US09360012B2
A differential pressure regulating valve is disposed in a fluid passage. The differential pressure regulating valve includes a valve chamber, a valve hole, a valve body, a support member and an urging member. The valve chamber is formed in the fluid passage and having a cylindrical shape. The valve hole is formed in the fluid passage as an opening which communicates with the valve chamber. The valve body is disposed in the valve chamber and adapted to open and close the valve hole. The support member is fixedly mounted to the valve chamber and extending across flowing direction of the fluid in the valve chamber. The support member has a communication passage for fluid communication between a first valve chamber and a second valve chamber. The urging member is disposed between the support member and the valve body for urging the valve body toward the valve hole.
US09360006B2
A method for controlling operation of a pump unit, where the pump unit includes a primary piston pump having a primary piston and a secondary piston pump having a secondary piston. The primary piston pump is fluidically connected with the secondary piston pump. The primary piston pump includes an inlet valve and an outlet valve, and the pump unit operates periodically according to a pump cycle. The method includes determining a fluid pressure of fluid dispensed by the pump unit, and performing a closed loop control of a position of the primary piston in dependence on the fluid pressure of the fluid dispensed by the pump unit during a first time interval of the pump cycle.
US09360001B2
The compressor comprises a valve plate, to be affixed to a compressor block, and a suction valve (V) formed by a spacer body, having a median opening and a flexible vane, which has a fixing end portion provided with a contour, symmetrical or asymmetrical, in relation to a longitudinal axis (X) of the flexible vane and which presents peripheral edge portions to be seated against respective inner edge portions of the median opening for restricting coplanar, linear and angular displacements of the flexible vane in relation to the spacer body upon seating the flexible vane against the valve plate, in the interior of the median opening.
US09360000B2
Reciprocating fluid pumps include a pump body including a cavity therein, a plunger located at least partially within the cavity, and a shift canister assembly disposed within the cavity. The shift canister assembly includes a sealing surface for forming a seal against the pump body. An area covered by the seal between the sealing surface and the pump body is less than about 75% of an outer cross-sectional area of the shift canister assembly. The shift canister assembly may include a shift canister and a shift canister cap attached thereto, the shift canister cap comprising the sealing surface. Reciprocating fluid pumps include a shift canister, a shift piston at least partially disposed within the shift canister, and a shift canister cap attached to the shift canister on a longitudinal end of the shift canister opposite the shift piston. Methods include forming such reciprocating pumps.
US09359997B2
A system and method for generating electricity from acoustic energy from an aircraft on a runway. Acoustic wave collectors mounted along the runway collect the acoustic energy and direct such acoustic energy to an associated acoustic converter assembly. A vibrating element is mounted within a housing of the acoustic converter assembly. The vibrating element moves in response to the acoustic energy. This movement draws air into the housing below the vibrating element and then forces the air downward to form an output air flow. The output air flow is directed to an associated turbine assembly to cause a shaft to rotate at a rate proportional to the magnitude of the received output air flow. An associated generator that is coupled to the shaft generates electricity proportionally to the rate of rotation of the shaft. The electricity from each generator is converted and sent to a substation for distribution.
US09359994B2
A module-handling tool for facilitating installation, servicing, and/or dismantling of a electromagnetic rotary machine, such as an electrical power generator or electric motor, having a modularized active portion. In one embodiment, module-handling tool is configured for a machine having a modularized stator having a number of removable modules. In one example of such stator-module-handling tool, the tool is designed and configured to hold a stator module and be temporarily secured to the rotor of the machine during the process of installing the stator module into the machine or removing the module from the machine. In this example, the module-handling tool also acts as a module carrier for transporting a module to or from the machine.
US09359993B2
A wind turbine tower that may be assembled fast, including a nacelle and a rotor, the tower comprising at least two stackable annular sections made of concrete connected through a main connecting arrangement adapted to withstand loads induced by the wind turbine rotor, and an auxiliary connector.
US09359991B2
An energy conversion system may include a stationary structure, a rotatable structure configured to rotate relative to the stationary structure, wherein the rotatable structure defines an axis of rotation. The system may further include at least one blade member mounted to and extending radially outward from the rotatable structure, the at least one blade member being configured to interact with fluid currents flowing in a direction substantially parallel to the axis of rotation to cause the rotatable structure to rotate about the axis of rotation, and at least one bearing mechanism disposed to provide at least one of a radial and axial bearing between the rotatable structure and the stationary structure as the rotatable structure rotates about the stationary structure. The system may be configured to convert rotation of the rotatable structure to at least one of electricity and hydrogen production.
US09359982B2
An air cleaner assembly and a filter element reduce wall noise by rigidly coupling the movement of opposing air cleaner housing sidewalls through the installed filter element. The sidewalls are rigidly coupled through the filter element with the sidewalls coupled to move together in unison such that wall deflection forces created by the pressure pulsations tend to cancel each resulting in improved dynamic stiffening of the air cleaner walls and reduced wall noise.
US09359977B2
A vehicle fuel system includes a vapor recovery canister containing at least two carbon beds. Each carbon bed is configured to capture hydrocarbon material associated with fuel vapor discharged from a vehicle fuel tank into the canister.
US09359974B2
Disclosed is a process of fueling a rocket engine or air-breathing engine for a hypersonic vehicle with a high performance hydrocarbon fuel characterized by a hydrogen content greater than 14.3% by weight, a hydrogen to carbon atomic ratio greater than 2.0 and/or a heat of combustion greater than 18.7 KBtu/lb. The disclosed fuels generally have a paraffin content that is at least 90% by mass and a C12-C20 isoparaffin content of at least 40% by mass.
US09359971B2
A system includes a reciprocating engine having a cylinder liner and a piston disposed within the cylinder liner. The cylinder liner includes an inner wall and extends around a cavity. The inner wall includes a first axial end, a second axial end, a piston travel portion, and a top portion. The top portion is nearer to the first axial end of the cylinder liner than to the second axial end of the cylinder liner. The top portion has a first surface finish with a first roughness average (Ra1) greater than approximately 2 μm and a total waviness (Wt) less than approximately 0.1 mm. The piston is configured to move in a reciprocating manner within the cylinder liner. The piston includes a top land configured to be radially opposite the top portion of the inner wall of the cylinder liner when the piston is at a top dead center position.
US09359967B2
Systems and methods for estimating catalyst transfer function gain are disclosed. In one example, an air-fuel ratio forcing function is applied to a catalyst. Air-fuel ratios upstream and downstream of the catalyst are manipulated to determine a transfer function gain of the catalyst. The transfer function gain may be a basis for indicating the presence or absence of catalyst degradation.
US09359966B2
A method for operating a fuel system is disclosed. The method includes sequentially purging fuel vapors from each of a plurality of regions of a canister. Purging a region includes opening an air inlet valve associated with that region and maintaining air inlet valves associated with each other region closed to direct fuel vapors to at least one purge outlet.
US09359957B2
A planet gear for use in an air turbine starter is formed of a first part having a set of gear teeth at a first axial location. A shaft extends axially away from the first set of gear teeth. A second part is interference fit on the first part, with the second part having a second set of gear teeth. The second part is mounted on the shaft of the first part. An outer diameter of the shaft is selected to be significantly larger than an inner diameter of a cylindrical portion of the second part which is interference fit on the shaft. A ratio of the outer diameter to the inner diameter is between 1.0005 and 1.0100. A planetary gear system, an air turbine starter and a method of installing a planet gear are also disclosed.
US09359955B2
An apparatus for supporting an aft portion of a transition duct in a gas turbine engine includes a transition aft frame that engages with an annular shaped stator component disposed in a turbine section of the gas turbine engine. The transition aft frame includes radially inner and outer panels and circumferentially spaced first and second side panels connecting the inner and outer panels. A forward face of the stator component includes first and second connection points circumferentially spaced apart. The transition aft frame includes first and second attachment structures that respectively engage with the first and second connection points when the transition duct is aligned axially with the stator component. The first and second attachment structures are spaced apart in a manner effective to transfer moment load from the first and second attachment structures to the first and second side panels respectively.
US09359952B2
A heat recuperator includes a plurality of channel walls composed substantially of thermally-conductive material and supported in spaced-apart relation, defining fluid channels and interstices therebetween. The fluid channels receive at least one primary fluid flow and the interstices receive at least one secondary fluid flow so as to effect heat exchange between the two flows. In use, the plurality of channel walls are deformable by pressure differential between the primary and secondary fluid flows. When at least some of the channel walls are in a deformed state, the plurality of channel walls are stabilized through press fit engagement of mutually opposed contact regions formed in adjacent pairs of the channel walls.
US09359951B2
An inlet system for a gas turbine includes an inlet air duct; a silencer disposed in the inlet air duct, the silencer including a plurality of panels with spaces between the panels; and a conduit with orifices disposed to inject inlet bleed heat into each of the spaces. A method of conditioning inlet air for a gas turbine includes flowing air through spaces between panels of a silencer in an inlet air duct of the gas turbine, and injecting inlet bleed heat through orifices and into each of the spaces.
US09359946B2
An internal combustion engine having an anodic oxidation coating formed on at least a part of a wall surface that faces a combustion chamber, wherein the anodic oxidation coating has voids and nano-holes smaller than the voids; at least part of the voids are sealed with a sealant derived by converting a sealing agent; and at least a part of the nano-holes are not sealed.
US09359922B2
The invention relates to a valve control means (1) for an internal combustion engine, having two cams (2, 3) which are arranged one behind another on a camshaft (20), the cams (2, 3) having different cam contours, a drag lever system (4), having a first lever (5), a second lever (7) which is connected to the first lever (5) such that it can be rotated about a pivot point (6), and a third lever (8) which is connected fixedly to the first lever (5), the first lever (5) having a roller pickup (15) for a first cam (2) and the second lever (7) having a roller pickup (17) for the second cam (3), the third lever (8) having a slotted guide (9) for the rectilinear positive guidance of a valve (30), the drag lever system (4) being mounted at the pivot point (6) such that it can be adjusted on a circular path (10) about the rotational axis (21) of the camshaft (20) in a cylinder block or cylinder head of the internal combustion engine, and having a play compensation element (11) between the second lever (7) and the first lever (5) or the third lever (8) for play compensation and for limiting the rotatability of the second lever (7) with respect to the first lever (5) and the third lever (8). Furthermore, the invention relates to an internal combustion engine, having at least one valve control means of this type.
US09359910B2
Operational gas turbine engine housing or casing dynamic strain, temporary or permanent displacement and/or temperature is measured by a distributed fiber optic sensing system (DFOSS) utilizing optical frequency domain reflectometry (OFDR) that is coupled to the turbine engine housing. The DFOSS/OFDR system measures localized variances in strain along the length of an optical fiber (OF), which are correlated with turbine engine housing displacement. Temperature influence on the measured localized strain variances is accounted for by obtaining temperature information from an another measurement system or by taking the same type OFDR measurements on unrestrained optical fiber (OF) and deriving compensated strain measurements that are not temperature influenced. The derived strain measurements along the DFOSS are correlated with housing displacement. Other embodiments include separate displacement measuring modules, each including DFOSS optical fibers, coupled along the engine housing.
US09359908B2
An aerodynamic seal assembly for a rotary machine includes multiple sealing segments disposed circumferentially intermediate to a stationary housing and a rotor. Each of the segments includes a shoe plate with a forward load-bearing section and an aft load-bearing section configured to generate an aerodynamic force between the shoe plate and the rotor. The shoe plate includes at least one labyrinth teeth facing the rotor and positioned between the forward load-bearing section and the aft load-bearing section. The sealing segment also includes at least one spring connected to a pedestal located about midway of an axial length of the shoe plate and to a stator interface element. Further, the sealing segment includes a rigid segmented secondary seal attached to the stator interface element at one first end and in contact with the pedestal of the shoe plate at one second end.
US09359898B2
A system includes a turbomachine. The turbomachine includes at least one rotor disk. The system also includes a rotor disk heating system configured to resistively heat at least a portion of the at least one rotor disk via an electrical current or voltage applied to the portion of the at least one rotor disk.
US09359891B2
An apparatus for estimating a property of an earth formation includes a carrier configured to be conveyed through a borehole penetrating the formation and a single probe configured to be extended from the carrier and to seal with a wall of the borehole. The apparatus further includes a fluid analysis sensor disposed at the carrier and configured to sense a property of a formation fluid sample extracted from the formation by the probe. A coring device is disposed at the carrier and configured to extend into the probe, to drill into the wall of the borehole, and to extract a core sample. A core sample analysis sensor is disposed at the carrier and configured to sense a property of the core sample. A processor is configured to receive data from the fluid analysis sensor and the core sample analysis sensor and to estimate the property using the data.
US09359889B2
A bottom hole assembly attached to a drillstring includes a main body including multiple electrical insulator sections along a length thereof, each of the electrical insulator sections configured to have a voltage difference generated there across, wherein a transmitting electrical insulator section having a voltage difference generated there across is configured to remain open, and wherein all remaining electrical insulator sections are configured to be electrically shorted there across.
US09359884B2
A positioning tool for determining the position of the tool in a case downhole. The positioning tool utilizes a detecting unit which includes at least a first magnet and a first sensor in a first plane as well as a second sensor also arranged in the first plane. The first and second sensors are configured to detect changes in a magnetic field generated by the first magnet. The first sensor is arranged at a first distance from the first magnet and the second sensor is arranged at a second distance from the first sensor in the first plane.
US09359882B2
Various embodiments include apparatus and methods that use hand mobile communications device with respect to a drilling operation at a drilling site. Data with respect to one or more sensors downhole at a drilling site can be wirelessly received in the hand mobile communications device. Representations of the received data can be displayed on a graphical user interface screen of the hand mobile communications device. The representations can include displaying the data in a graphical representation, a numerical representation, or a graphical and numerical representation on the graphical user interface screen. Additional apparatus, systems, and methods are disclosed.
US09359872B2
A downhole system includes a tubular having a plurality of spaced apertures radially extending through a wall of the tubular. A section of the tubular blocking radial fluid flow through the wall between an interior and exterior of the tubular. The section arranged from a first end to a second end of the tubular. A plurality of filter pucks respectively inserted into at least some of the plurality of apertures. The filter pucks each including a body configured for insertion in one of the apertures and a filtering element within each body; and, at least one control or monitoring line arranged on the section. Further is a method of controlling sand in a downhole system.
US09359865B2
A shifting sleeve has differential piston areas so that applied pressure displaces the sleeve against spring bias, which preferably is a series of Belleville washer stacks associated with modular mandrel components, to obtain the desired opposing force to the movement initiated with pressure applied to differential piston areas. An indexing feature is located between the sleeve and the mandrel passage wall and on a predetermined number of cycles disables the Belleville washer stacks from biasing the sleeve in an opposed direction as when pressure is applied. At this time the pressure in the mandrel acting on the differential piston area simply shifts the sleeve to open a lateral port so that fracturing through the cement that was earlier placed with the port closed can take place.
US09359861B2
A packer tool having simple and reliable setting and release systems comprising three or more slips evenly distributed around a mandrel. Each slip comprises two members with gripping teeth which, except for one slip, typically have the capacity to grip a well casing in opposite axial directions. The remaining slip has only one member with teeth able to grip the casing, the other slip member has dummy teeth with nil gripping capacity. The latter teeth have blunt or rounded edges and are not slanted in a selective gripping direction as the sharper teeth of the other slip members.
US09359857B2
A setting assembly including a settable member. A housing including a chamber and a setting material disposed in the chamber and having a first phase of matter and a second phase of matter. The setting material occupying a greater volume in the second phase than in the first phase. The setting material arranged to exert a setting force on the settable member during transition of the setting material from the first phase to the second phase. Also included is a method of setting a settable member.
US09359855B2
A flow back plug, a bridge plug, a ball drop plug and plug with a disintegratable check therein are made from a common subassembly including, in some embodiments, a mandrel, a slips/seal section, a setting assembly and a mule shoe. In other embodiments, the common components are a mandrel, a slips/seal section and a mule shoe. To make the flow back plug, a ball check is placed in the mule shoe. To make the bridge plug, an obstruction is inserted in the mule shoe. To make the ball drop plug, the mule shoe is left unobstructed so any ball dropped in a well seats in a tapered inlet to the mandrel. To make a plug with a disintegratable check, a ball dropped in the well is of a type that disintegrated in frac liquids. The setting assembly includes a setting rod connected to a setting device in the mandrel passage. When the plug is expanded into sealing engagement with a production string, the setting rod pulls out of the setting device leaving a passage through the mandrel and through the setting device. Another embodiment is an improved adapter sleeve used on conventional setting tools.
US09359854B2
A straddle packer tool for setting against a constraining wall includes: a drag assembly with a locking mechanism for locking a position of the drag assembly relative to the constraining wall; a mandrel installed in and axially moveable through an inner bore of the drag assembly; and a packing element housing including a first annular packing element and a second annular packing element spaced from the first annular packing element, the packing element housing positioned between a stop shoulder on the mandrel and the drag assembly, the packing element being settable to expand the first annular packing element and the second annular packing element by compression between the drag assembly and the stop shoulder. A valve sub including a pressure actuated piston is also described and may be operated to open using the straddle packer tool.
US09359851B2
A high energy tubular shear is connectable within a drilling system and includes a body forming a bore through which a tubular is disposed, a cross-bore intersecting the bore, opposing cutters moveably positioned in the cross-bore on opposite sides of the bore, and the each cutter in hydraulic communication with a respective hydraulic intensifier.
US09359844B2
The present invention relates to a downhole driving unit (11) for insertion into a well, comprising a driving unit housing (51), a hydraulic motor (23) comprising a hydraulic motor housing (93), a wheel assembly (90) comprising a stationary part (91) and a rotational part (92), the stationary part being connected with the driving unit housing and being rotatably connected with the rotational part, the stationary part and the rotational part constituting the hydraulic motor housing, the rotational part comprising a wheel ring (99) closed from one end, wherein the wheel assembly comprises a spring member (113) assembling the hydraulic motor housing. The present invention also relates to a downhole system comprising the driving unit according to the invention and an operational tool connected with the driving unit for being moved forward in a well or borehole as well as to a use of the driving unit according to the invention in a well or borehole for moving itself and/or an operational tool forward in a well or borehole.
US09359838B2
A connection lift system for handling oil and gas drilling tubular components includes a core component and a ring-shaped component. A range of ring-shaped components may be screwed onto the core component. The ring-shaped component may be configured based on the tubular component to be handled, and the core may be compatible with lifting equipment. A method for handling tubular components is also provided.
US09359834B2
A method for installing multiple fiber optic cables in coiled tubing in oil and gas operations.
US09359832B2
A method and a safety device are disclosed for protection of well barrier(s) against excessive bending moments from a riser. The safety device is arranged to detect critical bending loads in or in between the well barrier(s) and/or riser, and may include: a device for detecting changes in a curvature between a load carrying riser pipe and an unloaded stiff body attached to or in the vicinity of the riser pipe, said device for detecting changes in the curvature being arranged to measure a relative distance between the load carrying riser pipe and the unloaded stiff body, and a device for triggering disconnection of a releasable riser connector when the distance between the load carrying riser pipe and the unloaded stiff body reaches a predefined critical distance.
US09359823B2
Disclosed are systems and methods of balancing weight distribution between downhole cutting tools. One system includes a drill bit arranged at a distal end of the bottom-hole assembly, a first sensor sub arranged proximate to the drill bit and configured to monitor one or more operational parameters corresponding to the drill bit, a reamer axially-offset from the drill bit on the bottom-hole assembly, a second sensor sub arranged proximate to the reamer and configured to monitor one or more operational parameters of the reamer, and a communications module communicably coupled to the first and second sensor subs and configured to communicate one or more corrective action signals when the one or more operational parameters of the drill bit and the reamer surpass a predetermined operating threshold.
