C-arm slidably coupled to the outer C-arm and, an imaging signal transmitter and sensor attached to the C-arms. The two C-arms work together to provide a full 360 degree rotation of the imaging signal transmitter. The movable station may include a motion control system and an imaging control system. In embodiments, the motion control system includes omni-directional wheels for precision controlled-movement of the movable station.
US11986331B2
A flat panel detector and an imaging system are provided. The flat panel detector includes a plurality of pixel units which include photosensitive pixel units and alignment pixel units. Each photosensitive pixel unit includes a photoelectric sensor configured to convert an incident light into an electrical signal so that a photosensitive pixel unit in which the photoelectric sensor is located has a grayscale that changes according to a real-time change of the incident light. Each alignment pixel unit is configured to have a fixed grayscale, and the fixed grayscale does not change according to the real-time change of the incident light. The alignment pixel units includes first alignment pixel units and second alignment pixel units. Each first alignment pixel unit has a first fixed grayscale, each second alignment pixel unit has a second fixed grayscale different from the first fixed grayscale.
US11986330B2
A method for generating an object 3D point cloud in a medical imaging system comprising a machine table and a scanning device comprises: extracting a valid 3D point cloud in a valid region where the machine table is located from a global 3D point cloud based on a current height of the machine table and boundary information of the machine table, wherein the global 3D point cloud comprises 3D point clouds of an object and a surrounding environment thereof, and the object 3D point cloud is comprised in the valid 3D point cloud; and removing an environment 3D point cloud of the surrounding environment from the valid 3D point cloud to obtain the object 3D point cloud, wherein the surrounding environment comprises at least part of the machine table. In some embodiments, a moving path of the machine table in the medical imaging system is planned using the object 3D point cloud. In some embodiments, collision prediction of the object is performed in the medical imaging system using the object 3D point cloud.
US11986325B2
Disclosed are treatment information display device and method for displaying treatment history on an image of teeth in an accumulated manner. The treatment information display method enables a user to recognize at once a past treatment history, a current treatment status, and a future treatment plan by displaying, on the image of teeth, treatment information for the past, present, and future. In addition, the treatment information display method can provide the user with pieces of treatment information displayed on different images of teeth, by displaying, in an accumulated manner, the pieces of treatment information displayed on a plurality of teeth images.
US11986323B2
A model of data quality is derived for physiological monitoring with a wearable device by comparing data from the wearable device to concurrent data acquisition from a ground truth device such as a chest strap or electrocardiography (EKG) heart rate monitor. With this comparative data, a machine learning model or the like may be derived to prospectively evaluate data quality based on the data acquisition context, as determined, for example, by other sensor data and signals from the wearable device.
US11986322B2
A device for determining a heart rate of a user has a PPG sensor and an accelerometer to compensate for acceleration artifacts within the PPG signal. The device transforms time domain PPG and accelerometer signals into the frequency domain using a Fourier transformation and utilizes the Fourier coefficient magnitudes as indicative of the probability of candidate heart rate values. Candidate heart rate values are determined at sampling times over a time interval and a most probable heart rate path during the time interval is determined using a reward/penalty algorithm.
US11986315B2
The present disclosure is related to a method and apparatus for determining THC usage of a person. The present disclosure describes acquiring a video sequence, of an eye of a patient, the video sequence being a plurality of video frames, determining a frequency spectrum from a pupillary data of the video sequence, and determining, based on the frequency spectrum, the physiological characteristic or drug of use of the patient. In an embodiment, at least one frequency can be probed based on which physiological characteristic is being explored. For example, the physiological characteristic can be Δ#-tetrahydrocannabinol, and the at least one frequency probed can be selected to be specific to Δ#-tetrahydrocannabinol.
US11986311B2
A dermatoscope which can focus at a certain depth, e.g. below the top surface of the skin. Light sources are provided for creating shadows of a skin lesion and an image acquisition device to take images from which a 3D reconstruction can be made.