US09359822B2
A drill bit of the type used to drill a wellbore in the earth can comprise a bore formed in the drill bit, and a plug sealingly and reciprocably disposed in the bore, whereby the plug prevents fluid communication between sections of the bore in the drill bit. The plug can comprise a spherically-shaped member. The plug can comprise a floating plug sealingly and reciprocably disposed in the bore, whereby pressure in the different sections of the bore on respective opposite sides of the plug is substantially equalized.
US09359818B1
A utility holding device is suitable for carrying tools and materials at a construction site. The utility holding device is especially useful for carrying tools and materials for an electrician or a plumber. The wheels provide mobility. The ladder attachment permits a utility holding device to be safely used with a ladder. The scaffold attachment permits a utility holding device to be safely used with a scaffold.
US09359815B2
A device for actuating a curtain/awning in a double glazing includes a pulley supported by support elements connected to connection elements integrally connected to a wall of the double glazing at the movement group. A ring of cord is partially wound around the pulley and is maintained taught by a tensioning element, it too connected to the wall of the double glazing. By applying a tension to the cord ring, a torque is generated tending to rotate the pulley. The torque is transmitted by suitable transmission elements to the group for moving the curtain/awning. The support elements of the pulley are separated from the connection elements for values of tension applied to the cord ring that are greater than a pre-established limit value. The separation cancels the tension of the cord.
US09359814B2
A spring drive system includes a housing and an extendable window cover that is coupled to the housing. The window cover has at least one lift cord that is employed to retract the window cover. The system also includes a first cord spool and a spring drive system having at least one spring having a storage end that is operably coupled to a storage spool and an output end that is operably coupled to an output spool. The lift cord extends from the first cord spool to the window cover, and the spring drive system has an output that controls tension on the first cord spool and no external hand-operated control cord as an input used to raise and lower the window cover.
US09359813B2
The disclosure provides roll-up coverings for an architectural opening, and various embodiments of ladder tapes. Embodiments of the roll-up covering include a roller, a first outer elongate tape, a first inner elongate tape and a plurality of slats disposed between the outer and inner elongate tapes. The first inner elongate tape can further defines a plurality of collapsible hinge segments disposed along the length of the first inner elongate tape. The collapsible hinge segments can be configured to collapse in order to decrease the effective length of the first inner elongate tape when the first inner elongate tape is rolled up around the roller. The collapsible hinge segments can further be configured to expand in order to increase the effective length of the first inner elongate tape when the roll-up covering is unrolled from the roller.
US09359810B2
The subject of the present invention is a watertight fire door for closing an opening in a building or edifice comprising, on the one hand, a fixed frame and at least one opening leaf and, on the other hand, sealing means that provide sealing between the fixed frame and the opening leaf when the door is closed. The or each opening leaf comprises, on the one hand, a framework surrounding an empty space capable of accepting or forming a thermal insulator and being sandwiched between two layers and of thermal insulation each essentially produced from a material having low thermal conductivity or diffusivity and, on the other hand, if appropriate, at least one thermal break.
US09359784B2
The present invention discloses a high-capacity drilling rig system that includes novel design features that alone and more particularly in combination facilitate a fast rig-up and rig-down with a single set of raising cylinders and maintains transportability features. In particular, a transport trailer is disclosed having a first support member and a drive member which align the lower mast portion with inclined rig floor ramps and translate the lower mast legs up the ramps and into alignment for connection. A pair of wing brackets is pivotally deployed from within the lower mast width for connection to the raising cylinder for raising the mast from a horizontal position into a vertical position. A cantilever is pivotally deployed from beneath the rig floor to a position above it for connection to the raising cylinder for raising the substructure from a collapsed position into the erect position.
US09359778B1
The present invention discloses a method and a forming system that reduces the hydrostatic pressure caused by casting freshly mixed concrete or other cementicious material into a vertical form. Reducing the hydrostatic pressure in forms enables relatively weak materials to be used as forms and minimizes the amount of bracing necessary to support the forms—both of which lead to lower construction costs. The method uses the highly thixotropic properties of no-slump or low-slump concrete which enable the concrete to be quickly changed from a semi-solid state to a liquid state and back to a semi-solid state numerous times before it hardens and without affecting the concrete's quality. Since hydrostatic pressure is only present when a liquid state exists, minimizing the amount of liquid concrete in vertical forms will also minimize the hydrostatic pressure present.
US09359775B2
The present invention relates to a substructure unit (1) for a flooring system (10), said substructure unit (1) comprising a first series (2) of panels (3) arranged in parallel and being fixed under a second series (4) of panels (3) arranged in parallel, said first series and second series (2 and 4) of panels (3) being arranged in a criss-cross manner to form a diagonal lattice, said panels (3) of said first and second series (2, 4) having bevelled cut ends (5, 6) extending outwardly from said lattice to form coupling means to interconnect at least two substructure units (1).
US09359767B2
A Z-closure member for raised seam roofs is formed through bending techniques into a shape having a ventilated central vertical member, an upper mounting flange terminating in an upper tab member, and a lower flange member extending in an opposing direction from the upper mounting flange member and terminating in a flexible locking tab. The lower flange is secured to a raised seam roofing panel with fasteners, while the vent cap formed with a return lip is engaged with the upper flange by capturing the upper flange within the return lip. A fastener can be inserted through the vent cap return lip and the upper flange to secure the vent cap to the Z-closure member. A mesh filter is trapped against the vertical member by the upper tab member and the lower flexible locking tab. A seal can be added to the lower flange to seal against the roofing panel.
US09359765B2
A high speed granule delivery system and method is disclosed for dispensing granules in intermittent patterns onto a moving asphalt coated strip in the manufacture of roofing shingles. The system includes a granule hopper and a rotationally indexable pocket wheel in the bottom of the hopper. A series of pockets are formed in the circumference of the wheel and the pockets are separated by raised lands. A seal on the bottom of the hopper seals against the raised lands as the wheel is indexed. In use, the pockets of the pocket wheel drive through and are filled with granules in the bottom of the hopper. As each pocket is indexed beyond the seal, it is exposed to the moving asphalt coated strip below and its granules fall onto the strip to be embedded in the hot tacky asphalt. Well defined patterns of granules are possible at high production rates.
US09359761B2
A joint filling strip has a uniform cross-section along its length that defines a top portion and a shaft portion coupled to the top portion. The top portion includes a rectangular section. The shaft portion includes at least one pair of opposing fins spanning a distance that is greater than a width of the rectangular section.
US09359760B2
An improved concrete floor arrangement is formed from a single cast piece or alternatively a plurality smaller cast pieces linked together to form a floor surface. The floor is arranged in the form of a grid.
US09359756B2
An apparatus and method is disclosed that allows for the efficient installation and connection of steel beams to a concrete foundation. A steel beam support embed according to the present disclosure can be readily set in place during the forming of the concrete foundation via detachable anchors, thus allowing the installer to avoid rebar or other foundation components that would otherwise need to be moved or adjusted for proper placement of the embed. A steel beam support embed as disclosed herein also, after its installation in the concrete foundation, provides for adjustable connection to a steel beam without the need for field welding.
US09359752B2
A toilet flush valve that has a moveable buoyant float therein, wherein the float has an open bottom end to trap air therein and wherein the housing includes controls to selectively release air to allow the float to move upwardly therein to permit flushing. By timing when one or two air vents on the housing are open, the duration and volume of the flush can be controlled, with the buoyancy provided by the water lifting the float to open the flush valve. This provides a flushing system with minimal activation energy.
US09359750B1
Embodiments of an apparatus for draining liquid generally include a liquid inlet, a p-trap, an additive reservoir, a fluid outlet, a float switch, a valve, and a fitting, wherein the liquid inlet allows for introduction of liquid, the p-trap allows for maintenance of a liquid level whereby contact is provided between the liquid and an additive contained in the additive reservoir, the fluid outlet is configured to maintain the liquid level above an additive reservoir bottom interior surface, the float switch provides indication of high liquid level, the valve allows for blockage of fluid flow between the p-trap and the liquid inlet, and the fitting allows for introduction of high-pressure fluid into the apparatus. Embodiments of a method for clearing a liquid draining apparatus generally include ceasing flow of liquid there into, operating a valve to substantially prevent reverse flow of liquid therefrom, and providing high-pressure fluid into the apparatus.
US09359748B1
A two-stage coaxial shower head that allows conventional water flow through the shower head or a mixture of product and water through a product low flow nozzle. The product may be such liquids as soap, moisturizer, shampoo, or hair conditioner. Products are contained within product pressure reservoirs each with a product section and a piston. During a shower, a user rotates a selector dial at the multi-ported spool valve to select a product or conventional water flow for rinsing. When a product is selected water flow through a water supply tube from the multi-ported spool valve to the shower head will cease and pressure to force water down to the lower part of a product reservoir to raise the piston in the product pressure reservoir to reject product that is transported to a shower head section. A version using electronics instead of hydraulics is also presented.
US09359747B2
A sanitary fitting having a fitting housing with an electrical control unit for controlling the water flow through at least one water line which sanitary fitting can be maintained or repaired with particularly little effort particularly in applications involving vandalism. This is achieved by having a fitting housing that can be firmly fixed at the installation site with an assembly cover, which can be released from the fitting main body and which covers electrical control unit, turbine and hydraulic control elements within the fitting housing main body and which provides direct access for maintenance and servicing purposes.
US09359743B2
A control system for a hybrid construction machine includes: a turning motor provided in a turning circuit; a pressure detector for detecting a turning pressure of the turning motor; a variable displacement type of fluid pressure motor for regeneration which is rotated by means of pressurized fluid guided from the turning motor; a motor generator adapted to be rotated integrally with the fluid pressure motor; and a controller adapted to predict a turning regeneration flow from the turning motor on the basis of the turning pressure detected by pressure detector to control a tilt angle of the fluid pressure motor on the basis of the predicted turning regeneration flow.
US09359741B2
Disclosed is a wind turbine generator foundation with pressure-dispersive pre-stressed anchor rods or anchor ropes. The foundation comprises a pile cap, a plurality of foundation piles arranged circumferentially at the bottom of the pile cap at uniform spacing, and a wind turbine generator tower connected to an upper part of the pile cap.
US09359734B2
A snow plow-blower operates as a snow plow, snow blower, or as a snow plow-blower combination. The device includes a plow head blade optionally having retractable/pivotal scoop wings and a cavity with an aperture with blower doors and a blower unit. The snow blower unit includes an auger and impeller to move snow into the unit and force it out of a discharge chute. Blower doors are provided over the snow blower unit cavity to prevent snow from entering into the cavity when the blower is off. Optionally, the blower doors move along a track and rest flush against the plow head to open and close off access to the cavity. Alternatively, the blower doors are hingedly mounted to pivot to open and closed positions. The blower doors may be constructed to operate as blower blades to direct snow into the blower unit; alternatively, separate blower blades are provided to optimize snow removal and mitigate jamming/clogging.
US09359729B2
A construction machine apparatus includes a plurality of ground engaging supports, a machine frame supported from the ground engaging supports and a milling drum supported from the machine frame. A milling drum location detection system is configured to determine a drum location in an external reference system. A location indicator system includes a memory configured to store information identifying a location of one or more areas to be avoided in the external reference system, and a controller configured to compare the drum location to the location of the one or more areas to be avoided, and to provide an output corresponding to a proximity of the milling drum to the location of the one or more areas to be avoided.
US09359727B2
A paving machine for spreading, leveling and finishing concrete having a main frame, center module, bolsters laterally movably, and a crawler track associated with respective aft and forward ends of the bolsters. A bolster swing leg for each crawler track supports an upright jacking column. A worm gear drive permits rotational movements of the crawler track and the jacking column. A hinge bracket is interposed between each swing leg and a surface of the bolsters to enable pivotal movements of the swing leg. A length-adjustable holder engages the pivot pin on the hinge bracket and pivotally engages the swing leg. The holder permits pivotal motions of the swing leg in its length-adjustable configuration and prevents substantially any motion of the swing leg in its fixed-length configuration. A feedback loop cooperates with transducers keeping the crawler tracks position. The paving machine can be reconfigured into a narrowed transport configuration.
US09359719B2
A problem is to provide, in the field of polyhydroxy polyurethane resins the development of applications of which has not moved ahead by conventional technologies, a self-crosslinking polyhydroxy polyurethane resin, which enables to provide products, such as imitation leathers, excellent in abrasion resistance, chemical resistance, heat resistance and the like, and moreover, which is useful from the viewpoint of a reduction in greenhouse gas, contains carbon dioxide incorporated and fixed therein, and is responsive to environmental conservation. Provided are a self-crosslinking, polysiloxane-modified, polyhydroxy polyurethane resin having masked isocyanate groups in a structure of a polysiloxane-modified, polyhydroxy polyurethane resin derived from a reaction of a 5-membered cyclic carbonate compound and an amine-modified polysiloxane compound and having polysiloxane segments therein; a production process of the self-crosslinking resin; a resin material containing the self-crosslinking resin; and an imitation leather composed of a base fabric and a resin composition composed of the self-crosslinking resin as its principal component and impregnated in or laminated on the base fabric.
US09359710B2
A laundry treating apparatus is disclosed. The laundry treating apparatus includes a cabinet forming an external appearance of the laundry treating apparatus, a laundry accommodation portion arranged in the cabinet and providing a space to accommodate laundry, a machine chamber including at least one of an air supply unit to supply air to the laundry accommodation portion and a moisture supply unit to supply moisture to the laundry accommodation portion, the machine chamber being provided separately from the laundry accommodation portion, a laundry supporter to support a hanger having laundry placed thereon and to move the hanger such that a free end of the hanger forms an arc trajectory in the laundry accommodation portion.
US09359704B2
A washing machine containing a tub and basket placed within the tub, a basket bottom, a driving shaft coupled to the basket, a motor coupled to the driving shaft, a propeller located within the bottom and impelled by an end of the driving shaft, the propeller containing a scrubber, a center and a support, the scrubbers have a transversal section made from at least three arch circumference sections; a lower face of the propeller has a fin, which along with the bottom, functions as a centrifugal pump creating a current or washing liquor flow which is led through the water tower. In a preferred embodiment, the driving shaft has a solar gear coupled thereto which rotates a satellite gear and over the upper face of the support and between the scrubbers a mini-propeller is provided, the satellite gear is coupled to an axis that rotates the mini-propeller.
US09359701B2
The present disclosure is related to a wearable knitting needle support device. The wearable needle support or knitting pad includes an anchoring filling configured to support a needle in a desired position, a needle reception area with apertures on all or parts of the surface that covers the anchoring filling, and a contoured substrate opposite of the needle reception surface. The contoured substrate is concavely curved along at least one axis and serves to produce an identical curve in the lower piece 116. The knitting pad may be connected to a belt or other attachment mechanism that secures the pad to a select position on a user.
US09359698B2
A shedding apparatus for waste selvage includes a pair of first swing levers and a pair of second swing levers for forming an open shed of selvage yarns. The drive force to the swing levers is transmitted by cranking through a drive shaft which is coaxial with the sun gear of a planetary gear mechanism. The crank mechanism using the cranking includes a crank, first end of which is fixedly connected to the drive shaft for rotation therewith, a drive lever for transmitting a rotational force to the swing levers, and a connecting rod connected between second end of the crank and the drive lever. A ratio between an eccentric distance of the crank and a length of the drive lever is less than 1.
US09359697B2
A spinning wheel assembly, including a collapsible frame and a spinning assembly connectable thereto. The spinning assembly includes a first grooved pulley and a plurality of differently sized second grooved pulleys, each pulley being rotatably connectable to the frame. A spindle is removably connectable to a respective grooved second pulley, and an endless belt is operationally connected to the first and second pulleys. Each respective grooved second pulley has at least one circumferential groove defining an effective diameter and at least one unique effective diameter.
US09359689B2
Preparation of semiconductor nanocrystals and their dispersions in solvents and other media is described. The nanocrystals described herein have small (1-10 nm) particle size with minimal aggregation and can be synthesized with high yield. The capping agents on the as-synthesized nanocrystals as well as nanocrystals which have undergone cap exchange reactions result in the formation of stable suspensions in polar and nonpolar solvents which may then result in the formation of high quality nanocomposite films.
US09359687B1
A non alpha controlled Tin including Tin and a trace amount of Polonium is utilized as a plating anode to selectively plate Tin upon a plating cathode. Tin may be selectively plated by pulse plating the non alpha controlled Tin with current control to suppress plating of Polonium upon the plating cathode. Tin may also be selectively plated by pulse plating the non alpha controlled Tin with potential control to suppress plating of Polonium upon the plating cathode. Tin may also be selectively plated by pulse and reverse plating to plate out Polonium upon a filtering cathode. Tin may also be selectively plated by plating out Polonium upon a filtering cathode within a concentrate. Tin may also be selectively plated by plating out purified Tin upon a filtering cathode, separating the purified Tin from the filtering cathode, and utilizing the purified Tin to plate Tin upon the plating cathode.
US09359682B2
A method for forming a surface layer, the purpose thereof is to form a high erosion resistant film. The method for forming a surface layer includes: arranging a member (2) in a machining fluid (3); and forming the surface layer including silicon by spacing a silicon electrode (1) from the member (2) at a predetermined distance, and by supplying silicon component from the silicon electrode (1) to the member side by applying a predetermined voltage and generating electric discharge, and an iron-based metal texture including silicon of 3 to 11 wt % is formed at a thickness of 5 to 10 μm at a portion to be treated by repetitively generating a electric discharge pulse in which a time integration value of a current value of the electric discharge pulse is in a range of 30 A·μs to 80 A·μs.
US09359655B2
The invention relates to a pelletizing feed containing chromite ore, at least one nickel salt, and silicon carbide as the only carbonaceous material and the only reducing agent. The invention also relates to process for manufacturing the pelletizing feed comprising the steps providing chromite, at least one nickel salt and silicon carbide, and mixing chromite, at least one nickel salt and silicon carbide. The invention also relates to use of the pelletizing feed as a starting material for the manufacture of sintering feed. The invention also relates to a sintering feed in the form of pellets containing the pelletizing feed. The invention also relates to sintered pellets containing the sintering feed. The invention also relates to process for manufacturing the sintered pellets. The invention also relates to use of the sintered pellets as a component of smelting feed. The invention also relates to smelting feed comprising sintered pellets. The invention also relates to process for manufacturing ferrochrome alloy. The invention also relates to ferrochrome alloy obtainable by the method.
US09359654B2
The mist cooling apparatus (3) includes: a cooling system (30) which includes a nozzle (35, 35A) that sprays cooling liquid in a form of a mist onto a treatment object which has been heated and provided in a cooling furnace (10), and a pump (33) that is driven by a drive source and thereby makes the cooling liquid flow toward the nozzle (35, 35A); and a second cooling system (40) which operates in response to a stoppage of the drive source, and thereby cools the treatment object.
US09359646B2
The present invention relates to a kit and nucleic acid chip for diagnosing bladder cancer using a bladder cancer-specific marker gene. More particularly, the invention relates to a kit and nucleic acid chip for diagnosing bladder cancer, which can detect the promoter methylation of a bladder cancer-specific gene, the promoter or exon region of which is methylated specifically in transformed cells of bladder cancer. The use of the diagnostic kit or nucleic acid chip of the invention enables diagnosis of bladder cancer at an early stage of transformation, thus enabling early diagnosis of bladder cancer, and can diagnose bladder cancer in a more accurate and rapid manner compared to a conventional method.
US09359640B2
Compositions, methods and kits are disclosed for synthesizing and amplifying pools of probes using precursor oligonucleotides. In some aspects the precursor is amplified and nicking enzymes are used to separate the full length probes from the amplification products. The methods enable the preparation of single stranded DNA probes of defined sequence and length that are suitable for use in target detection assays.
US09359635B2
A modified luciferase protein which is a sensor for molecules including cAMP, cGMP, calcium, chelators thereof, kinases, or phosphatases is provided. Also provided is a circularly permuted anthozoan luciferase protein and a decapod crustacean luciferase protein, optionally containing one or more heterologous amino acid sequences, at least one of which directly or indirectly interacts with a molecule of interest. Further provided is a modified anthozoan luciferase protein and a decapod crustacean luciferase protein containing an insertion of one or more heterologous amino acid sequences, at least one of which directly or indirectly interacts with a molecule of interest.
US09359632B2
Devices, systems and methods including a sonicator for sample preparation are provided. A sonicator may be used to mix, resuspend, aerosolize, disperse, disintegrate, or de-gas a solution. A sonicator may be used to disrupt a cell, such as a pathogen cell in a sample. Sample preparation may include exposing pathogen-identifying material by sonication to detect, identify, or measure pathogens. A sonicator may transfer ultrasonic energy to the sample solution by contacting its tip to an exterior wall of a vessel containing the sample. Multipurpose devices including a sonicator also include further components for additional actions and assays. Devices, and systems comprising such devices, may communicate with a laboratory or other devices in a system for sample assay and analysis. Methods utilizing such devices and systems are provided. The improved sample preparation devices, systems and methods are useful for analyzing samples, e.g. for diagnosing patients suffering from infection by pathogens.
US09359610B2
A method for purifying GLA-domain coagulation proteins, includes the following steps: a) bringing a sample containing one or more GLA-domain coagulation proteins into contact with an affinity substrate on which nucleic aptamers which bind specifically to the GLA-domain coagulation proteins are immobilized, in order to form complexes between (i) the nucleic aptamers and (ii) the GLA-domain coagulation protein(s), b) releasing the GLA-domain coagulation protein(s) from the complexes formed in step a), and c) recovering the GLA-domain coagulation protein(s) in a purified form.
US09359608B2
Disclosed herein are antisense compounds and methods for decreasing STAT3 mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate hyperproliferative diseases.
US09359606B2
The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
US09359588B2
The present invention relates to multilayered structures. In various embodiments, the present invention provides an at least partially transparent multilayered structure that includes at least one first layer including at least one polyolefin, and at least one second layer including at least one of a cyclic olefin copolymer and a cyclic olefin polymer. In various embodiments, the present invention provides methods of making such multilayered structures, and photobioreactors having compartments including such multilayered structures.
US09359580B2
The present invention provides methods for the isolation of oils from intact or lysed microorganisms in aqueous media with pressurized carbon dioxide as a solute. Such oils may be used for the production of biofuels. Also provided for are methods for harvesting and rupturing whole cell microorganisms in aqueous media with pressurized carbon dioxide as a solute.
US09359566B2
Aromatic extraction and hydrocracking processes are integrated to optimize the hydrocracking units design and/or performance. By processing aromatic-rich and aromatic-lean fractions separately, the hydrocracking operating severity and/or catalyst reactor volume requirement decreases.
US09359564B2
A process and apparatus is provided to produce desulfurized diesel at low pressure with high cetane rating. A hydrotreated stream is stripped and fed to a saturation reactor. The saturated stream is stripped again and fractionated to provide diesel product. Unconverted oil may be hydrocracked and stripped with the saturated product.
US09359558B2
A method of operating a carbon to liquids system is provided. The method includes receiving a flow of syngas and reacting, in a reactor, the syngas and a catalyst in a Fischer-Tropsch reaction to produce a product including steam, wherein the reactor includes a polymeric material that is configured to permit the permeation of the steam therethrough. The method also includes recycling the permeated steam to a vessel positioned upstream from the reactor.
US09359547B2
A method of servicing a wellbore in a subterranean formation comprising placing a wellbore servicing fluid comprising a coupling agent, a hardenable resin and a hardening agent into the wellbore wherein the coupling agent comprises a multihydroxy phenyl, a dihydroxy phenyl, a trihydroxy phenyl, ascorbic acid, a hydroxymethylnaphthol, an oxidation product thereof, a derivative thereof, or combinations thereof. A wellbore servicing fluid comprising a coupling agent, a hardenable resin, a hardening agent and a proppant wherein the coupling agent comprises a multihydroxy phenyl, a dihydroxy phenyl, a trihydroxy phenyl, ascorbic acid, a hydroxymethylphenol, a hydroxymethylnaphthol, an oxidation product thereof, a derivative thereof, or combinations thereof.
US09359538B2
Provided is a sealant for use in ink jet recording heads, comprising a cationically polymerizable resin; a fluorine-containing compound that is liquid at a temperature in a range of 20° C.±15° C.; and a cationic polymerization initiator.
US09359536B2
Disclosed is an aqueous adhesive agent composition which has no concern about environmental safety and can be used as an adhesive agent composition for automobile interior materials. The aqueous adhesive agent composition comprises (A) an acid-modified polyolefin resin and (B) a core-shell-type curing agent.
US09359534B2
A hot-melt adhesive composition, the use thereof, and a composite body including the hot-melt adhesive composition. The hot-melt adhesive composition includes a polyolefin P, which is solid at 25° C., a soft resin WH with a softening point between −10° C. and 40° C., and a polar modified polyolefin wax PW.
US09359523B2
The invention relates to unique applications for the novel high melt flow, low viscosity, selectively hydrogenated styrene-butadiene-styrene (hSBS) or selectively hydrogenated controlled distribution styrene-butadiene/styrene-styrene (hSBSS) block copolymers, wherein the melt flow rate of said block copolymer is at least 100 g/10 min at 230° C. under 2.16 kg mass according to ASTM D1238. These block copolymers are novel and have the highest melt flow rate of any styrenic block copolymer also possessing high strength and elasticity. It has applications that prior to the present invention were not normally possible due to the normal low melt flow rate of styrenic block copolymers. The present invention also encompasses various fields of use such as a fiberglass hSBS or hSBSS reinforced mat, low viscosity hSBS or hSBSS coatings for industrial uses, hot melt adhesives prepared from hSBS or hSBSS blended with polyalpha-olefins, and elastic film, fiber, and nonwoven constructions using hSBS or hSBSS.
US09359519B2
Disclosed are aqueous coating compositions comprising a branched alkyl alcohol ethoxylate oligomer of formula where m is 1 to 3 and where n is an average number such that Mn is from about 1030 to about 2400, at least one latex polymer and water. The compositions also preferably comprise at least one pigment such as titanium dioxide. The compositions are for instance architectural latex paints. The compositions are for instance free of alkyl phenol ethoxylate (APE) surfactants and are low or zero VOC (volatile organic compounds). The compositions are provided effectively long open film times with excellent leveling properties.
US09359513B1
Printable dopant formulations, methods of making such dopant formulations, and methods of using such dopant formulations are disclosed. The dopant formulations provide a printable dopant ink with a viscosity sufficient to prevent ink spreading when deposited in a pattern on a substrate. Furthermore, an ion exchange purification process provides the dopant formulation with a reduced metal ion concentration, and thus a relatively high purity level. Consequently, the dopant residue remaining on the substrate after curing and/or dopant activation process is relatively uniform, and therefore can be easily removed.
US09359509B2
A water-based, carbon filler-dispersed coating formulation for forming a conductive coating film contains (1) a hydroxyalkyl chitosan as a resin binder, (2) a conductive carbon filler, and (3) a polybasic acid or its derivative in a water-based medium containing at least water as a polar solvent. In 100 parts by mass of the coating formulation, the hydroxyalkyl chitosan (1) is contained in a range of from 0.1 to 20 parts by mass, and the conductive carbon filler (2) is contained in a range of from 1 to 30 parts by mass. An electricity-imparting material, an electrode plate for an electricity storage device, a process for producing the electrode plate, and the electricity storage device are also disclosed.
US09359497B2
The present invention relates to a new solvent-free preparation method of a (meth)acrylic acid polymer in solution, where said polymer has a molecular weight less than 8,000 g/mol and a polydispersity IP index between 2 and 3 by radical polymerization, the polymers obtained by this means, and their applications in industry.
US09359495B2
A rubber composition for heat-resistant conveyor belts according to the present technology contains an ethylene-butene copolymer and an ethylene-propylene-diene copolymer. The mass ratio of the ethylene-butene copolymer to the ethylene-propylene-diene copolymer [(ethylene-butene copolymer)/(ethylene-propylene-diene copolymer)] is from 5/95 to 95/5; and the amount of diene units in the ethylene-propylene-diene copolymer is 2.0% by mass or less per 100 parts by mass of the total of the ethylene-butene copolymer and the ethylene-propylene-diene copolymer.
US09359490B2
The present invention refers to diene-based unsaturated polymer latex particles having a particle size measured as d90-value of less than 60 nm and a method for their production. Methods for using the diene-based polymer latex as rubber and for conversion to hydrogenated polymers, with reduced gel formation, are also disclosed.
US09359483B2
A hybrid carbon black, a coating composition, and a shielding material employing the same are provided. The hybrid carbon black includes a core of carbon black, and a cross-linked network polymer film covering the whole surface of the carbon black overall. In particular, the carbon black core has a mass fractal dimension between 2 and 3 and a surface fractal dimension between 2 and 2.5, and the cross linking network polymer film includes a product obtained by crosslinking a composition including a styrene monomer and a divinylbenzene monomer.
US09359479B2
The present disclosure generally relates to methods of using boron-containing additives for crosslinking polysilazane green fibers, which are precursors to silicon carbide fibers. These methods provide a controllable process for crosslinking silicon carbide fibers while providing a simple way for the introduction of boron as a sintering aid into the polymer structure.
US09359478B2
The present invention provides a curable composition, comprising: (A) at least one polycarbosilane A represented by the following formula (1): [R1R2R3SiX1/2]M[R4R5SiX2/2]D[R6SiX3/2]T[SiX4/2]Q (1), (B) at least one organopolysiloxane B represented by the following formula (2): [R7R8R9SiO1/2]M′[R10R11SiO2/2]D′[R12SiO3/2]T′[SiO4/2]Q′, (2), and (C) at least a catalyst, as well as a cured product obtainable by heating such composition, and the use of the composition as semiconductor encapsulating material and/or electronic elements packaging material.
US09359476B2
The polyamide resin of the present invention is a polyamide resin containing an amine group and a carboxyl group, wherein the amine group concentration is about 200 to 300 μeq/g and two to six times as high as the carboxyl group concentration. The polyamide resin has excellent long-thermal stability.
US09359474B2
The present invention provides unimolecular metal complexes having increased activity in the copolymerization of carbon dioxide and epoxides. Also provided are methods of using such metal complexes in the synthesis of polymers. According to one aspect, the present invention provides metal complexes comprising an activating species with co-catalytic activity tethered to a multidentate ligand that is coordinated to the active metal center of the complex.
US09359467B2
Thermoset/supramolecular hybrid composites and resins, resulting from bringing at least one thermosetting resin precursor, this thermosetting resin precursor including hydroxyl functions and/or epoxy groups, and optionally ester functions, into contact with at least one hardener chosen from carboxylic acids and acid anhydrides, and with at least one compound including, on the one hand, at least one associative group, and on the other hand at least one function enabling the grafting thereof to the thermosetting resin precursor, to the hardener or to the product resulting from the reaction of the thermosetting resin precursor and the hardener, in the presence of at least one transesterification catalyst. Process for manufacturing these materials, process for transforming and process for recycling these materials. Novel solid forms of hybrid composites and resins which can be used in the implementation of these processes.
US09359463B2
Non water-soluble polymers with a comb structure and a (meth)acrylic skeleton on which are grafted side chains containing at least one hydrophobic monomer of the styrene or (meth)acrylic ester type on C1 to C4, and at least one hydroxy or methoxy polylakylene glycol monomer. The levels of monomers are such that the polymer is amphiphilic because it is both rich in hydrophobic monomer and polylakylene glycol monomer. These products, used in paper coating dispersions, enable an increase in their Brookfield™ viscosity, a reduction in their ACAV viscosity, and an improvement in their water retention, which makes them particularly well suited for dry extract and/or high deposit speed coatings.
US09359454B2
A method for making a solid electrolyte includes the following steps. A first monomer, a second monomer, an initiator and a lithium salt are provided. Wherein the first monomer is R1—OCH2—CH2—OnR2, the second monomer is R3—OCH2—CH2—OmR4, each “R1”, “R2” and “R3” includes —C═C— group or —C≡C— group, “R4” is an alkyl group or a hydrogen (H), and “m” and “n” represents an integer number, molecular weights of the first and second monomers are greater than or equal to 100, and less than or equal to 800. The first and second monomers, the initiator and the lithium salt are mixed to form a mixture, and a weight ratio of the first monomer to the second monomer is less than or equal to 50%. The first and second monomers are polymerized to form an interpenetrating polymer network, and the lithium salt is transformed into a solid solution and dispersing in the interpenetrating polymer network.
US09359450B2
The amount of water-insoluble fibers in a water-soluble cellulose derivative is reduced in a process comprising the steps of a) providing a water-soluble cellulose derivative having a residual amount of at least 20 ppm by weight of water-insoluble fibers in a 2 weight percent aqueous solution of the water-soluble cellulose derivative; b) mixing the water-soluble cellulose derivative of step a) with a liquid in a compounder to provide a moist water-soluble cellulose derivative having a temperature of at least 50 C and a moisture content of from 35 to 90 percent, based on the total weight of the moist cellulose derivative; and c) drying-grinding the mixture of step b) in a gas-swept impact mill to obtain a dried and ground cellulose derivative.
US09359449B2
The invention provides polynucleotides and methods for expressing light-activated proteins in animal cells and altering an action potential of the cells by optical stimulation. The invention also provides animal cells and non-human animals comprising cells expressing the light-activated proteins.
US09359448B2
Bispecific antibodies are provided that specifically bind B-cell Activating Factor of the TNF Family (BAFF) and Interleukin-17A (IL-17) and are characterized as having high affinity and strong neutralizing properties to both BAFF and IL-17. The bispecific antibodies of the invention are expected to be useful in treating Lupus Nephritis (LN), Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), Psoriasis (Ps), Ankylosing Spondylitis (AS), Psoriatic Arthritis (PA), primary Sjögren's Syndrome (pSS), or Multiple Myeloma (MM).
US09359436B2
The present invention provides a method for inducing a cancer specific immune response against MUC1 using an immunogenic glycopeptide. Other aspects of the invention are a pharmaceutical composition comprising the immunogenic glycopeptide and a cancer vaccine comprising the immunogenic glycopeptide. Another aspect is an antibody generated using the immunogenic glycopeptide and the use of said antibody in therapy and diagnosis.
US09359429B2
Provided are a hybridoma cell CGMCC No. 4783 that secretes a monoclonal antibody of an anti-cyanobacteria cell surface antigen, and the secreted monoclonal antibody thereof. Also provided are an anti-cyanobacteria recombinant antibody polypeptide, encoding gene, preparation method and use thereof. The anti-cyanobacteria recombinant antibody polypeptide is composed of an anti-cyanobacteria antibody mimetic polypeptide operably linearly connecting to the carboxyl terminal of an Escherichia coli polypeptide. The anti-cyanobacteria antibody mimetic polypeptide is a polypeptide with cyanobacteria identifying and binding capability designed based on an antigen binding fragment of the monoclonal antibody secreted by the CGMCC No. 4783 hybridoma cell. The anti-cyanobacteria recombinant antibody polypeptide directly form an ion channel on the cell membrane of a cyanobacteria to kill the cyanobacteria, targeted killing the cyanobacteria (prokaryote) without killing other beneficial eukaryotic cell algae.
US09359428B2
Provided herein are antibodies that specifically bind and neutralize Staphylococcus enterotoxin B. In addition, nucleic acids encoding such antibodies, and cells that express such antibodies are provided. Also provided are methods for treating diseases mediated by, and for neutralizing Staphylococcus enterotoxin B.
US09359427B2
The present invention pertains to a method for culturing a suspension of immortalized human blood cells, preferably cells of myeloid leukaemia origin or cells derived therefrom, wherein said method provides a high productivity, a high cell viability and growth rate and a high batch-to-batch consistency, and can be scaled up without altering these parameters.
US09359426B2
The present invention relates to methods for producing low-iron Lf having improved antimicrobial activity and to a low-iron Lf having improved antimicrobial activity.
US09359424B2
Multimeric polypeptides and pharmaceutical uses thereof; multimers comprising alpha3 and alpha1 peptides of an HLA-G antigen and methods of producing such multimers, pharmaceutical compositions comprising the same, as well as their uses for treating various diseases including organ/tissue rejection. Said multimers comprise at least two monomers, each of said monomers being selected in the group consisting of a peptide P2 of formula P1-X3 or X2-X3, wherein P1 is of formula X1-X2, wherein X1 represents a peptidic linker including a cysteine amino acid and X2 represents an alpha1 domain (or alpha1 peptide) of HLA-G and X3 represents an alpha3 domain of HLA-G.
US09359422B2
The present invention relates to biologically active single chain relaxin polypeptides comprising a relaxin B chain derived from relaxin-3, the polypeptides being truncated by one or more amino acids at the C-terminus of the relaxin-3 B chain. Typically the single chain relaxin polypeptides are antagonists of the RXFP3 receptor, and in some embodiments are selective antagonists of the RXFP3 receptor.
US09359420B2
The present invention refers to single-chain fusion proteins comprising three soluble TNF superfamily (TNFSF) cytokine domains and nucleic acid molecules encoding these fusion proteins. The fusion proteins are substantially non-aggregating and suitable for therapeutic, diagnostic and/or research applications.
US09359419B2
A peptide consisting of 7-17 amino acids and including the adjacent hexamer TX1EX2X3E, where X1, X2 and X3 can be any natural or non natural amino acid, wherein the peptide does not exhibit TNF-receptor-binding activity and is cyclic, for the treatment or prevention of vascular complications in diabetes patients.
US09359418B2
In T lymphocytes, p38 mitogen activated protein kinase (MAPK) can be activated through an alternative pathway that involves phosphorylation at tyrosine 323. Disclosed herein is the identification of a minimal region of the growth arrest and DNA damage-inducible alpha (Gadd45α) protein that is required for binding to and inhibition of tyrosine 323-phosphorylated p38 in T cells. The disclosed Gadd45α polypeptides inhibit proliferation of T cells in response to T cell receptor stimulation, inhibit differentiation of T cells into Th1 or Th17 cells, inhibit the production of proinflammatory cytokines, and reduce tumor formation and growth of inflammatory cancers, such as pancreatic cancer.
US09359415B2
The present invention provides fusion polypeptides comprising polypeptide ligands that are modified by circular permutation and fused to at least one polypeptide fusion partner wherein such fusion polypeptides have new, improved or enhanced biological functions or activities. Such improvements include, but are not limited to, increased binding affinity, increased activity, increased agonist activity (super agonist), antagonist activity, increased accessibility, increased flexibility of the active site, increased stability, broader and/or changed substrate specificity, and combinations thereof.
US09359414B2
The invention relates to novel polypeptides which are recognized by anti-Trichinella antibodies. Said polypeptides can be used particularly for detecting anti-Trichinella antibodies and in trichinosis prevention.