US11986299B2
Methods and systems are provided for point-of-care nucleic acid amplification and detection. One embodiment of the point-of-care molecular diagnostic system includes a cartridge and an instrument. The cartridge can accept a biological sample, such as a urine or blood sample. The cartridge, which can comprise one or more of a loading module, lysis module, purification module and amplification module, is inserted into the instrument which acts upon the cartridge to facilitate various sample processing steps that occur in order to perform a molecular diagnostic test.
US11986293B2
A medical diagnostic device includes a wirelessly transmitted time data receiver and processor. Associated devices, methods and functionality are also described.
US11986292B2
An apparatus comprising a pump configured to deliver insulin, an input configured to receive blood glucose data, a user interface, and a controller communicatively coupled to the pump, the input, and the user interface. The controller includes a blood glucose data module to compare the blood glucose data to a target blood glucose level for an insulin pump user. The controller is configured to present a question related to the blood glucose level via the user interface when the blood glucose level is different than the target blood glucose level, receive a response to the question via the user interface, and present a recommended user action based at least in part on the response. Other devices, systems, and methods are disclosed.
US11986278B2
A system for monitoring a health parameter in a person is disclosed. The system includes at least one transmit antenna configured to transmit millimeter range radio waves over a 3D space below the skin surface of a person, multiple receive antennas configured to receive radio waves, the received radio waves including a reflected portion of the transmitted radio waves, and means for isolating a signal from a particular location in the 3D space in response to receiving the radio waves on the multiple receive antennas and outputting a signal that corresponds to a health parameter of the person in response to the isolated signal.
US11986275B2
An optical vital signs sensor is provided which comprises a PPG sensor (100), a pre-processing unit (130) which adapts the sampling rate or the number of pulses per sample, a processing unit (140) which executes at least one processing algorithm based on an output signal of the pre-processing unit and a sensor control unit (150). The sensor control unit is configured to control the PPG sensor by adapting the sampling rate and/or the number of pulses per sample.
US11986270B2
Provided are an ultrasound imaging apparatus and a surgical operation support system for obtaining position information of a device outside an imaging area and presenting the position information to a user together with an ultrasound image. The surgical operation support system includes the ultrasound imaging apparatus, an ultrasonic source fixed to a therapeutic tool to be inserted into a subject body, a display device for displaying the ultrasound image and the position of the ultrasonic source. The ultrasound imaging apparatus is provided with a position estimator for estimating the position information of the ultrasonic source, and the position estimator analyzes a grating lobe artifact (false image) that is generated by the ultrasonic wave emitted from the ultrasonic source outside the imaging area, to estimate the position information of the ultrasonic source with respect to the imaging area.
US11986267B2
Systems, methods and devices are implemented for microscope imaging solutions. One embodiment of the present disclosure is directed toward an epifluorescence microscope. The microscope includes an image capture circuit including an array of optical sensor. An optical arrangement is configured to direct excitation light of less than about 1 mW to a target object in a field of view of that is at least 0.5 mm2 and to direct epi-fluorescence emission caused by the excitation light to the array of optical sensors. The optical arrangement and array of optical sensors are each sufficiently close to the target object to provide at least 2.5 μm resolution for an image of the field of view.
US11986257B2
Certain aspects relate to systems and techniques for a medical device. The medical device can include an elongated shaft having a proximal end, a distal end, and a bendable section between the proximal end and the distal end. The medical device can include a tip assembly at the distal end of the elongated shaft. The tip assembly include a control member and a distal tip component attached to the control member. At least one cable can extend through the elongated shaft and be anchored to the control member. The at least one cable can be configured to bend the bendable section based on a force applied thereto. At least one electronic component can be embedded in the distal tip component.
US11986256B2
This invention concerns an automated registration method and device for a surgical robot enabling registration between a first three-dimensional location system comprising an optical distance sensor and a second three-dimensional location system comprising optical acquisition means. The method comprises: a first step of intraoperative registration between the first location system and data recorded on an anatomical surface of a patient and; a second step of intraoperative registration of two three-dimensional location systems. The second registration step is performed at the same time as the first registration step by detection, by the optical acquisition means, of at least one point of a point cloud acquired by the optical sensor during the first intraoperative registration.
US11986250B2
Systems and methods for determining position and orientation of a bone of an anatomical feature are described. These include the use of a wearable holder configured to be mounted about an outer-skin surface of the anatomical feature, such that the anatomical feature and the bone are positioned in fixed relation with respect to the wearable holder when the wearable holder is mounted about the anatomical feature. Reference marker arrays are fixedly mounted to the wearable holder, each being positioned on the wearable holder to identify a landmark of the bone within the wearable holder when the wearable holder is mounted to the anatomical feature. The position and orientation of the reference markers are trackable to determine position and orientation of the wearable holder in a reference coordinate system, thereby enabling position and orientation of the landmarks on the bone to be determined.
US11986240B2
A system for guiding an ophthalmic procedure is disclosed. The system includes a housing assembly with a head unit configured to be at least partially directed towards a target site in an eye. An optical coherence tomography (OCT) module and stereoscopic visualization camera are at least partially located in the head unit and configured to obtain a first set and a second set of volumetric data, respectively. A controller is configured to register the first set and second set of volumetric data to create a third set of registered volumetric data. The third set and second set of registered volumetric data are rendered, via a volumetric render module, to a first and second region. The first region and the second region are overlaid to obtain a shared composite view of the target site. The controller is configured to extract structural features and/or enable visualization of the target site.
US11986235B2
A system for treating a patient comprises an elongate shaft, an expandable reservoir and a fluid delivery assembly. The elongate shaft comprises a distal portion and is constructed and arranged to be introduced into a gastrointestinal lumen. The expandable reservoir is positioned on the elongate shaft distal portion and is constructed and arranged to receive a first fixed amount of ablative fluid and to deliver a first thermal dose of energy to a first portion of target tissue. The fluid delivery assembly is in fluid communication with the expandable reservoir and is constructed and arranged to deliver the first fixed amount of ablative fluid to the expandable reservoir. Devices and methods for treating tissue of a patient are also provided.
US11986231B2
A cryotreatment catheter for treating tissue. The catheter may include an outer elongate body, a balloon treatment element coupled to the distal portion of the elongate body with a plurality of balloon lobes radially arranged around the outer elongate body, an inner elongate body rotatably movable within the lumen of the outer elongate body, and a fluid delivery lumen located within the lumen of the outer elongate body and at least partially within the lumen of the inner elongate body. The fluid delivery lumen may be branched at a distal portion into a plurality of linear segments, each linear segment being in fluid communication with one of the plurality of balloon lobes. Each of the balloon lobes may be inflated independently of each other by the linear segments of the fluid delivery lumen.
US11986230B2
The disclosure provides a flexible cryoablation needle device resistant to a low temperature and a high pressure, a threaded part is arranged on the outer wall of a liner pipe to enhance a connection strength between the liner pipe and a flexible pipe structure. Since an annular protrusion portion is arranged on the outer wall of the liner pipe, further leakage of a gas coming from a pressure relief process is prevented and the connection strength is enhanced as well. Air tightness and connection strength are further guaranteed by radial extrusion of extruding pipes. And an inner cavity in a cutter head is directly subjected to pressure relief through a cutter head vent, a pressure relief intermediate cavity, a liner vent, a flexible pipe vent and a pressure relief gap.
US11986229B2
Devices used to treat tissue, including treatment of vertebral bone fractures, are disclosed. The devices may be configured to displace bone tissue using an expandable member, such as a balloon. The devices may further include a handle having a rotatable grip configured to apply a tension force to a plurality of pull wires to articulate a distal portion of the devices.