US09359406B2
A therapeutic composition comprising (1) a complementary peptide comprising a sequence complementary to a major immunogenic region of an acetylcholine receptor (AChR) involved in myasthenia gravis (MG), the sequence being SEQ ID NO:1 (with modified tryptophan in position 8 carrying at least one 2,4,6-trimethoxybenzyl group as hydrocarbonation), (2) a complementary peptide having at least a sequence SEQ ID NO:2, which is complementary to a T-cell recognition site of the acetylcholine receptor, and (3) at least one carrier, may be used in the therapeutic or prophylactic treatment of myasthenia gravis in mammals.
US09359394B2
Disclosed is a method for selective synthesis of 1,2-cis-α-linked glycosides which does not require the use of the specialized protecting group patterns normally employed to control diastereoselectivity. Thioglycoside acceptors can be used, permitting iterative oligosaccharide synthesis. The approach eliminates the need for lengthy syntheses of monosaccharides possessing highly specialized and unconventional protecting group patterns.
US09359393B2
The present invention provides a manufacturing method that can easily manufacture a compound known as photoresponsive (photocoupling) nucleic acids at high yield in a shorter period of time than that of the conventional technology. The present invention relates to a method of manufacturing a photoresponsive nucleic acid which includes a step of reacting a nucleic acid having groups represented by the Formula I, the Formula III, the Formula IV, or the Formula V and a compound represented by the Formula II, or reacting a nucleic acid having groups represented by the Formula VI, the Formula VIII, the Formula IX, or the Formula X and a compound represented by the Formula VII by heating them by microwaves in the presence of a metal catalyst, a basic substance, and a solvent.
US09359388B2
The present invention discloses a transition metal compound having a novel structure and including a heteroatom, a catalyst composition including the same, and a method for preparing polymers using the same. The transition metal compound according to an embodiment of the present invention has good copolymerization properties, and a polymer having a low density may be prepared using thereof. Thus, a copolymer having various uses may be prepared.
US09359381B2
The present invention provides a compound of formula I or a pharmaceutically acceptable salt thereof; and its therapeutic uses. The present invention further provides a combination of pharmacologically active agents and a pharmaceutical composition.
US09359380B2
The present invention relates to compounds useful as inhibitors of DNA-PK. The invention also provides pharmaceutically acceptable compositions comprising said compounds and methods of using the compositions in the treatment of various disease, conditions, or disorders.
US09359371B2
Disclosed are bicyclic group substituted pyrimidine compounds, pharmaceutical acceptable salts thereof or stereoisomers thereof. Also disclosed are preparation methods, pharmaceutical formulations, and pharmaceutical compositions of the compounds, and use of the compounds, pharmaceutical formulations, and pharmaceutical compositions for preparing a medicament for treating and/or preventing sexual dysfunction diseases and diseases with lower urinary tract symptoms.
US09359367B2
Disclosed are compounds of formula (I), their tautomeric forms, stereoisomers, and pharmaceutically acceptable salts thereof, wherein R1-R6, R7a-d, R8a-d, A, M, n, and p are as defined in the specification, pharmaceutical compositions including a compound, tautomer, stereoisomer, or salt thereof, and methods of treating or preventing diseases or disorders, for example, cancer, that are amenable to treatment or prevention by inhibiting the PARP enzyme of a subject.
US09359356B2
A compound, (4s)-1-azaadamantane-4yl formate ester, is described. In addition, a process is described for preparing (4s)-1-azaadamantane-4yl formate ester, aminothiadiazole-phenyl phosphate salt, bromothiadizole-phenyl or (4s)-4-(5-phenyl-1,3,4-thiadiazol-2-yloxy)-1-azatricyclo[3.3.1.13,7]-decane dihydrogen citrate. Furthermore, a process is described, comprising step of hydrolyzing (4s)-1-azaadamantane-4yl formate ester to form (4s)-1-azaadamantan-4-ol HBr salt.
US09359355B2
Compounds of Formula I are useful inhibitors of CDK 4, CDK6, and FLT3. Such compounds are useful in treating cancer and various other disease conditions. Compounds of Formula I have the following structure: where R1 is a group of Formula IA, Formula IB, Formula IC, or Formula ID and the definitions of the other variables are provided herein.
US09359352B2
The present invention provides substituted benzimidazole compounds of Formula I: wherein the variables R1, R2, W1, W2, W3, W4, W5, W6, Wa, Wb, Wc and Wd are defined herein. The compounds are useful as phosphoinositide 3-kinase (PI3 kinase) inhibitors.
US09359347B2
The subject invention concerns materials and methods for inhibiting the Akt/PKB pathway. In one embodiment, a compound of the invention inhibits kinase activity and/or phosphorylation levels of Akt proteins. The subject invention also concerns methods for inhibiting or killing a cancer cell or other cell in which expression of an Akt protein is elevated or constitutively active, comprising contacting the cell with an effective amount of a compound of formula I. The subject invention also concerns methods for treating cancer or a tumor in a person or animal comprising administering an effective amount of a compound of formula I to the person or animal.
US09359335B2
Objects are to provide the following: a substance that facilitates hole injection and has high triplet excitation energy; a light-emitting element having high emission efficiency using the substance that facilitates hole injection and has high triplet excitation energy; a light-emitting element having low driving voltage; and a light-emitting device, an electronic device, and a lighting device having low power consumption. Provided is a triazole derivative in which a dibenzothiophen-4-yl or dibenzofuran-4-yl group represented by General Formula (G2) is bonded to any one of Ar1 to Ar3 of a triazole derivative represented by General Formula (G1). In the formulas, A represents oxygen or sulfur, Ar1 to Ar3 separately represent a substituted or unsubstituted aryl group having 6 to 13 carbon atoms, and R1 to R7 separately represent hydrogen, an alkyl group having 1 to 4 carbon atoms, or a substituted or unsubstituted aryl group having 6 to 13 carbon atoms.
US09359333B2
The present invention refers to a new efficient process for the synthesis of the active pharmaceutical ingredient Lapatinib and salts thereof.In particular, the present synthesis is carried out employing new intermediates in which the amine function is protected by a group cleavable in basic milieu that provides a higher overall yield of the synthesis process.
US09359326B2
The invention relates to processes for manufacturing a compound of formula 5, or a stereoisomer, tautomer or a salt thereof, wherein the substituents are as defined in the specification. The invention further relates to new manufacturing processes for specific solid forms of Compound A and its salts, to such solid forms and to use of such solid forms for the therapeutic treatment of warm-blooded animals.
US09359321B2
The hydroxymethylfurfural derivative is represented by the general formula (A) (wherein, R is selected from the group consisting of the following formula (I), (II) HOOCCH2COCO—, (III) HOOCCH2CH2COCO—, and (IV) a hydrogen atom).
US09359320B2
An acid-functionalized polyolefin material that can be used as an acid catalyst in a wide range of acid-promoted chemical reactions, wherein the acid-functionalized polyolefin material includes a polyolefin backbone on which acid groups are appended. Also described is a method for the preparation of the acid catalyst in which a precursor polyolefin is subjected to ionizing radiation (e.g., electron beam irradiation) of sufficient power and the irradiated precursor polyolefin reacted with at least one vinyl monomer having an acid group thereon. Further described is a method for conducting an acid-promoted chemical reaction, wherein an acid-reactive organic precursor is contacted in liquid form with a solid heterogeneous acid catalyst comprising a polyolefin backbone of at least 1 micron in one dimension and having carboxylic acid groups and either sulfonic acid or phosphonic acid groups appended thereto.
US09359305B2
The invention relates to oral, topical or injectable compositions for combating liver fluke parasites in mammals, comprising at least one benzimidazole derivative active agent. The invention also provides for an improved method for eradicating and controlling liver fluke parasite infections and infestations in a mammal comprising administering the compositions of the invention to the mammal in need thereof.
US09359290B2
The present invention relates to a method of treating cataplexy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of certain carbamate compounds.
US09359289B2
The present invention relates to non-steroidal ligands for use in nuclear receptor-based inducible gene expression system, and a method to modulate exogenous gene expression in which an ecdysone receptor complex comprising: a DNA binding domain; a ligand binding domain; a transactivation domain; and a ligand is contacted with a DNA construct comprising; the exogenous gene and a response element; wherein the exogenous gene is under the control of the response element and binding of the DNA binding domain to the response element in the presence of the ligand results in activation or suppression of the gene.
US09359286B2
Disclosed are compounds of Formula (I) and/or a salt thereof; wherein R is —OH or —OP(O)(OH)2. Also disclosed are methods of using such compounds as selective agonists for G protein-coupled receptor S1P1, and pharmaceutical compositions comprising such compounds. These compounds are useful in treating, preventing, or slowing the progression of diseases or disorders in a variety of therapeutic areas, such as autoimmune diseases and vascular disease.
US09359281B2
This invention refers to the synthesis and purification of 2 hydroxide derivatives of fatty acids, as well as to the separation method of its enantiomers (or optic isomers) [−] y [+], to the enantiomers themselves, to pharmaceutical compositions which include them, and to their use as medicines, as well as to an in vitro method of diagnosis/prognosis and evaluation of the potential use of the molecules of the invention in different pathologies, as well as their use for the regulation of certain enzymes and the study of their activity and effects.
US09359265B2
Embodiments described herein provide for nanofertilizers having at least one plant nutrient coated onto a metal nanoparticle. Some embodiments provide for a method of making a nanofertilizer including providing a metal nanoparticle and coating the metal nanoparticle with at least one plant nutrient or precursor thereof. In some embodiments, a method of making a nanofertilizer may include mixing a metal salt and a plant nutrient in an aqueous medium to form a solution and adding a reducing agent to the solution to form a coated metal nanoparticle. Some embodiments provide for a boron nanofertilizer and methods of making the same. Some embodiments provide for a method of treating a plant nutrient deficiency, such as, for example, a boron deficiency. Some embodiments also provide for a kit for making a plant nutrient coated nanoparticle.
US09359260B2
A semiconductor light emitting device comprising a light emitting layer disposed between an n-type region and a p-type region is combined with a ceramic layer which is disposed in a path of light emitted by the light emitting layer. The ceramic layer is composed of or includes a wavelength converting material such as a phosphor. Luminescent ceramic layers according to embodiments of the invention may be more robust and less sensitive to temperature than prior art phosphor layers. In addition, luminescent ceramics may exhibit less scattering and may therefore increase the conversion efficiency over prior art phosphor layers.
US09359257B2
A dry, free-flowing cement composition that comprises dry cement particles and flow inducing particulates that comprise solid adsorbent particulates having adsorbed thereon a flow inducing chemical, ethylene glycol, and water. The water is present in an amount from 5% to 30.3% by weight of the solid adsorbent particulates, the ethylene glycol is present in an amount from 3.25 to 20% by weight of the solid adsorbent particulates, and the flow inducing particulate is present in an amount from 0.005% to 5% by weight of the cement. The dry, free-flowing cement composition is free-flowing at temperatures at least as low as 10° F.
US09359254B2
A wellbore cement composition includes substantially unhydrated cement powder and additive powder for cement. The additive powder is formulated from ingredients including a liquid additive for cement and solid carrier particles. The liquid additive is absorbed by the solid carrier particles. A wellbore cementing method includes using a dry cement composition, adding water to the dry cement composition, forming a cement slurry, placing the slurry in a wellbore, and setting the placed slurry. The dry cement composition contains substantially unhydrated cement powder and retarder powder for cement. The retarder powder contains a retarder absorbed by solid carrier particles.
US09359253B2
A concrete composition and method include a portion of fine aggregate bearing a coating of a polymer, which may be a continuous coating layer or a layer of powdered, discrete particles embedded in a binder. The polymeric coating may be a super absorbent polymer (insoluble in water, but absorbing water), or another polymer such as the acrylamides, co-polymers thereof, polyacrylamides, or the like (soluble in water). The coating absorbs water, but particles are too small to form significant voids. Water is absorbed into the concrete mix in far greater proportions (e.g. w/c ratio over 0.5) improving workability, doubling workability time, and improving ultimate compressive stress (strength).
US09359251B2
Glasses with compressive stress profiles that allow higher surface compression and deeper depth of layer (DOL) than is allowable in glasses with stress profiles that follow the complementary error function at a given level of stored tension. In some instances, a buried layer or local maximum of increased compression, which can alter the direction of cracking systems, is present within the depth of layer. Theses compressive stress profiles are achieved by a three step process that includes a first ion exchange step to create compressive stress and depth of layer that follows the complimentary error function, a heat treatment at a temperature below the strain point of the glass to partially relax the stresses in the glass and diffuse larger alkali ions to a greater depth, and a re-ion-exchange at short times to re-establish high compressive stress at the surface.
US09359250B2
A substrate ion exchange system, along with methods of maintain such a system, is provided that includes a substrate having an outer region containing a plurality of substrate metal ions, an ion exchange bath that includes a plurality of first metal ions at a first metal ion concentration and a plurality of second metal ions at a second metal ion concentration, and a vessel for containing the ion exchange bath and the substrate. The ion exchange system also includes a temperature sensor coupled to the vessel, and a processor configured to receive a vessel temperature from the sensor and to evaluate the first metal ion concentration based at least in part on a first metal ion consumption rate relationship and the vessel temperature. Further, the first metal ion consumption rate relationship is predetermined.
US09359249B2
Certain example embodiments relate to methods of making anti-corrosion anti-reflection (ACAR) films, and/or associated coated articles. The methods may involve forming the reaction product of a hydrolysis and/or a condensation reaction of at least one hybrid alkoxide selected from the group consisting of Si(OR)4—Al(s-OBu)3, Si(OR)4—B(OBu)3 and Si(OR)4 and Zr(OBu)4, where R is a CH2CH3 group, s-OBu is sec-butoxide and OBu is n-butoxide. The solution optionally may be blended and/or mixed with silicon nanoparticles and/or siloxanes. A Tqe % gain of about 3.2% and/or refractive index of 1.5 or less is/are possible in certain example embodiments.
US09359242B2
A glass-plate manufacturing method employing a down-draw process includes: a forming step of forming a sheet glass by making a molten glass flow downward along opposite side surfaces of a forming member and merge at a lower section of the forming member; and a cooling step of cooling the sheet glass while drawing the sheet glass downward with rollers. In the cooling step, an above-glass-strain-point temperature control step is performed which is a step of performing a temperature control in the width direction of the sheet glass in a temperature region ranging from the lower section of the forming member to where the temperature of the sheet glass falls below a temperature region near the glass strain point, and includes: first, second and third temperature control steps as defined herein.
US09359241B2
The present invention concerns a method of making a mineral melt by burning combustible material in the presence of inorganic particulate material and thereby forming a melt, comprising injecting fuel, particulate mineral material and combustion gas into a circulating combustion chamber (1) through an inlet conduit (4) and combusting the fuel in the circulating combustion chamber (1) thereby melting the mineral material to form a mineral melt and generating exhaust gases; separating the exhaust gases from the mineral melt, collecting the mineral melt (9) and passing the exhaust gases upwards through an exhaust pipe (10) to a conduit (11) of a heat exchange system; and supplying particulate mineral material and a first portion of waste mineral wool into the conduit (11) and pre-heating the supplied material in the heat exchange system, and supplying a second portion of waste mineral wool with a water content between 5 and 25% by weight directly to the inlet conduit (4).
US09359237B2
A digester for degradation of human waste comprising a main tank having biochemical treatment compartment and chemical treatment compartment connected by connecting pipe as a passage for bio-chemically treated waste to chemical treatment compartment; the biochemical treatment compartment has at least one loosely fitted partitioned wall and at least one inlet to receive waste, at least one gas outlet and at least one waste drain pipe to remove sludge; the chemical treatment compartment has discharge means to discharge treated waste and excess of liquid, and float ball assembly to release chemical for chemical treatment.
US09359227B2
There is provided a porous formed article which can remove hazardous substances at a high speed, has a high adsorption capacity and has high durability to cleaning chemicals and further which is scarcely broken even if being repeatedly used, and which contains an organic polymeric resin and an inorganic ion-adsorbing material, wherein the organic polymeric resin is a polyether sulfone resin and/or a polysulfone resin, and is an organic polymeric resin having a hydroxyl group.
US09359219B1
A system, method, and articles of manufacture for a surface-modified transition metal cyanide coordination compound (TMCCC) composition, an improved electrode including the composition, and a manufacturing method for the composition. The composition, compound, device, and uses thereof according to AxMn(y-k)Mjk[Mnm(CN)(6-p-q)(NC)p(Che)rq]z. (Che)rw(Vac)(1-z).nH2O (wherein Vac is a Mn(CN)(6-p-q)(NC)p(Che)rq vacancy); wherein Che is an acid chelating agent; wherein: A=Na, K, Li; and M=Mg, Al, Ca, Sc, Ti, V, Cr, Fe, Co, Ni, Cu, Zn, Ga, Pd, Ag, Cd, In, Sn, Pb; and wherein 0
US09359218B2
Systems and methods of producing chemical compounds are disclosed. An example chemical production system includes an intake chamber having intake ports for entry of a gas mixture. An igniter ignites the gas mixture in the intake chamber. A nozzle restricts exit of the ignited gas mixture from the intake chamber. An expansion chamber cools the ignited gas with a cooling agent. The expansion chamber has an exhaust where the cooled gas exits the expansion chamber. A chemical compound product is formed in the expansion chamber.
US09359211B2
Methods of fabricating graphene using an alloy catalyst may include forming an alloy catalyst layer including nickel on a substrate and forming a graphene layer by supplying hydrocarbon gas onto the alloy catalyst layer. The alloy catalyst layer may include nickel and at least one selected from the group consisting of copper, platinum, iron and gold. When the graphene is fabricated, a catalyst metal that reduces solubility of carbon in Ni may be used together with Ni in the alloy catalyst layer. An amount of carbon that is dissolved may be adjusted and a uniform graphene monolayer may be fabricated.
US09359205B2
The present invention relates to a specific process for producing trisilylamine from monochlorosilane and ammonia in the liquid phase. The invention further relates to a plant wherein such a process can be carried out with advantage.
US09359204B2
A plurality of mesoporous metal nitride materials may be formed by a method that includes treating with ammonia (or a related bonded nitrogen and hydrogen containing reducing material) a mixed metal oxide material that comprises at least one first metal that forms an unstable product with ammonia and at least one second metal that forms a stable product with ammonia to form the metal nitride materials that include the second metal but not the first metal. The method contemplates forming metal nitride materials, as well as metal oxynitride materials. A related method that uses a non-bonded nitrogen and hydrogen containing reducing material may yield a mesoporous metal oxide. In particular the at least one metal that forms an unstable product with ammonia comprises zinc metal.
US09359199B2
The present invention relates to an apparatus for generating hydrogen gas using a composition for generating hydrogen gas, which generates hydrogen gas (H2) from water (H2O) through spontaneous thermochemical reaction without supplying electricity using a composition for generating hydrogen gas which generates the hydrogen gas by spontaneous oxidation with water at room temperature.
US09359193B2
An integrated MEMS device and its manufacturing method are provided. In the manufacturing method, the sacrificial layer is used to integrate the MEMS wafer and the circuit wafer. The advantage of the present invention comprises preventing films on the circuit wafer from being damaged during process. By the manufacturing method, a mechanically and thermally stable structure material, for example: monocrystalline silicon and polysilicon, can be used. The integrated MEMS device manufactured can also possess the merit of planar top-surface topography with high fill factor. The manufacturing method is especially suitable for manufacturing MEMS array device.