US11986226B2
A bone plate includes a pair of lobed portions and a central linking portion extending between the pair of lobed portions. The pair of lobed portions each include a through-hole extending from an upper surface to a lower surface and configured to receive a fastener. Each of the lobed portions has a cross-sectional thickness, in a plane extending along a longitudinal length of the bone plate and between the upper and lower surfaces, that continuously decreases in a direction extending away from the central linking portion to a respective end of each lobed portion. The bone plate has a maximum thickness where each lobed portion joins the central linking portion, the maximum thickness being approximately 1.5-2.3mm. A minimum thickness of the central linking portion is approximately 1.3-1.7mm.
US11986219B2
An implantable growing rod assembly adapted to be secured along a length of a spine for treating deformities of the spine. The assembly includes a housing, a fixed rod extending along a longitudinal axis away from the housing, and an expansion rod extendible from the housing along the longitudinal axis. A driver assembly is fixed to the housing and adapted to translate the expansion rod along the longitudinal axis.
US11986217B2
There is provided an apparatus for extraction of at least one object from a cavity. The apparatus includes a sleeve including an inflatable section configured to surround the at least one object during inflation; a handle configured to enable a user to hold the sleeve, the handle defining a holding edge of an opening at a first portion of the sleeve; and a handle-mount mounted to a peripheral area around the opening, the handle-mount being for attachment of a pump used for inflating the inflatable section. There is also provided a pressure limitation apparatus configured to operate with a birth assistance device when attached via a conduit.
US11986214B2
A trocar is provided that is adapted to insert a lighting attachment into a body cavity. The trocar connects at its distal end to the lighting attachment such that it can be pushed into the body cavity. An endoscope may then be inserted through the trocar into the body cavity. The lighting attachment is configured to detach from the trocar and attach to the endoscope head to provide additional lighting to the endoscope. The lighting attachment includes foldable lighting panels that expand when in use in order to light a wider field of view. The lighting attachment may be powered by induction coil from the endoscope.
US11986199B2
Various devices and methods having detachable handles at a proximal end thereof for use in the working channel of an endoscope. The detachable components at the proximal end allow the endoscope to be retracted and removed over the device, while leaving the device in place for purposes such as tissue manipulation.
US11986183B2
A surgical stapling assembly is disclosed comprising a shaft, an end effector attached to the shaft, an electric motor, a plurality of sensors positioned within the end effector to measure an electrical parameter, and a control circuit. The end effector comprises a first jaw, a second jaw movable relative to the first jaw, and a firing driver to deploy staples and cut tissue. The electric motor is to actuate the firing driver. The control circuit is to actuate the electric motor to deploy staples from a staple cartridge during a firing stroke, monitor the electrical parameter at a first location of the firing stroke, and monitor the electrical parameter at a second location of the firing stroke, wherein the first location and the second location are different.
US11986175B2
A medical system includes a propellant source containing a propellant fluid, containers containing a material, and a shaft having a plurality of lumens, each of the plurality of lumens having a first opening at a proximal end of the shaft and a second opening at a distal end of the shaft. The plurality of lumens are fluidly coupled to one or more of the propellant source and at least one of the plurality of containers, and a first lumen surrounds, is coaxial with, or is side-by-side with, at least one other lumen.
US11986169B2
An intraosseous access system can include a needle that defines a lumen and a longitudinal axis about which the needle can be rotated during an insertion event. The needle can include a proximal end that remains at an exterior of a patient during use, a distal end that can be inserted through the skin of the patient into contact with a bone of the patient, and a distal tip at a distalmost point of the distal end of the needle that is positioned at the longitudinal axis of the needle. The system can further include an obturator sized to be received within the lumen of the needle that can inhibit material from entering the needle as the system is inserted into the bone.