US09359184B2
A fluid dispenser comprising a fluid container and a metering unit is disclosed. The container comprises a fluid level sensor and the dispenser comprises a control unit configured to determine a parameter value representative for an amount of fluid in the container after refill on basis of a signal from the sensor. The sensor can for example be configured to generate a signal at a predefined fluid level (B, C), while the control unit is configured to calculate a fluid level on basis of an input value indicative of the fluid level (A) after refill, and a dispense value indicative of amounts of fluid dispensed since the latest refill. The control unit can be configured to compare the signalled predefined fluid level (B, C) with the calculated fluid level to generate a correction factor.
US09359181B2
A method and device for filling containers with a liquid product. The product is fed to the container by a filling valve and a filling nozzle. The product emerging from the filling nozzle is fed to a directing element. The directing element has a geometrical configuration such that an edge of the directing element runs along at a small distance from the inside walls of the container.
US09359174B2
A composite lifting beam and methods are provided. Such a lifting beam includes at least one beam element. A plurality of plate elements are mounted to the at least one beam element and are spaced apart along a length of the at least one beam element. The plurality of plate elements provide a first connection arrangement for connecting the beam to a lifting apparatus, and a second connection arrangement for connecting the beam to a load.
US09359172B2
An exemplary elevator system includes a first mass that is moveable within a hoistway. A second mass is moveable within the hoistway. A plurality of elongated members couple the first mass to the second mass. At least one damper is positioned to selectively contact at least one of the elongated members if sway occurs. A sensor is associated with the damper. The sensor detects contact between the damper and the at least one of the elongated members. A controller adjusts at least one aspect of elevator system operation responsive to the detected contact.
US09359161B2
An interleaving element is adapted to interleave a roll of glass substrate. The glass substrate includes at least one active area, a plurality of spacing zones and two edge zones. The plurality of spacing zones and the edge zones define the active area. The interleaving element includes two elongated side elements and a plurality of bridging elements. The elongated side elements correspond to the two edge zones. Each of the plurality of bridging elements is connected with the elongated side elements. The plurality of bridging elements corresponds to the spacing zones.
US09359159B2
A sheet feeding apparatus includes a stacking portion, a feed portion, a moving amount detecting portion provided downstream of the feed portion and configured to detect a moving amount of the sheet, and a control portion. The control portion is configured to change a timing for starting a sheet feed operation by the feed portion in feeding a n+1th sheet by the feed portion based on a detection result of the moving amount detecting portion detected when a nth sheet has been fed by the feed portion in feeding the sheets consecutively by the feed portion.
US09359150B2
The problem of singulating products that are provided in a pallet layer is solved by breaking up the pallet layer so that each product can be handled separately by a robot tool and outputted in at least one line according to a predetermined orientation. The singulator includes a layer drop zone that receives a pallet layer of products, a break-up system that separates the products by creating gaps therebetween, yielding separated products, a vision system that determines characteristics and position of each separated product; and a robot equipped with a tool that receives information indicative of the characteristics and position of said each separated product to grip and position each separated product onto an output station within at least one line.
US09359145B2
A roller driven device for roller conveyors includes a cylindrical and tubular roller configured to rotate around its geometric axis, and having at each end a respective first lateral wheel and a second lateral wheel. At least the first lateral wheel has a tubular cylindrical element having at its end facing the second lateral wheel a first flange and at the opposite end a second flange. The device further includes a ring whose axial length ranges from two thirds to one twentieth of the axial distance between the first flange and the second flange of the first lateral wheel. An end of the ring is positioned between the first flange and the second flange and the end is fixed to the outer surface of the roller, where the end portion of the roller is fixed at the central hole of the second flange.
US09359144B2
A method of manufacturing a multi-piece shaft for an idler roller. The method includes providing a tube having a first end and a second end, mechanically crimping the first end of the tube to a first stub to secure the first stub to the first end of the tube with a mechanical interlock, and mechanically crimping the second end of the tube to a second stub to secure the second stub to the second end of the tube with a mechanical interlock. The first stub extends from the first end of the tube and the second stub extends from the second end of the tube.
US09359143B2
A conveyance device has a carriage drive for driving and propelling a pair of left and right carriage units which individually support left and right sides of an object to be conveyed. A pair of left and right screw shafts is pivotally supported in a rotatable manner along the movement path of the carriage units. Driven rollers are pivotally supported in a rotatable manner by the carriage units and engage with the screw shafts. A transmission connects the pair of left and right screw shafts through the outside of a conveyance path such that the left and right screw shafts are linked and coupled; and a single motor drives the pair of left and right screw shafts through the transmission means.
US09359141B2
Components of a conveyor system designed to facilitate tight transfer of products onto and off a positively-driven, low tension conveyor belt. The conveyor system includes a tension amplifier in a returnway of a conveyor belt circuit for selectively increasing tension in the conveyor belt prior to infeed without increasing the low tension in the returnway prior to the tension amplifier.
US09359139B1
A chute system includes a pair of support rails, each having a bent reinforcement member secured to it. The chute is made up of multiple chute panels, which nest within one another for ease of storage and transportation. A spacer bar sets the system width and provides overall support. The system also includes a pair of hinged anchors for adjustably securing the system to the edge of a roof. There is also a roof eave debris stop for preventing debris from sliding off the roof onto landscaping, humans and animals below.
US09359137B2
A system for high-pressure natural gas storage includes at least one underground bored tunnel, suitable for holding natural gas under pressure and a process for storing natural gas under pressure.
US09359135B2
A storage shelf reduces vibration while maintaining load-carrying capacity and includes placement units on which a FOUP is placed, and a frame unit that supports the placement units. The placement units include frames that are arranged on the frame unit with first elastic bodies interposed therebetween, and a shelf plate that is arranged on the frames with second elastic bodies interposed therebetween and is configured to place thereon the FOUP.
US09359128B2
A portion capsule for producing a beverage is proposed, having a capsule body with a capsule base and a filling side, with a cavity for accommodating a pulverulent or liquid beverage base being formed between the capsule base and the filling side, with a filter element being arranged between the beverage base and the capsule base, and with the filter element having a non-woven which is arranged in the region of the capsule base.
US09359125B2
A gift box is described for housing a plurality of pop-up elements that are automatically presented to a user when a lid of the box is removed. The box includes an interior portion enclosed by a base and sidewalls around its outer periphery. The interior portion of the gift box contains a central tower coupled to four levers that each pivot on a respective sidewall. The central tower and/or the four levers additionally have one or more paper pop-up elements attached thereto that are presented to a user when the box is opened. A band passing through the interior portion of the box stores the mechanical energy necessary to cause the four levers to pivot on the sidewalls, thereby generating the force to move the central tower out of the box when the lid is removed.
US09359118B2
A packaging material comprising a plurality of magnetisable portions thereon comprising at least one spot per package to be formed from the packaging material is disclosed. At least one of the magnetisable portions provides a first magnetic mark carrying a magnetic field pattern providing position information related to finishing of respective package to be formed.
US09359117B2
A canister includes a container and a closure. The container is formed to include a product-storage region to receive products and the closure is configured to seal off a brim of the container to block access to the product-receiving container when the closure is rotated in a clockwise direction. The closure includes a lid-retainer ring and a floating lid that covers a mouth of the container.
US09359107B2
A card holder assembly for holding multiple transaction cards, such as gift cards, to a common backer panel for presentation and sale. Cards mounted on the backer panel may be lifted for scanning by a card reader without necessitating removal of the cards from the assembly.
US09359101B2
A leak resistant food sleeve for holding single-serving food items is provided. The sleeve may be constructed from a blank that is folded into the sleeve when ready to use. The sleeve consists of two major and two minor sidewall panels, and first and second ends. The major and minor sidewall panels are folded to form a box-like structure. The first end consists of two major end flaps, two minor end flaps, and gusset panels extending between and foldably connected to one of the major end flaps and one of the minor end flaps. The gusset panels become layered between the minor end flaps and major end flaps when each is folded inward to close the first end, such that the minor end flaps, gusset panels, and major end flaps form a web of material that prevents fluidal and viscous substances from leaking out of the first end.
US09359096B2
A method for sterilizing cuboid-shaped cardboard/plastic combipacks in an autoclave, with the packs including product and packing are subjected to heat treatment at a certain temperature over a certain period of time, the product including a liquid and chunky portions, and mechanisms are provided inside the autoclave to drive the packs rotationally about a rotational spindle, and a cuboid-shaped cardboard/plastic combipack for use in such a device.A plurality of packs are arranged closely adjacent to one another in parallel rows, to be arranged on support floors and for a plurality of support floors loaded with packs to be arranged one above the other and fixed in their mutual positions. The cardboard for the pack used therewith is made water-repellent by means of glue to reduce the intake of water.
US09359092B2
A device for packaging preferably two-dimensional products is designed for forming a bag-like tube by way of a longitudinal connection device, from a web of packaging material. The bag-like tube, with respect to a conveying direction of the packaging material, is open in a region in front of the longitudinal connection device and is closed in the region after the longitudinal connection device. The device includes a suction device which leads into the still open bag-like tube, and in the closed region includes a suction opening, through which gas can be sucked out of the region after the longitudinal connection device, out of the bag-like tube and through the suction device.
US09359086B2
A door for a storage compartment of an aircraft includes a door leaf and a profiled strip connected to an edge of the door leaf. The profiled strip includes openings that provide a path for gas exchange such that smoke from the storage compartment is detectable outside of the storage compartment by passing the profiled strip.
US09359085B2
Internal shield in the rear fuselage of an aircraft having a propulsion system formed by two engines mounted on each side of it; the rear fuselage having at least a vertical symmetry plane; the rear fuselage being made of a composite material; the internal shield being located in said vertical symmetry plane and extended in an area that covers the possible trajectories of a set of pre-defined fragments detached from one of said engines in a failure event that would impact on critical elements of the opposite engine; the internal shield having a flat shape and an energy absorption capability that allows stopping said fragments. The invention also refers to a method for determining the area of an internal shield and to an aircraft having said internal shield.
US09359079B2
An aircraft seat set is provided that allows for providing extra room for passengers and/or allow for selectively increasing the width of an aircraft aisle during enplaning and deplaning and/or increasing the width of some seats during flight. In one embodiment, the aisle seat of the seat set is movably connected to the seat frame of the seat set to allow the aisle seat to be disposed above and in front of the middle seat of the seat set for enplaning and deplaning.
US09359069B2
An electro-mechanical actuator including an aircraft parking brake may include a motor shaft, a park brake disk, and a voice coil assembly. The voice coil assembly may include a bobbin configured to translate between an engaged position and a disengaged position. An engagement feature may be coupled to the bobbin. The engagement feature may contact the park brake disk in the engaged position. The engagement feature may be magnetically coupled to a voice coil magnet and washer in the disengaged position.
US09359061B2
In accordance with the present invention an aircraft stringerless fuselage structure is provided comprising an impact compliant outer skin having a plurality of resin impregnated skin fibers forming an outer skin surface, an inner stringerless skin surface, and a skin thickness. A plurality of stiffeners is included, each comprising a plurality of resin impregnated stiffener fibers integrated into the inner stringerless skin structure. The plurality of resin impregnated skin fibers are not aligned with the plurality of resin impregnated stiffener fibers.
US09359058B1
An outboard marine propulsion device comprises an internal combustion engine. At least one engine cooling passage conveys cooling water through the internal combustion engine. An exhaust manifold comprises a plurality of exhaust runners and an exhaust log. The plurality of exhaust runners axially conveys exhaust gases from the internal combustion engine to the exhaust log. A cooling jacket on the exhaust manifold comprises an exhaust log cooling jacket that conveys the cooling water along an outer surface of the exhaust log and a plurality of exhaust runner cooling passages that each axially convey the cooling water along an outer surface of a respective one of the plurality of exhaust runners from the exhaust log cooling jacket to the engine cooling passage.
US09359052B2
A human propelled watercraft having a pair of flexible fins extending into the water each adapted to oscillate through an arcuate path in a generally transverse direction with respect to the central longitudinal dimension of said watercraft. Pedals are provided for applying input force whereby as input force is applied, the flexible fins can twist to form an angle of attack for providing forward thrust with respect to the longitudinal dimension of the watercraft while moving in both directions along the arcuate path. The user can pull a lever and cause the fins to rotate 180° and produce thrust in the reverse direction. The fins are able to pivot and swing aft to avoid damage if there is a collision with a submerged object. The fins are more efficient, durable, and adjustable. Simple plastic roller bearings have been adapted to reduce mechanical friction without the need for oil seals.
US09359049B1
A flotation-hydration system to be worn by a user, particularly in a water borne environment, includes a vest assembly dimensioned to at least partially surround the user's upper torso while donned by the user in an operative manner. The vest assembly comprises a plurality of panels securely attached to one another, and a flotation assembly comprising at least one flotation member having a buoyant material of construction disposed in one of the panels of the vest assembly. A hydration support assembly is disposed substantially within the vest assembly and includes a chamber support unit, wherein the chamber support unit is dimensioned and configured to receive a hydration chamber in a supported relation therein. A dispensing tube is routed from the hydration chamber to the front of the vest assembly, for ready access by the user, through a dispensing tube retention channel.
US09359038B2
A rear-wheel suspension system for a two-wheeled vehicle includes a pair of right- and left-side center frames; a swing arm; and a shock absorber, wherein the shock absorber includes a tubular buffer and a spring, wherein the intake system part is a curved tubular member, wherein a position of the spring is shifted downwardly so that the intake system part are moved toward an interior of the vehicle body by a dimension corresponding to the spring, wherein a lower end of the intake system part is above the upper end of the spring, wherein a part of the intake system part is closer than an outer end of the spring to the center of the tubular buffer, and wherein the shock absorber and the intake system part are disposed between a pair of right- and left-side center frames.
US09359034B2
A recumbent cycle includes a toothed belt drive system and rear suspension. It also includes a double A-arm suspension assembly and at least one transmission having a planetary gear arrangement.
US09359022B2
A snowmobile rear suspension assembly has a pair of slide rails and at least one suspension arm pivotally connected thereto and adapted to be pivotally connected to a tunnel. A shock absorber is adapted to be pivotally connected between the tunnel and the slide rails. A limiter strap, adapted to extend between the tunnel and the slide rails, is substantially inextensible to limit separation therebetween. A strap holder, connected between an end of the limiter strap and the slide rails or the tunnel when the at least one suspension arm is connected to the tunnel, is moveable between a first and a second strap holder position. A position of the end of the limiter strap, relative to the slide rails or the tunnel, is different in the first strap holder position compared to the second strap holder position. A method of adjusting the limiter strap is also disclosed.
US09359006B2
There is provided an reliable electric power steering system. The electric power steering system includes a torque sensor that outputs a detection signal corresponding to a steering torque, and a controller. The controller computes a detected steering torque value based on the detection signal, and a torque differential value, which is a first-order time differential value of the detected steering torque value. The controller computes a current command value by providing compensation to a basic current command value based on the detected steering torque value with the use of a compensation value based on the torque differential value. When the detected steering torque value is held for a predetermined period, the controller holds the torque differential value at a value computed before the detected steering torque value is held, during the period in which the detected steering torque value is held.
US09359005B2
A drive mechanism for an AGV that includes a drive unit for propelling the AGV and a steering unit for steering the AGV. The drive unit has a drive motor, drive transmission, and a drive wheel. The steering unit has a steering motor. Both motors are fixedly mounted on the AGV and remain stationary relative to each other while the drive motor rotates the drive wheel and the steering motor steers the drive wheel. The drive transmission couples the drive motor to the drive wheel and can be at least partially mounted within a gear housing that is rotatably mounted via a bearing so that the drive motor can be operated to move the AGV via power transferred to the drive wheel via the drive transmission, and the steering motor can be operated to steer the drive wheel by rotation of the gear housing and drive wheel via the bearing.
US09359003B2
A clutch apparatus is configured such that a first mode, a second mode and a third can be switched among these three modes. In the first mode, the rotating force is not transmitted between the steering-wheel-side housing and the tire-side housing. In the second mode, the steering-wheel-side housing and the tire-side housing are being mutually locked in place and, in this locked state, the rotating force can be transmitted to for the rotation in the both directions. In the third mode, the transmission of the rotating force can be canceled such that while the rotating force can be transmitted, between the steering-wheel-side housing and the tire-side housing, relative to the rotation in one direction, the rotation of either the steering-wheel-side housing or the tire-side housing in the other direction is allowed.
US09359002B2
A steering device includes a fixed bracket which includes a first plate, a movable jacket which rotatably supports a steering shaft, a movable bracket which includes a second plate, a suspension mechanism and a resin pin. The suspension mechanism includes a suspension shaft connecting the first plate and the second plate, and is configured to move in a column movement direction along with the second plate at the time of the secondary collision. The resin pin is inserted into a first hole provided in the first plate and a second hole provided in the second plate, and is configured to be broken at the time of the secondary collision. The resin pin has a predetermined amount of play in a direction orthogonal to the column movement direction with respect to at least one of the first hole and the second hole.
US09358996B2
A blade cart for a wind turbine blade for use during the manufacturing of such a blade is described. The cart presents an adjustable and adaptable support for the tip end of a blade after the blade is removed from the mold. The cart is rotatable, and comprises selectively actuatable and/or removable support surfaces to provided easy access to the surfaces of the molded blade for the performance of post-molding operations, e.g. blade surface grinding, coating, etc.
US09358992B2
A magnetic rail brake device includes a magnetic main part and pole shoes with friction surfaces. The friction surfaces of the pole shoes are made of the material of the main part in first regions and of a different material in second regions.
US09358991B2
A multi-car vehicle with a first car of the multi-car vehicle and a second car of the vehicle and having a connection device having an elongated body for transmitting the pushing force required to push the first car in front of the second car, when the second car is moving, the elongated body having a longitudinal axis, a connection to connect the elongated body to the first car or the second car and suitable to transmit the pushing force from the second car to the elongated body or from the elongated body to the first car, the first car and/or the second car having an underframe that comprises at least one longitudinal beam and/or at least one cross beam, wherein the elongated body is arranged approximately at the same vertical level as the longitudinal beam and/or the cross beam and/or is arranged in such a manner that with regard to the vertical direction the elongated body at least partially overlaps with the beam.
US09358981B2
Systems and methods for improving launching of a stopped hybrid vehicle are presented. The systems and methods adjust speed of a motor to reduce lag between an increase in driver demand torque and torque being produced at vehicle wheels. In one example, motor torque is adjusted to a maximum motor torque to improve vehicle launch during select conditions where driver demand torque is not a maximum level.
US09358975B1
Example systems and methods are disclosed for implementing vehicle operation limits to prevent vehicle load failure during vehicle teleoperation. The method may include receiving sensor data from sensors on a vehicle that carries a load. The vehicle may be controlled by a remote control system. The load weight and dimensions may be determined based on the sensor data. In order to prevent a vehicle load failure, a forward velocity limit and an angular velocity limit may be calculated. Vehicle load failures may include the vehicle tipping over, the load tipping over, the load sliding off of the vehicle, or collisions. The vehicle carrying the load may be restricted from exceeding the forward velocity limit and/or the angular velocity limit during vehicle operation. The remote control system may display a user interface indicating to a remote operator the forward velocity limit and the angular velocity limit.
US09358970B2
A vehicle comprises a rotary electric machine, an inverter and an electronic control unit. The inverter is configured to supply current to the rotary electric machine. The electronic control unit is configured to set a control mode of the inverter to a first mode on a condition that the electronic control unit determines that there is no possibility of occurrence of the electrolytic corrosion. The electronic control unit configured to set the control mode of the inverter to a second mode and maintain output of the rotary electric machine at user request output on a condition that the electronic control unit determines that there is a possibility of occurrence of the electrolytic corrosion. The second mode is a mode in which occurrence of the electrolytic corrosion is further suppressed compared to the first mode.
US09358957B2
A windscreen wiper device includes an elastic, elongated carrier element, as well as an elongated wiper blade, which can be placed in abutment with a windscreen to be wiped. The wiper blade includes an upper holding part holding at least one longitudinal strip of the carrier element disposed in at least one longitudinal groove of the upper holding part, as well as a lower wiping part, which windscreen wiper device includes a connecting device for an oscillating arm. The oscillating arm is pivotally connected to a rod of the connecting device about a pivot axis near one end thereof, with the interposition of a joint part, wherein the connecting device includes limitation means for limiting the maximum rotation angle of the pivotal movement of the oscillating arm.
US09358954B2
A system for finding a vehicle includes a function controller, a key for matching with and controlling the function controller, and a portable device. The portable device can match with the key and transmit an instruction to the key. The key includes a first positioning module, and the function controller includes a second positioning module coupled to the first positioning module. The first positioning module and the second positioning module can receive data as to the distance between and respective locations of the chip key and the function controller. The present disclosure also discloses a method for finding vehicle.
US09358949B2
A belt tensioner for a seat belt system includes a belt shaft housing, a belt shaft pivoted about an axis in the belt shaft housing, a rope reel tightly connected to the belt shaft. A tensioner drive includes a tensioner tube, a deformable plastic element guided to be longitudinally movable in the tensioner tube, a drive pinion and a pull rope which is partly wound onto the rope reel. The plastic element is adapted to engage in the drive pinion and to drive the drive pinion in the tensioning direction. During rotation of the drive pinion the pull rope is wound onto a rope drum of the drive pinion, on the one hand, and is unwound from the rope reel, on the other hand, while the belt shaft rotates.
US09358948B2
Provided is a buckle device that fixes a seat belt mounted on a 2nd-row seat or a 3rd-row seat to the vehicle body floor in a vehicle. The buckle device may include a buckle bracket having an upper end with a hole for connecting with a seat belt and a lower end connected to a rail on a vehicle body floor by a buckle connection bolt, and a wire fixing bracket connected between a side of the buckle bracket and a side of a seat frame and absorbing vibration of a seat.
US09358945B2
An airbag housed in the housing and inflatable with an inflation gas for deployment rearward in order to protect a passenger in a front passenger seat. The airbag includes a main bag section that includes at its rear surface a front-collision arresting plane for catching the passenger upon a frontal collision, and an auxiliary bag section that includes an oblique-collision arresting section protruding rearward relative to the main bag section. The oblique-collision arresting section includes on its lateral an oblique-collision arresting plane for catching a head of the passenger upon an oblique collision. The oblique-collision arresting section is a high-pressure section which has a higher internal pressure than the main bag section when inflated. The airbag further includes in a front region of the auxiliary bag section a low-pressure section that is in gas communication with the main bag section and partitioned from the high-pressure section by a partition wall.
US09358943B2
A side airbag for installation into a motor vehicle, a vehicle seat with such a side airbag and a motor vehicle with such a vehicle seat are described. The side airbag comprises at least one mounting device for mounting the side airbag on the backrest of the vehicle seat, an outer skin with a first side wall extending forwards, when viewed in the vehicle direction, and a second side wall connected to the first side wall. In order to be able, at as low a cost as possible, to protect the passengers to be protected better against a movement towards the middle of the vehicle, the second side wall extends essentially cross-ways to the vehicle direction when the outer skin is fully deployed and free from external forces, so that at least a third side wall connecting the first two side walls is present.
US09358937B2
A wire harness includes a wire bundle and a sheathing member covering the wire bundle and configured from a nonwoven member that has been hot-pressed. The sheathing member includes a plurality of path regulators along each of an extension direction and a circumference direction of the wire bundle, the path regulators being capable of regulating a path of a long member to be arranged along a surface of the sheathing member.
US09358932B1
A device for securing ladders to a vehicle having telescoping cross bar having pivotal arms pivotally attached at each end of the telescoping cross bar, respectively, the telescoping crossbar having a receiving portion and an insertion portion, the insertion portion and receiving portion sized such that there is a close fit when inserting the insertion portion into the receiving portion, each pivotable arm has an arm body that includes a pivot arm aperture, at each distal end of the insertion portion and receiving portion are at least one pivot tang, also located at each distal end of the insertion portion and receiving portion is a ladder insertion tang, the ladder insertion tangs are attached to projecting tabs on the distal ends and are inwardly directed, and the receiving portion includes a movement limiting mechanism.
US09358931B2
An adapter for a vehicle mount having a base portion having a top surface and a bottom surface, the bottom surface having a high friction element, the high friction element reducing a lateral movement of the base portion when positioned on an exterior surface of vehicle, and a receiver disposed on the base portion, the receiver configured to receive a portion of a vehicle mount, wherein a load of the vehicle mount is distributed across the surface area of the base portion is provided. Furthermore, an associated method is also provided.
US09358928B2
A mirror device permitting a driver using the device to view forward and rearward of the vehicle. The device provides the visual field of the conventional and/or modern side-view mirror and also extends the visual field to view areas, regions, and/or objects which are forward to allow a line of sight that might otherwise be blocked by an obstruction.
US09358915B2
A storage assembly for a vehicle includes a housing having an outlet formed at a rear end thereof, a cooling and heating cup holder installed in the housing and having a thermoelectric element attached to a side end surface thereof, a convenience device disposed to be adjacent to a side of the thermoelectric element in the housing and including a storage tray or an electrical control switch, a heat exchange pin and a blower disposed at the outlet side of the rear end of the housing, and a heat pipe having one end connected to the thermoelectric element and the other end extended to turn aside or traverse the convenience device and connected to the heat exchange pin.
US09358904B1
Some embodiments are directed to a vehicular seat adjustment mechanism for facilitating positional adjustments of a vehicular seat along a longitudinal direction of a vehicle. The vehicular seat adjustment mechanism includes a pair of rails that extend substantially parallel to a longitudinal direction of the vehicle. Each of the rails defines an opening that faces a lower surface of the vehicle. A pair of support legs are configured to be secured to a vehicular frame. Each of the support legs is secured to and supports one of the rails. A mounting plate supports the vehicular seat and is configured to be movable along the pair of rails. A pair of supports are each secured to one of the rails and configured to support the mounting plate and facilitate longitudinal movement of the mounting plate along the rails.
US09358903B2
An adjustment arrangement for a seat of a motor vehicle including a rail which is mounted displaceably in a longitudinal direction of the vehicle relative to a frame of the vehicle, a seat support which forms a retainer for the seat, a connecting element which mechanically couples the seat support to the rail, wherein a first section of the connecting element is mounted on the rail so as to be rotatable in a predefined pivoting plane, wherein a second section of the connecting element is mounted on the seat support so as to be rotatable in the pivoting plane, and wherein the connecting element is functionally rotatable relative to the seat support and/or to the rail up to a predefined adjustment limit, and further including an absorber unit which is designed to absorb kinetic energy introduced by the connecting element, if the connecting element exceeds the predefined adjustment limit.
US09358898B2
In the present specification, degradation of a battery is suppressed in a hybrid vehicle having an EV mode in which the hybrid vehicle runs without using an engine and an HV mode in which the hybrid vehicle runs using both the engine and a motor. A controller of the hybrid vehicle is configured to limit a usage range of the battery in the EV mode with an execution request of the EV mode having been made by an information input from outside to the vehicle than in the EV mode with no execution request. The degradation of the battery is suppressed by limiting the usage range of the battery.
US09358895B2
An electrical vehicle includes a vehicle body defining a passenger cabin; at least one battery compartment with an openable hood that can be opened to expose the battery compartment; a battery including electrical electrodes removably stored in the battery compartment; at least three battery supports mounted substantially in a vertical orientation in the battery compartment, wherein at least two of the battery supports include electrical contacts that are configured to be electrically coupled with the electrical electrodes of the battery; the battery includes at least two downwardly depending projections which are spatially spaced and arranged relative to each other so that their spacing identically matches a corresponding spacing between said at least three battery supports in the battery compartment, and at least two of the three battery projections comprise said electrical electrodes configured to electrically mate with the electrical contacts of the battery compartment; and the battery supports and the battery projections are so spaced and configured as to enable the battery to be vertically lowered onto the battery supports to effect electrical contact and mechanical coupling between the battery supports and the battery projections.
US09358889B2
The power conversion apparatus converts power among a plurality of ports, and includes: a first voltage conversion unit that converts a voltage of a first port and outputs power having the converted voltage to a second port; and a second voltage conversion unit that performs a first operation of converting a voltage of one port of the second port and a third port and outputting power having the converted voltage to the other port, or a second operation of converting a voltage of the other port and outputting power having the converted voltage to the one port, and when performing the first operation the second voltage conversion unit switches from the first operation to the second operation when a vehicle condition where power of the one port is insufficient is detected.
US09358888B2
A display apparatus in a motor vehicle has at least one display element, which can be used to display at least one value and which has at least one light-emitting element for adjusting a display brightness for the display element. A sensing device has, a sensing element for sensing an ambient brightness for surroundings of the display element. The display brightness can be adjusted by the light-emitting element on the basis of the sensed ambient brightness. The sensing device is designed to prompt at least one function of the motor vehicle that is different than the adjustment of the display brightness when a change in the ambient brightness is sensed. A method operates such a display apparatus.
US09358886B2
The present invention relates to a method for configuring a user interface of a head unit of a vehicle by using a mobile terminal. The method includes steps of: (a) allowing the head unit of the vehicle to acquire information on at least one application stored at an executable state in the mobile terminal, if the mobile terminal is connected to the head unit; (b) allowing the head unit to decide a specific template interoperable with the application among multiple templates stored in the head unit by referring to the acquired information on the application; and (c) deciding a display mode of the specific template by referring to at least one piece of information on the number of acquired application and the driving state of the vehicle and displaying the acquired application on a screen of the head unit by using the decided display mode of the specific template.
US09358882B2
A vehicle is described having plural modes of operation for the front and rear differential and whereupon start-up of the vehicle, the front and rear differentials are opened to their most open position.
US09358878B2
A fluid energy reducing device includes a body having multiple, oppositely directed flow restrictors extending away from opposite sides of the body. Each flow restrictor can have a geometric shape such as a pyramid, triangle, or a conical shape. Fluid such as a fuel traveling in a wave entering the flow restrictors accelerates as the flow area in a flow passage of the flow restrictors decreases. The work performed by accelerating the fluid flow through one or more apertures created in each flow restrictor reduces the energy of the wave, thereby reducing noise in the fluid tank having the fluid energy reducing device when the reduced size and velocity wave subsequently strikes tank structure or walls.
US09358874B2
An electric motor or generator system comprising a stator, a rotor, a first bearing, a first coupling device and a second coupling device, wherein the second coupling device includes a first coupling element arranged to be coupled to a vehicle and a second coupling element coupled to the rotor with a second bearing mounted between the first coupling element and the second coupling element to allow the rotor to rotate relative to the vehicle, wherein the first bearing is mounted between a surface of the stator and a surface of the rotor or the second coupling element to allow the rotor to rotate relative to the stator and the first coupling device is arranged to substantially preventing movement of the stator relative to the first coupling element in a first degree of freedom while allowing movement of the stator relative to the first coupling element in at least a second degree of freedom.
US09358873B2
A transmission system for a hybrid vehicle includes a primary input shaft for receiving drive from a primary vehicle drive motor, such as an internal combustion engine. A secondary input shaft receives drive from a secondary vehicle drive motor, such as an electric motor. An output shaft of the system is connected to drive a final drive unit. A multi-speed gearbox is provided to connect the primary input shaft to the output shaft at one of a plurality of gear ratios. An input selection mechanism, in a first mode, connects the secondary input shaft to drive the output shaft and, in a second mode, connects the secondary input shaft to drive the primary input shaft. A clutch may be provided that can selectively connect or disconnect drive between the primary drive motor and the gearbox.
US09358862B2
A weatherstrip includes a welt section in a substantially letter U shape cross section attached to a flange, and a trim lip formed on an outer surface of an inner side wall section to cover an end edge of a vehicular body trim. The flange is held from both sides by holding lips extending obliquely toward a summit section from the inner surfaces of the respective side wall sections. A projection section is projected on a back side of the outer holding lip. When the flange is fitted, the outer holding lip is struck on the projection section and positioned.
US09358829B2
A ruler having an arch member on an upper surface of a ruler body for allowing the ruler body to closely contact a target object by being pressed from above. The ruler has a pair of parallel standing walls facing each other on the upper surface of the ruler body in a longitudinal direction, and the arch member is fitted along the longitudinal direction of the standing walls. In addition, bending pieces which bend inward towards each other are formed on upper end edges of the standing walls, projections which are positioned below the bending pieces project on both of outer side surfaces of the arch member, and the projections are guided by the bending pieces and are inserted between the standing walls.
US09358824B2
Disclosed herein is a multi-layered matte film comprising at last one layer of a coating comprising the condensation reaction product of the combination of a polyalkylimine and an acetoacetonate (“AcAc”)-functional material or an oxirane-functional material, each comprising an ethenic unsaturation group, the coating adhered to a sealant film layer; a sealant layer comprising a polyolefin and having a Tm within the range of from 120° C. to 170° C.; and a Flexural Modulus within the range from 500 to 1200 MPa; a core polypropylene layer; and a matte layer between the sealant layer and core layer, the matte layer comprising a blend of at least two incompatible polymers such that the Haze is at least 50%.
US09358823B2
An improved Braille erasure mechanism may comprise a reverse-embosser or impressing mechanism to imprint a negative Braille cell. A negative Braille cell is the reverse of a normal Braille cell, with one or more dots lowered or pressed into the printing medium in an opposite direction to the raised dots of a normal Braille cell. Because the dots of a negative Braille cell are lowered past the surface of the printing medium, they may be ordinarily undetectable to the fingers of a Braille user. Accordingly, by imprinting a full negative Braille cell on top of a Braille cell to be erased, all of the previously raised dots of the Braille cell may be lowered beyond the surface of the printing medium. Any further Braille cell embossed over the erased cell will be free from corruption, because any dot not used by the new cell will remain lowered and undetectable.
US09358815B2
An arrangement for capturing an image of a printing substrate web in a printing machine, includes a camera that has a sensor field extending parallel to the printing substrate web, and an objective lens an optical axis of which runs at right angles to the sensor field, a light source that is arranged relative to the printing substrate web such that the light emitted therefrom is reflected by reflective surface portions of the printing substrate web mainly into the camera, and the objective lens is arranged to be offset from the sensor field such that a straight line extending through the center of the sensor field and the center of the objective lens and a straight line extending from the center of the light source to the center of the light incident on the image field on the printing substrate web form equal angles with the axis of incidence.
US09358810B2
An inkjet recording method includes recording an image on a heated nonpermeable substrate with an aqueous ink by an inkjet method; and drying the aqueous ink, wherein the method satisfies the following requirements (1) to (3): (1) the aqueous ink comprises water, a hydrosoluble organic solvent, a pigment and a particulate resin, wherein the hydrosoluble organic solvent comprises a solvent having a boiling point not higher than 200° C. in an amount not less than 50% by weight; (2) the hydrosoluble organic solvent having a boiling point not higher than 200° C. comprises 3-methoxy-3-methyl-1-butanol; and (3) a difference of heating temperatures between the recording and the drying is from 25 to 80° C.
US09358808B1
The present invention discloses a method for controlling a laser marking machine and a laser marking machine. The laser marking machine includes an interface module, a processing module, a laser control module and a galvanometer control module. The interface module receives marking data packets and transfers the marking data packets to the processing module. The processing module parses the marking data packets to obtain marking instructions and control parameters, extracts laser control instruction(s) and galvanometer control instruction(s) from the marking instructions, extracts laser control parameter(s) and galvanometer control parameter(s) from the control parameters, transfers the laser control instruction(s) and the laser control parameter(s) to the laser control module, and transfers the galvanometer control instruction(s) and the galvanometer control parameter(s) to the galvanometer control module.
US09358805B1
A laser printer fuser assembly in a laser printer includes a lever to control envelope mode printing. The lever may protrude from an external surface of the laser printer and may provide a first position for normal paper printing, a second position for envelope printing, and a third position for jam clearing in the laser printer. The first position may apply a maximum force between a fuser heat roll and a pressure roll in the laser fuser printer assembly. The second position may apply a reduced force instead of the maximum force, while the third position may apply zero force. The first and second position may be accessible without opening a cover panel of the laser printer.
US09358803B2
In the present invention, an air bubble residing in a filter chamber is purged at a high speed without inducing liquid ejection deficiency at a liquid ejection head. A filter chamber is divided into a first filter chamber and a second filter chamber via a filter. A pump circulates ink through an ink tube and a bypass path between an ink tank and the first filter chamber. A valve capable of regulating a flow of the ink is provided at the ink tube that allows the second filter chamber and a print head to communicate with each other.
US09358794B2
A liquid ejecting apparatus includes a liquid flow path connecting a liquid containing unit that contains a liquid to a liquid ejecting unit that ejects the liquid. The liquid flow path includes a supply flow path which connects the liquid containing unit to the liquid ejecting unit and a return flow path which connects the liquid ejecting unit to the liquid containing unit. When the liquid is not ejected by the liquid ejecting unit, the liquid contained in the liquid containing unit is circulated between the liquid containing unit and the liquid flow path by allowing the liquid to flow in order of the supply flow path, the liquid ejecting unit, and the return flow path. When the liquid is ejected, the liquid contained in the liquid containing unit is supplied to the common liquid chamber via both of the supply flow path and the return flow path.
US09358789B2
A method of manufacturing a flexible circuit, including forming a first set of traces, forming a second set of traces, and cutting a gap between the first and second set of traces.
US09358788B2
Various configurations of print head die are described. In an example, a first print head die has first print structures disposed along a major dimension thereof perpendicular to the media path, the first print structures including a leading print structure with respect to the media path. A second print head die independent of the first print head die has second print structures disposed along a major dimension thereof perpendicular to the media path, the second print head die being staggered with respect to the first print head die along the media path, the second print structures including a leading print structure with respect to the media path. An extent between respective leading print structures of the first and second print head dies is between a minimum equal to a width of the first print head plus 100 μm and a maximum value such that the distance along the media path between any of the first print structures and any of the second print structures does not exceed 10 mm.
US09358782B2
A liquid discharge apparatus includes: a drive signal generator that generates a drive signal; a piezoelectric element that is displaced in response to a voltage of the drive signal; a cavity which is filled with a liquid and of which an inside volume is expanded and contracted due to the displacement of the piezoelectric element; and a nozzle that communicates with the cavity and is capable of discharging the liquid by the expansion and contraction of the inside volume of the cavity. In the drive signal generator, a set of a first MOSFET and a second MOSFET which are electrically connected in series between a wire of a high potential and a wire of a low potential is arranged in plurality in series. A part or all of the first MOSFETs and the second MOSFETs in the plurality of sets have different sizes from each other.