US11986167B2
Systems and methods for continuous real-time sweat sampling and analysis are disclosed. A sweat collection article and method of collecting sweat from a person's skin using the sweat collection article are provided. The sweat collection article includes: a sweat collecting tube placed adjacent to the person's skin, and at least one piece of flexible material that has an adhesive that adheres the article to the person's skin and is positioned to overlie one end of the tube. The second end of the sweat collecting tube is in fluid communication with an instrument such as a mass spectrometer that analyzes the sweat on a real-time basis. The systems and methods may further include a device for removing salt from the sweat that is arranged so that the sweat is transported to the device prior to being transported to the instrument for analyzing the sweat.
US11986165B1
Co-manipulation robotic systems are described herein that may be used for assisting with laparoscopic surgical procedures. The co-manipulation robotic systems allow a surgeon to use commercially-available surgical tools while providing benefits associated with surgical robotics. Advantageously, the surgical tools may be seamlessly coupled to the robot arms using a disposable coupler while the reusable portions of the robot arm remain in a sterile drape. Further, the co-manipulation robotic system may operate in multiple modes to enhance usability and safety, while allowing the surgeon to position the instrument directly with the instrument handle and further maintain the desired position of the instrument using the robot arm.
US11986163B2
An endoscope includes an insertion portion that is covered with an exterior tube with an outer diameter of 1 mm or less, an observation optical system that includes a rectangular image sensor fixed to a tip of the insertion portion and having a length of one side of 60% or less of the outer diameter of the insertion portion, an illumination fiber that is arranged between an inner surface of the exterior tube and an edge of the observation optical system and penetrates the exterior tube, a cable bundle that is connected to the image sensor and penetrates the exterior tube, and a connector that is connected to the cable bundle and the illumination fiber.
US11986159B2
A device for visualizing and providing suction for a surgical procedure in an ear includes a handle, a main shaft extending from the handle, an imaging sensor at a distal end of the main shaft, a light source at the distal end of the main shaft, a first suction tube extending along a proximal portion of a first side of the main shaft, a second suction tube extending along a proximal portion of a second side of the main shaft, and a first suction component. The first suction component includes a first suction shaft, a first thumb depress member coupled with a proximal end of the first suction shaft, a first spring disposed over a proximal portion of the first suction shaft, and a first suction tubing for connecting the first suction shaft or the first thumb depress member with the handle.
US11986152B2
Provided is an endoscope cap or the like with an elevator which is easily attached to and detached from the distal end of an endoscope. An endoscope cap attachable to and detachable from an endoscope including a lever pivotally provided at a distal end of an insertion part of an endoscope and a pivot part causing the lever to pivot comprises: a cylindrical cover; and an elevator which is pivotally supported at the inside of the cover, is connected to the lever when the endoscope is attached to the cover, and pivots in response to pivoting of the lever.
US11986142B2
An inlet assembly (T) and a washing device (C), particularly a dishwasher, are provided. The inlet assembly (T) comprises at least one body (1) having a first opening (1a); a connection area (1b) on the body (1), and a hole; a cover assembly (2), at least a part of which is inserted into the body (1) through the first opening (1a), and including a cover body (2a) closing the first opening (1a), a water inlet section (2b) extending from one side of the cover body (2a), a second opening (2d) on the water inlet section (2b), allowing air to enter the water inlet section (2b), a condensation section (2e), formed as a chamber, extending into the body (1), and located on the other part of the cover body (2a), and a third opening (2f) on a part of the cover body (2a) where the condensation section (2e) is situated.
US11986141B2
A method of controlling a dishwasher includes: linking the dishwasher to an air quality detection device provided at an outside of the dishwasher, receiving information regarding activation of an auto open door (AOD) function of the dishwasher, determining whether a quality of indoor air input from the air quality detection device is within a set range, based on determining that the quality of the indoor air deviates from the set range, recommending a user of the dishwasher to deactivate the AOD function of the dishwasher, maintaining or deactivating the AOD function of the dishwasher based on a command input from the user, and washing a washing target in the dishwasher.