US09358773B2
An apparatus for adjustably positioning a form roll having a form roll axis against at least two different sized plate cylinders in a variable cutoff printing unit is provided. The apparatus includes a plate cylinder support for interchangeably supporting the at least two different sized plate cylinders, the plate cylinder support including a plate cylinder axis at least two different sized plate cylinder cams. The at least two different sized plate cylinder cams are interchangeably removably connectable to the plate cylinder support and include a smaller plate cylinder cam and a larger plate cylinder cam that are removably connectable to the plate cylinder support as alternatives of each other. The apparatus also includes a form roll hanger for supporting the form roll that is configured for contacting the smaller plate cylinder cam if the smaller plate cylinder cam is coupled to the plate cylinder support to set a smaller distance between the plate cylinder axis and the form roll axis. The form roll hanger is also configured for contacting the larger plate cylinder cam if the larger plate cylinder cam is coupled to the plate cylinder support to set a larger distance between the plate cylinder axis and the form roll axis. A method of adjustably positioning a form roll and a variable cutoff printing press are also provided.
US09358762B2
A lamination apparatus, including: a substrate support; an adhesive film support that is disposed so as to be spaced from the substrate support; an air injection head that is disposed on a co-plane with the adhesive film support so as to be spaced apart from the substrate support or disposed so as to be further spaced apart from the substrate support than the adhesive film support; an air pump that supplies air to the air injection head; an air supply pipe that connects the air injection head with the air pump, wherein the air injection head includes an ion generation unit.
US09358755B2
A waterproof breathable material has a higher strength-to-weight ratio and higher tear resistance-to-weight ratio than traditional materials, and may be applied in a wide field of potential uses. A non-woven composite material comprises at least one waterproof breathable (W/B) membrane, a first unidirectional non-woven composite layer having multiple fibers enclosed by adhesive in parallel to each other, a second unidirectional non-woven composite layer having multiple fibers enclosed in adhesive in parallel to each other. The first unidirectional non-woven composite layer is positioned such that the fibers are oriented 90° relative to the fibers of the second unidirectional non-woven composite layer, and a space is formed between the first and second multiple fibers. No adhesive is present in the space.
US09358753B2
Substrates and methods of forming a pattern on a substrate. The pattern includes a repeating pattern region and a pattern-interrupting region adjacent to the repeating pattern region. A mask is formed on the substrate, with the mask including the repeating pattern region and the pattern-interrupting region and which are formed using two separate masking steps. The mask is used in forming the pattern into underlying substrate material on which the mask is received. Substrates comprising masks are also disclosed.
US09358744B2
A reinforcing element for geo-technical applications may include a monolithic net structure made of a plastic material, having a plurality of first elements distanced from one another and having an elongate conformation in a respective prevalent development direction, a plurality of second elements distanced from one another and also having an elongate conformation, which develop substantially in a transversal direction to the first elements. The second elements are stretched along a development thereof, and the second elements are configured such that the net structure exhibits a substantially arched profile and forms a longitudinal seating having an axis of extension substantially parallel to the first elements. A process of manufacturing the reinforcing element and an artificial or partially artificial structure obtained by consolidating the terrain using the reinforcing element are also described.
US09358743B2
A method and a device for welding plastic pipes (1) made of thermoplastic material by a butt-welding method, wherein the pipes (1) are held in a coaxial position in relation to one another by clamping points (2), are trimmed by a trimmer (3), which can be brought between the clamping points (2), and are heated up by heated tools (6), which can be fitted in place of the trimmer (3), wherein the heating of the free pipe ends (8) to be welded has the effect of forming a melting region which forms a bead when pressing occurs, the pipe projection (5) of the pipes (1) being trimmed to a defined size.
US09358740B2
A production apparatus includes the following stations juxtaposed in the following sequence: a parison forming station for forming a parison; a built-in part attachment station where opposite sides of a center die provided with a built-in part are held between a pair of molding dies to locate the center die in the molding dies with the parison between the center die and the molding dies, and the built-in part being attached to the parison transferred to the molding dies; a molding station where the molding dies are closed to mold the hollow molded product; and a conveyance station for taking the hollow molded product out of the molding dies and conveying the hollow molded product. The center die is fixed at the built-in part attachment station, and the molding dies are configured to be movable back and forth between the built-in part attachment station and the molding station.
US09358736B2
This invention provides a method of packaging and manufacturing a contact lens in a container, wherein the container comprises a central recess formed of a curved surface with a ring-shaped protruding portion surrounding the curved surface, the method comprising the steps of: providing the container; injecting a lens-forming monomer mixture into the central recess to form the contact lens along the curved surface of the central recess; combining the container and a hand-held section; pouring a solution into the container to immerse the contact lens in the container; and sealing the container with a lid for sealing the contact lens and the solution in the container; wherein the curved surface of the central recess has one or a plurality of continuous radii of curvature Rrecess less than a radius of curvature Rlens of the contact lens in its hydrous state.
US09358733B2
A method for the manufacture of a fiber composite component with at least one opening, which is edged by an integral collar, a device for the execution of a method of this type with a mold core, which has at least one convexity for the formation of a component section in the form of a bulge, also a fiber composite component with a multiplicity of openings, each of which is edged by an integral collar.
US09358725B2
A panel assembly includes at least one reinforcing assembly made of a high strength material having a low yield to tensile strength ratio for energy absorption and reduced weight and profile. The panel assembly may be light-weight with a low profile to minimize protrusion into an opening or compartment enclosed by the panel. The panel assembly may be a floor panel assembly for a vehicle floor. The reinforcing assembly may traverse the panel such that the reinforcing assembly extends laterally, e.g., cross-vehicle, relative to the longitudinal axis of the vehicle body. A method of making the panel assembly may include forming the reinforcing assembly by joining a plurality of metal channel members in a nested arrangement with a plurality of welds to provide a structural assembly with good bending resistance loads imposed on the panel assembly including knee loads. The channel members can be made of dual phase steel.
US09358720B2
The invention relates to a method and device used to blow-mold containers. After thermal conditioning, a preform is shaped into the container inside a blow mold by the effect of blowing pressure. Required blowing gas is introduced into an interior of the preform through a connecting element. After the blow-molding, a purging gas is conducted through the interior of the container. A plurality of blowing stations are used, and, for at least one of the blowing stations, at least part of the required amount of the purging gas is stored in a storage volume associated only with said blowing station.
US09358717B1
The invention comprises a die apparatus including a flexible lip for adjusting a gap between the flexible lip and a second lip. The apparatus includes a rotating shaft that cooperates to move the flexible lip. The rotating shaft may communicate with linear moving members to move the flexible lip. The apparatus may also include a cross-bar contacting the lip and extending substantially the length of the lip, where the cross-bar is connected to the linear moving members that are moved by the rotating shaft. As a result, the dimensions of the gap may be changed by moving the rotating shaft in a first direction or a second direction.
US09358713B2
A hot runner injection molding apparatus (10) includes hot runner nozzles (20), a movable frame (30) that can be displaced between at least two positions relative to a plurality of mold cavities (24), each cavity having a mold gate (27). Valve pins (32) associated with the hot runner nozzles (20) are individually coupled to the movable frame (30) by a decouplable connector (36, 60). Disengagement devices (40) associated with the valve pins are activated to decouple any associated valve pin (32) from the movable frame (30). A control system (52) is used to activate the disengagement devices (40). In some instances a blocking element (42) is also activated to lock any valve pin at the mold gate or close to the mold gate. Control system (52) is further used to operate the blocking element (42). Disengagement devices (40) and the blocking elements (42) can be the same or different.
US09358708B2
A method of manufacturing a terminal block for a telecommunication cable is disclosed, which includes: positioning at least one electrical connector in a mold, the at least one electrical connector comprising a first end adapted to receive a first electrical wire and a second end adapted to receive a second electrical wire; connecting at least one insulated electrical wire to the first end of each of the at least one electrical connectors; and injecting a dielectric material by a force of greater than 1 g into the mold containing the at least one electrical connector and the at least one electrical wire, wherein the dielectric material surrounds at least the first end of the electrical connector and the at least one electrical wire.
US09358702B2
An unseasoned substrate support assembly includes a ceramic body and a thermally conductive base bonded to a lower surface of the ceramic body. The substrate support assembly further includes an upper surface of the ceramic body having a first portion proximate to a center of the upper surface of the ceramic body and having a first roughness profile and a second portion distal from the center of the upper surface of the ceramic body and having a second roughness profile with a lower roughness than the first roughness profile, wherein areas of the first and second portions are based on radial distances from the center of the ceramic body.
US09358688B2
A machine for aligning items in a pattern and a method of using the machine. The machine includes a robotic assembly having four spaced apart joints. The joints including a base joint which is mounted to a stationary surface and a wrist joint onto which an effector is secured. A suction cup is mounted on the effector and is connected to a vacuum source. The suction cup is capable to picking up, positioning and releasing a new item relative to a first laid item and a second laid item. The first and second laid items each have an upper surface and each is aligned perpendicular to one another. The machine further includes three edge sensors and three height sensor. At least one of the edge and height sensors are secured to a first side of the effector and is capable of detecting an edge aligned along an X-X axis of the first laid item and the height of the upper surface of the first laid item, and at least one of the edge and height sensors are secured to a second side of the effector and is capable of detecting an edge aligned along a Y-Y axis of the second laid item and the height of the upper surface of the second laid item. The machine further includes a control mechanism for operating the robotic assembly, the vacuum source and the edge and height sensors. Lastly, the machine includes a power source for supplying power to the control mechanism.
US09358685B2
Robots have the capacity to perform a broad range of useful tasks, such as factory automation, cleaning, delivery, assistive care, environmental monitoring and entertainment. Enabling a robot to perform a new task in a new environment typically requires a large amount of new software to be written, often by a team of experts. It would be valuable if future technology could empower people, who may have limited or no understanding of software coding, to train robots to perform custom tasks. Some implementations of the present invention provide methods and systems that respond to users' corrective commands to generate and refine a policy for determining appropriate actions based on sensor-data input. Upon completion of learning, the system can generate control commands by deriving them from the sensory data. Using the learned control policy, the robot can behave autonomously.
US09358680B1
A hand tool organizer adapted to be mounted on a wall or door and configured to retain a plurality of tools via profile recesses, where each slidably received tool matches a corresponding recess. The organizer is further provided with side-pivoting doors and slide-out drawers.
US09358673B2
A tool having segments forming a triangle wherein a connecting bolt segment moves the other two segments together, thus rotating a valve nut, is disclosed. The tool can be attached and easily operated without the disadvantage of having to apply physical strength in an awkward position. Different embodiments are provided that are adaptable to various valve body types.
US09358670B2
A surface fine machining tool has a working medium carrier with a bottom side and a top side. Grooves extend from the top side to the bottom side completely through the working medium carrier and have a narrowed portion at the bottom side but do not narrow upwardly toward the top side. The working medium carrier is an injection-molded plastic part. Lamellas with a holding rim and a lamella body are inserted with the holding rim in the grooves. The lamella body extends downward away from the holding rim, passes through the narrowed portion, and extends away from the bottom side. The lamellas are uniformly distributed about the bottom side. The grooves have an open end at a carrier rim of the working medium carrier. The open end has a cross-section matching the groove cross-section. A cover is connected to the top side and covers grooves and holding rims.
US09358652B2
A tool turret includes a tool disk (2) swivelable about a support column (32) that defines a swivel axis (26) into positions in which at least one machining tool fastened to the tool disk (2) is in a machining position. A drive device (14) includes drives (10, 8) connected by a controllable coupling device (18) to outputs (20, 22) used to drive the tool disk (2) or the machining tool. The drive device (14) is arranged inside the tool disk (2) together with the drives (8, 10) and the output (22) used to drive the machining tool. The output used to drive the tool disk (2) in a swiveling manner has a gear train arrangement (34) outside the tool disk (2) on the support column (32). The gear train arrangement has an output shaft (70) that extends along the support column (32).
US09358651B2
The present disclosure provides a system and method for automatically adjusting a position of a panel on a chuck. The system includes: the chuck having a front end sensor and a rear end sensor arranged respectively on front and rear ends of the chuck in a direction of carrying the panel, and also having an adjustment unit arranged in a central area of the chuck; and a central control apparatus configured to receive a front end trigger signal transmitted by the front end sensor, and judge whether to enable the adjustment unit to adjust the position of the panel on the chuck based on whether a rear end trigger signal transmitted by the rear end sensor is received within a predetermined period of time after the front end trigger signal is received. In this way, the position of the panel with respect to the chuck can be adjusted efficiently, thereby accurately judging a condition of carrying the panel, and thus preventing a machine station from falsely generating an alarm and halt.
US09358645B2
A method for finishing a shape of a component by machining, in which one area is produced by smelting with a thickened portion forming a first surface with a surrounding profile and a theoretical profile defined by a second surface, the method including: defining, on the second surface, a grid forming nodes and squares; defining each point over which the machining tool is to pass according to weighting coefficients equal to weight to be given to the nodes of the square in which the tool is located, to be the barycenter of assigned nodes of the coefficients; measuring, for each node located outside an outer limit, the delta between the first surface at the node and the theoretical position of the node; calculating deltas for each node within the outer limit by interpolation from already known deltas; using the weighting coefficients, defining the delta to be applied at each point.
US09358642B2
A movable joining device for connecting structural components of an aircraft, with joining means moveably arranged on a guiding device situated on the outside of the structural components so as to fixedly connect joining edges of the structural components positioned adjacent to each other, wherein the joining means includes a welding unit that can move on the rail-like guiding device, and is equipped with a special so-called bobbin tool as a tool for friction stir welding.
US09358638B2
A movable vacuum welding device (1) includes a vacuum chamber (7) having an edge section (12) opposite to a surface of a welding target (T) and forming a vacuum space between the surface of the welding target (T) and the vacuum chamber (7), a seal section (8) interposed between the edge section (12) and the welding target (T) throughout the entire circumference of the edge section (12), a welding head (9) configured to perform welding on the surface of the welding target (T) in the vacuum space, and a preload unit (10) configured to previously apply a load to the seal section (8). The seal section (8) includes a first seal member (27) formed of an elastic material and extending along the edge section (12), and a second seal member (28) disposed at least a rear side in a relative moving direction in which a welding bead (W) passes and having higher flexibility than the first seal member (27).
US09358633B2
The invention relates to an ultrasonic welding device having an oscillator, having a sonotrode, which can be caused to oscillate with a wavelength, and has a welding region in the vibration antinode of the sonotrode. The sonotrode is supported at the vibration node of the sonotrode in a first bearing. To enable both a radial and an axial alignment of the sonotrode, the first bearing has a projection, which has a U-shaped geometry in a section extending in a longitudinal direction of the sonotrode, which U-shaped geometry has side legs and a cross leg that connects the side legs, the projection engages in a recess in the sonotrode matched to the U-shaped geometry, the sonotrode is supported on the cross leg of the projection in a planar manner, and the sonotrode is axially aligned by means of at least one side leg of the projection.
US09358616B2
A device for connecting two components (10, 14), for example two tool parts. The first component (10) has a cylindrical locating pin (12) and an annular face (22) projecting radially beyond this locating pin (12), while the second component (14) has a cylindrical locating bore (16) for receiving the locating pin (12) and an annular face (24) surrounding the locating bore (16). Also provided is a clamping mechanism (18), which ensures during the clamping operation that the locating pin (12) is drawn into the locating bore (16) and at the same time the annular faces (22, 24) are pressed against one another.
US09358615B2
A metal particle manufacturing system includes: a first airtight container, in which a metal film is placed and conveyed; a plasma melting chamber for heating and melting the metal film into ultrafine particle metal; a second airtight container for cooling and suspending the ultrafine particle metal for collection and being taken out; and a circulating conveyor belt for providing conveying channels between the first airtight container, the plasma melting chamber and the second airtight container. Airtight channels are provided to cover between the first airtight container, the plasma melting chamber and the second airtight container. With this implementation, the highly pure ultrafine particle metal with the purity reaching 99.99% can be obtained.
US09358610B2
A device for supporting a molten metal container is provided, wherein the device has first and second support units for supporting the weight of the molten metal container in connection with a ring member, taken alone or in combination according to a rotary position. According to one embodiment of the present invention, the device for supporting the molten metal container comprises: a ring member which encloses the outside of a rotatable molten metal container; and first and second support units which are configured to support the weight of said molten metal container in connection with said ring member, taken alone or in combination according to a rotary position of said molten metal container.
US09358602B2
There is provided a useful method for producing a press-formed product without making the structure of a press tool complicated, which product has favorable formability in a level so as to be able to be produced by deep drawing, and which product is produced by press-forming a thin steel sheet with a punch and a die, in which the thin steel sheet is heated to a temperature not lower than an Ac3 transformation point thereof, and the press-forming is then started, wherein the forming is carried out so that a temperature difference in the thin steel sheet is adjusted to be not higher than 200° C. at a stage when the thin steel sheet has reached one third of a forming height.
US09358600B1
A method of forming a gun barrel includes providing a gun barrel with a desired wall thickness, and cold gas-dynamic spraying the gun barrel with a titanium powder to form an outer layer. The method may further include contouring the outer layer, applying a ceramic top coating to the contoured outer layer of the gun barrel, and sealing the gun barrel with a liquid metal sealer. The method may further include spraying the gun barrel with a bonding coating to form a bonding layer before cold gas-dynamic spraying the gun barrel.
US09358592B2
A mobile sanitary wash apparatus and system including a housing including vertical and horizontal protective enclosing walls, with at least one vertical side further including an opening for inserting equipment to be cleaned and/or sanitized, and a drainage system coupled to the flooring for receiving and collecting waste effluent for controlled transport and/or disposal.
US09358587B2
A substrate treating apparatus includes a loading section 1, a treating tank 2, a rinsing tank 4, a drying tank 5, an unloading section 6, and a pair of endless belt members 7 for transporting substrates successively through the loading section 1, treating tank 2, rinsing tank 4, drying tank 5 and unloading section 6. The substrate treating apparatus further includes a fixing mechanism for fixing a pair of side edges of each substrate parallel to a transport direction of the substrate to the endless belt members 7. In the loading section 1, a plurality of substrates are fixed, each with the pair of edges thereof parallel to the transport direction fixed at constant intervals to the pair of endless belt members 7. The substrates having undergone the treatment are removed from the pair of endless belt members 7 in the unloading section 6.
US09358581B2
A method of producing a hot-dip galvanized steel sheet includes applying, to a hot-dip galvanized steel sheet having a Ra of 0.5 to 2.0 μm and a PPI of 150 or more, a predetermined surface treatment agent, i.e., a surface treatment agent containing a specified resin compound, a specified urethane resin having cationy, a specified silane coupling agent having a functional group, a specified organic Ti chelate compound, and a tetravalent vanadyl compound at a specified ratio; and drying the surface treatment agent at a ultimate sheet temperature of 50° C. to 180° C. to form a surface treatment coating film with a coating weight of 0.2 to 1.0 g/m2 on the surface of the steel sheet.
US09358575B2
A method for depositing particles on a substrate, or a running substrate, including: (a) producing at least one first compact film of particles floating on a carrier liquid provided in a transfer area having an outlet of particles arranged facing the substrate; (b) producing at least one pattern by depositing a substance on the first film in the transfer area, along a contour of the pattern, the substance maintaining the particles of the film together in contact with the substance; (c) removing at least one portion of the particles of the first film located interiorly relatively to the contour, or exteriorly relatively to the contour; and then (d) transferring patterns onto the substrate through the outlet of particles.
US09358571B2
The invention is a device for holding elongated objects such as fishing rod parts in conjunction with surface treatment. The device includes one first inner part and one outer second part which are pivotally arranged relative to one another between a first position where the object can be inserted into the device and a second position where the object can be fixed temporarily to the device with at least three elastic bands. Each elastic band is connected to a fastening device on the first inner part and a fastening device on the outer second part. Each elastic band's distance from the device's center of rotation changes during the relative turning of the first inner part with respect to the second outer part, causing the object to be held or released from the device depending on the relative rotational orientation of the first inner part and the second outer part.