US11986139B2
An extraction cleaner includes a steam delivery system, a liquid delivery system, and a recovery system, and includes multiple cleaning modes, including a first cleaning mode in which components of the steam delivery system, liquid delivery system, and recovery system are active, a second cleaning mode in which components of the delivery system and recovery system are active, and a third cleaning mode in which components of the steam delivery system are active. Methods for operating an extraction cleaner are also provided.
US11986127B2
A grinding mill or seasoning grinder for grinding seasonings includes a stator and a rotatably mounted rotor having a base body with a shape of a truncated cone, where the rotor concentric to the stator. The stator and the rotor each include milling projections which are, at least in some sections, convexly curved in cross-section and the surfaces of milling projections are devoid of discontinuities that include edges or undercuts.
US11986115B2
A landing station guidance-and-security system can include an environmental cover and/or a guide-and-security bar. In some embodiments, the landing station guidance-and-security system is integrated into a parcel-receiving device. In some embodiments, the landing station guidance-and-security system is configured to attach to a parcel-receiving device. In some embodiments, the guide-and-security bar includes a precision rod. In some embodiments, a drone landing station includes: a magnetic centering mechanism configured to center a drone and/or a package; sliding dovetail doors; a plow bar; at least one roll-up door; a first storage locker; a second storage locker; and/or a solid rear door configured to block access to the second storage locker from the first storage locker when the first storage locker is being accessed by a user.
US11986111B2
A system for mounting to a scaffold comprises a holder and a shelf. The holder includes a first slot for receiving a drink container, e.g., a large cup, and a second slot for receiving a phone, e.g., a smart phone. The shelf includes apertures for receiving tools. The holder is configured to attach to the shelf, which can mount on the scaffold, for providing added workspace and more places to put tools.
US11986107B2
A cell (1) for storing a set (2) of products (20) includes ventilation means (4) for creating a rear-to-front air flow (A) circulating in the housing (14) and at least one first sealing device (5 or 6) having a first flexible sealing element (50 or 60) that is inflatable in relation to one of the walls (10, 11, 12) of the cell and towards the inside of the housing (14) under the effect of an air pressure which is generated in the housing (14) by said air flow. The first sealing device (5 or 6) has at least one second sealing element (52 or 62) that can be actuated between an inactive configuration and an active configuration in which it exerts a mechanical pressure on part of the first flexible sealing element (50 or 60).
US11986098B1
A foldable chair, including a first bracket and a second bracket that are hingedly fixed in an X-shape, and an adjusting mechanism connecting an upper portion of the first bracket and a lower portion of the second bracket. The adjusting mechanism includes a fixing member and a movable member, the fixing member including a slide groove, and the movable member including a limit member movable within the slide groove; the slide groove has a serrated first inner side wall and a smooth second inner side wall, and the limit member is snapable to the first inner side wall.
US11986096B2
According to the embodiments, an air mattress includes an air cell unit, a first side edge unit, and a first pump unit. The air cell unit includes a plurality of air cells that are arranged along a first direction. The first side edge unit includes a polymeric foam. A direction from the first side edge unit to a first portion of the air cell unit is along a second direction that intersects the first direction. The first pump unit performs supply and exhaust of air to and from at least a part of the plurality of the air cells. A direction from the first pump unit to a second portion of the air cell unit is along the second direction. A direction from the first side edge unit to the first pump unit is along the first direction.
US11986084B2
A mobile trailer-cleaning system is a system that facilitates the cleaning of the exterior surfaces of a trailer. The system may include at least one brush assembly, a roof carriage, an agitation mechanism, and a steering assembly. The at least one brush assembly enables the cleaning of all the trailer's exterior surfaces including the rear of the trailer and any non-flat surfaces. The roof carriage serves as a guide to maintain the at least one brush assembly adjacent to the trailer's walls as the at least one brush assembly moves along the trailer. The roof carriage also prevents the at least one brush assembly from tipping over. The agitation mechanism eases the cleaning of the trailer's exterior surfaces by agitating the at least one brush assembly in predetermined modes of operation. The steering assembly enables the user to manually operate the at least one brush assembly during the cleaning process.