US09358558B2
Disclosed is a spray gun including: a body having a gun barrel; a coating material nozzle disposed on a tip end side of the gun barrel, and an air cap disposed on the tip end side of the gun barrel to surround a tip end portion of the coating material nozzle, wherein the tip end portion of the coating material nozzle has on the tip end surface thereof a guide wall spreading, and also has on the outer peripheral surface thereof a plurality of air grooves channeled in a longitudinal direction, and wherein each of the air grooves has a bottom portion gradually increasing in depth in the longitudinal direction, the bottom portion being located within a range of the guide wall on the tip end surface of the coating material nozzle.
US09358553B2
Conditioning and concentration of microalgae are accomplished by the process steps of grinding a dilute aqueous dispersion of microalgae in the presence of grinding media and then applying adsorptive bubble separation. This process is amenable to the use of dilute feed microalgal dispersions such as are encountered in the production of algal biomass for biofuel applications.
US09358542B2
A system for holding sample tubes used in immunoprecipitation and similar laboratory techniques. A rack comprises top and bottom plates spaced apart from each other and defining rows of holes to receive the sample tubes and hold the sample tubes in a pair of spaced-apart rows. A magnet holder is configured to slide between the top and bottom plates and between the two parallel rows of sample tubes such that when the magnet holder is fully inserted between the rows of sample tubes, magnets held by the magnet holder align with the sample tubes in the two parallel rows.
US09358540B1
An isothermal reaction and analysis system may include a receiver to receive sample holders, a thermal control subsystem to control a temperature of the receiver, an excitation subsystem, a detection subsystem and an analysis subsystem. Excitation sources and/or detectors are positioned to enhance data collection. Sample holders may include filters, selectively blocking and passing wavelengths or bands of electromagnetic radiation.
US09358533B2
Hollow porous metal oxide microspheres are provided. The microspheres may be used as a support for a catalyst, particularly an exhaust treatment catalyst for an internal combustion engine. Also provided are methods of making the microspheres, methods of using the microspheres as catalyst supports, and methods of exhaust treatment using catalyst articles comprising the microspheres.
US09358526B2
A cobalt containing catalyst supported on a metal oxide suitable for performing a Fischer-Tropsch reaction. A pore volume of a metal oxide support, before loading of cobalt thereon, is within the range of 0.35 to 0.85 cc/g. The support has an average pore diameter before the cobalt loading and reduction such that the effective average pore diameter after cobalt loading and reduction is 14 nanometers or higher. A cobalt loading of 11 weight % or higher is also provided. An alpha value higher than 0.89 in a diesel to wax weight ratio below 1.07 is provided.
US09358523B2
Thermally-activated cellulosic-based carbon is rendered more thermally stable by exposure to a halogen and/or a halogen-containing compound. Such treated cellulosic-based carbon is suitable for use in mitigating the content of hazardous substances in flue gases, especially flue gases having a temperature within the range of from about 100° C. to about 420° C.
US09358514B2
A granulating device for granulating thermoplastic materials. The device has a die head, a cutting chamber housing, and at least one insulating element comprising thermally insulating material. The insulating element is situated between a die head element and a cutting chamber housing element. At least one tempering device situated between the insulating element and cutting chamber housing element or adjacent to the insulating element is provided. The tempering device acts to remove unwanted heat introduced in its vicinity, or to replenish heat undesirably removed from its vicinity.
US09358503B2
Provided are emissions treatment systems for an exhaust stream having an ammonia-generating component, such as a NOx storage reduction (NSR) catalyst or a lean NOx trap (LNT) catalyst, and an SCR catalyst disposed downstream of the ammonia-generating catalyst. The SCR catalyst can be a molecular sieve having the CHA crystal structure, for example SSZ-13 or SAPO-34, which can be ion-exchanged with copper. The LNT can be layered, having an undercoat washcoat layer comprising a support material, at least one precious metal, and at least one NOx sorbent selected from the group consisting of alkaline earth elements, rare earth elements, and combinations thereof and a top washcoat layer comprising a support material, at least one precious metal, and ceria in particulate form, the top washcoat layer being substantially free of alkaline earth components. The emissions treatment system is advantageously used for the treatment of exhaust streams from diesel engines and lean burn gasoline engines.
US09358495B2
TSA method for purification by means of adsorption of a synthetic gas including hydrogen, CO and/or methane, implementing at least one adsorber having at least one adsorbent and subjected to a pressure cycle comprising at least an adsorption step, a step of producing a flow enriched with a main component and a regeneration step, characterized in that the regeneration step includes: regenerating the adsorbent using a regeneration gas including more than 95 mol of nitrogen; and scavenging the adsorbent using a scavenging gas corresponding to a fraction of the synthetic gas to be purified or a fraction of the purified synthetic gas.
US09358486B2
Disclosed is a method of characterizing a fiber sample comprising standard fibers and identification fibers which can be used for tracking and tracing fibers through at least part of the supply chain. Each identification fiber exhibits at least one distinct feature. Each group of distinguishable identification fibers can exhibit a taggant cross-section shape, a taggant cross-section size, or combination of the same taggant cross-section shape and same taggant cross-section size. The distinct features and the number of fibers in each group of distinguishable identification fibers can represent at least one supply chain component of the fibers. The fiber sample can include a portion of an acetate tow band or a filter made from the acetate tow band, and the supply chain information can include the manufacturer of the acetate tow band and the customer of the acetate tow band.
US09358485B2
A filter element is provided. The filter element is removably engaged with a filter head having an inlet and an outlet. The filter element includes an outer housing, a filter cartridge, and a baseplate. The filter element further includes a plurality of seals adapted to seal between the baseplate and the filter head, and between the baseplate and the filter cartridge.
US09358472B2
A amusement ride feature comprises a waterslide sliding surface, a vehicle having a vehicle bottom surface adapted to slide on said sliding surface and to convey at least one rider thereon, and at least one reaction plate and at least one permanent magnet each mounted to one of said vehicle and said sliding surface. The at least one reaction plate and the at least one permanent magnet are positioned to affect motion of the vehicle when the motion of the vehicle brings the reaction plate under the influence of the permanent magnet.
US09358469B1
Systems and methods are provided for an inter-sport fantasy sports challenge. According to one aspect, a set of players is provided to each user, where each player competes in one of a plurality of sports. A roster selected from the set of players is received from each user. Rosters include players selected without regard to a respective sport and a respective position, and can include players from multiple sports. In another aspect, rosters include prescribed numbers of players and positions, and the respective rosters as between at least two users include players from multiple sports. Performance data for each player is received. A player point value for each player is calculated and converted into normalized values using one or more piecewise-defined non-linear functions for each sport. A roster score is calculated by aggregating normalized values for each player on the roster, and users are ranked based on roster scores.
US09358467B2
Technologies are generally described for a load balancing scheme. In some examples, a method performed under control of a load balancing system may include associating a candidate client device with a lower-resolution client device; measuring resource usage of a game server; determining that the measured resource usage has exceeded a predetermined threshold; and transmitting, to the candidate client device and/or the associated lower-resolution client device, a message that instructs a user of the candidate client device to perform a predetermined task using the associated lower-resolution client device.
US09358465B2
A display device is caused to selectably display panels in a predetermined area of a display screen in a predetermined arrangement pattern. When selection of at least one displayed panel is received from a user of a video game processing apparatus, the selected panel and the number of panels are specified. It is determined whether the number of panels satisfies a skill activating condition of a player character or not by referring to skill related information. The skill related information is stored in a skill related information memory. The skill related information contains player character information indicating the player character, skill information indicating a skill, and the skill activating condition indicating an activating condition of the skill. In a case where it is determined that the number of panels satisfies the skill activating condition, action processing for the skill by the player character is carried out.
US09358463B2
A gaming system, comprising a site server configured to provide game instances to local gaming devices in communication with the site server, a monitor for displaying video information related to the game instances, a central server configured to provide information about the availability of a game to players using local gaming devices in proximity of the site server, provide information about the availability of the game to one of the mobile telephones over the wide-area wireless network, receive, from the one or more mobile telephones, an indication of a selected game offered by the central server, and relay game instances between the site server and the one or more mobile telephones as the selected game is being played by players using the local gaming devices and players using the one or more mobile telephones via the wide-area wireless network.
US09358459B2
Provided is an information processing device including a communication unit for transmitting content data to a plurality of display devices connected, a request check unit for causing other display devices to display a check screen for an arbitrary request upon reception of the request from one of the plurality of display devices, and determining whether to permit the request in accordance with a user operation in the other display devices which display the check screen, and a control unit for performing a response control for the request when the request check unit permits the request.
US09358457B2
An example game system includes a home-console type game device and a terminal device. The terminal device includes a touch panel and an inertia sensor, and wirelessly transmits to the game device operation data including touch panel data and inertia sensor data. The game device receives the operation data from the terminal device, and performs game processes based on the operation data. Moreover, the game device generates first game images and second game images based on the game processes. The first game images are compressed, and the compressed image data is wirelessly transmitted to the terminal device. The second game image is output to, and displayed on, an external display device which is separate from the terminal device. The terminal device receives the compressed image data from the game device, expands the received compressed image data, and displays the first game images on a display section.
US09358452B2
Configuration of advertisements in a streaming video segment from a serving node is based on a result of an interactive game process executing on a client device. A configuration of advertisements in the streaming video is determined based on the game result. The configuration may include which advertisements are selected to play during ad slots to be included in the video segment, or a number of ad slots to be provided in the video segment. The serving node may configure the video segment with the advertisements selected based on the game result in the determined number of ad slots so that the selected advertisements are played during the ad slots when the video segment is streamed to the client device. If the video segment is configured with no ad slots based on the game result, then the video segment may be streamed to the client device without advertisements.
US09358447B2
A ski binding heel employs a low-mass, spring-loaded interface between the heel and/or toe release mechanisms of the heel and or toe pieces of the binding and the ski boot, i.e., fast-response heel and toe cups. The low mass or lightweight fast-response heel and toe cup interfaces follows the dynamics of the ski to retain the boot during events that could cause inadvertent release (IR) in a conventional release binding. A biased, or spring loaded member engages, the boot heel/toe for mitigating loads and for absorbing sub-injury loads and compensating for movement between the boot and ski. The spring loaded members are biased toward the boot heel and toe for absorbing loads and compensating for displacements that might otherwise result in an inadvertent release. The spring loaded toe/heel cups permit movements of the boot relative to the ski flexing and counter flexing that might have otherwise resulted in an IR.
US09358446B2
An adjustable connecting element (10) of a device for fixing a shoe to a gliding board, capable of a mobile connection with a second element (50) to enable movement thereof for adjusting the position of a shoe fixing device on the gliding board, characterized in that it includes a rod (12) comprising a locking element (13) capable of fixing the connecting element on the second element (50) and in that it includes at least one clearance compensation component (25), the rod (12) comprising an actuating element (15) cooperating with at least one clearance compensation component (25), so as to reduce or to eliminate remaining clearance when fixing the connecting element by means of the locking element (13).
US09358444B2
According to an example embodiment, a display system includes, among other things, a plurality of displays. A corresponding plurality of processors are associated with the displays. Each processor is configured to control a displayed image on one of the associated displays. A controller is configured to provide a control signal to each of the processors. The control signal indicates a desired image to be displayed on the displays. Each of the processors is configured to receive the control signal and determine whether the control signal satisfies at least one criterion. Each processor is configured to determine a portion of the desired image to be displayed on the associated display based on the control signal. Each controller is also configured to control the associated display to display the portion of the desired image at a time corresponding a timing indicator.
US09358439B2
A recreational amusement takes the form a cooler having a toss-type game board integrated with the cooler's lid. The toss-type game board includes one or more cavities in the top of the lid. Provision is made for orienting the top of the lid in a sloping position for play of the game enabled by the game board. The cooler retains all conventional features of a beverage type cooler and, in particular, the characteristic of the interior space of the cooler being substantially sealed off from the environment about the cooler by placement atop the body of the cooler of the lid.
US09358438B2
A golf tee bag device includes a main body constructed from a single piece of fabric material having a front surface, a back surface and a plurality of edges. The device includes a main pocket area, an elongated horizontal tee pocket, a pair of vertical tee pockets, a marker engagement unit, and a pair of connectors for engaging the back surface of the main body in order to attach the device to a belt.
US09358437B2
A composite shaft formed from a single flag of composite material having variable fiber orientation, and methods of forming said shaft, are disclosed herein.
US09358426B2
Example embodiments may relate to a system, method, apparatus, and computer readable media configured for monitoring a user performing an exercise and generating a avatar of the user and a virtual shadow, wherein the virtual shadow illustrates proper form of the exercise. The example embodiments may further be configured for determining an amount of overlap between the virtual avatar and the virtual shadow, and generating a feedback score based on the amount of overlap.
US09358417B2
A respiratory treatment device comprising at least one chamber, a chamber inlet configured to receive exhaled air into the at least one chamber, at least one chamber outlet configured to permit exhaled air to exit the at least one chamber, and an exhalation flow path defined between the chamber inlet and the at least one chamber outlet. A restrictor member positioned in the exhalation flow path is moveable between a closed position, where a flow of exhaled air along the exhalation flow path is restricted, and an open position, where the flow of exhaled air along the exhalation flow path is less restricted. A vane in fluid communication with the exhalation flow path is operatively connected to the restrictor member and is configured to reciprocate between a first position and a second position in response to the flow of exhaled air along the exhalation flow path.
US09358406B2
The invention is related to a method and apparatus for verifying the beam range in a target irradiated with a charged hadron beam, such as a proton beam. The beam range is the location of the Bragg peak in the target, being the location where the largest portion of the dose is delivered. The method utilizes a prompt gamma camera provided with a slit-shaped opening, so as to be able to produced a 1-dimensional profile of the dose distribution along the beam line. The camera is mounted with the slit oriented perpendicularly to the beam line. The method comprises the steps of calculating a position of the camera with respect to a target, for a plurality of beam energies and spots to be irradiated. The method further comprises the steps of verifying the beam range for said plurality of spots, and delivering a value representative of the difference between the estimated beam range and the actual beam range. The apparatus of the invention is provided with a positioning module for positioning the camera.
US09358399B2
An external charger for a battery in an implantable medical device and charging techniques are disclosed. Simulation data is used to model the power dissipation of the charging circuitry in the implant at varying levels of implant power. A power dissipation limit constrains the charging circuitry from producing an inordinate amount of heat to the tissue surrounding the implant, and duty cycles of a charging field are determined so as not to exceed that limit. A maximum simulated average battery current determines the optimal (i.e., quickest) battery charging current, and at least an optimal value for a parameter indicative of that current is determined and stored in the external charger. During charging, the actual value for that parameter is determined, and the intensity and/or duty cycle of the charging field are adjusted to ensure that charging is as fast as possible, while still not exceeding the power dissipation limit.
US09358395B2
A system for designing a therapy or for treating a gastrointestinal disorder or a condition associated with excess weight in a subject comprising at least one electrode configured to be implanted within a body of the patient and placed at a vagus nerve, the electrode also configured to apply therapy to the vagus nerve upon application of a therapy cycle to the electrode; an implantable neuroregulator for placement in the body of the patient beneath the skin layer, the implantable neuroregulator being configured to generate a therapy cycle, wherein the therapy cycle comprises an on time during which an electrical signal is delivered, the electrical signal comprising: a) a set of pulses applied at a first selected frequency of about 150-10,000 Hz, wherein each pulse of the set of pulses has a pulse width of at least 0.01 milliseconds and less than the period of the first selected frequency.
US09358390B2
A stimulation system, such as a spinal cord stimulation (SCS) system, having a programmer with a user interface. The programmer determines a position of an implanted medical lead with respect to a patient's spinal column. The programmer overlays the medical lead, an initial stimulation field, and an initial target stimulation area within the initial stimulation field on an image of the spinal column. A user enters, via the user interface, graphical manipulations of displayed boundaries of the initial stimulation field and the initial target stimulation area. The graphical manipulations of the stimulation field and the target stimulation field are independent of each other and they may move and/or alter the shape of the boundaries. The programmer then determines stimulation parameters to drive the implanted medical lead to generate the displayed stimulation field and target stimulation field as manipulated by the user.
US09358389B2
An exemplary system includes 1) a headpiece module configured to be affixed to a head of a patient and comprising a primary sound processor configured to generate stimulation parameters used to direct an auditory prosthesis implanted within the patient to apply electrical stimulation representative of one or more audio signals to the patient and 2) a sound processor module separate from the headpiece module and configured to be selectively and communicatively coupled to the headpiece module. The sound processor module includes a secondary sound processor configured to detect a communicative coupling of the sound processor module to the headpiece module and contribute to the generation of one or more of the stimulation parameters while the sound processor module is communicatively coupled to the headpiece module. Corresponding systems and methods are also disclosed.
US09358388B2
Systems and methods for detecting intrathecal penetration are disclosed. A method in accordance with one embodiment includes detecting a value corresponding to an impedance of an electrical circuit that in turn includes an electrical contact located within the patient, and patient tissue adjacent to the electrical contact. The method further includes comparing the detected value to a predetermined criterion, and, if the detected value meets the predetermined criterion, identifying penetration of the patient's dura based at least in part on the detected value.
US09358380B2
Methods and systems for delivering an active agent into an intraoral structure are disclosed. One embodiment of a method for implementing the subject matter described herein includes generating an electrical signal that includes a first frequency, a second frequency, and a third frequency, and supplying the electrical signal to an embedded circuit contained in an intraoral delivery tray, wherein the embedded circuit includes at least one electrode that includes projections positioned proximally to a surface of an intraoral structure. The method further includes providing the first frequency and the second frequency to the at least one electrode to generate an electrical field that electrically motivates the active agent suspended in a fluid medium contained in the intraoral delivery tray toward the intraoral structure via dielectrophoresis and providing the third frequency to the at least one electrode to increase the uptake of the active agent into intraoral structure via alternating current electroosmosis.
US09358377B2
A low-dose-rate (LDR) brachytherapy device having a spatiotemporal radiation profile includes an elongated body having a radioactive material in a spatial pattern to provide a spatial radiation profile with a radiation intensity that varies along a length of the elongated body. The radioactive material includes at least first and second radioisotopes having at least first and second respective decay profiles that together provide a temporal radiation profile that is different from the first and second decay profiles. The spatial radiation profile and the temporal radiation profile form a net spatiotemporal radiation profile configured to provide a radiotherapy plan for a patient.
US09358376B2
A micro-needle roller infusion system for transdermal or intradermal delivery of active agents, skin-care products, and other topical formulations is provided. The infusion system comprises a needle roller assembly with needles enclosed in a housing with a disposable cartridge having the active agent. The device offers the advantages of creating a path for the active agents to reach or be injected into the desired depth for an easier, more effective interaction with the target skin layer. Apart from the approximation of the agent to the target, the device also provides biological benefits of the needling therapy of collagen generation and skin rejuvenation coupled with superior convenience and ease of use.
US09358364B2
An activator attachment that can be attached to the proximal end of a catheter adapter and can activate a blood control valve within the catheter adapter.
US09358357B2
A collar for a tracheostomy tube, a method of securing a tracheostomy tube to the neck of a patient, and a medical device including a collar for the tracheostomy tube. In one exemplary embodiment, the collar includes a securing portion, a protection portion, and an attachment portion. The securing portion secures the tracheostomy tube to the neck of the patient. The protection portion extends from the securing portion and covers a portion of a flange of the tracheostomy tube. The protection portion is also positioned between the tracheostomy tube flange and the neck skin of the patient when the securing portion is attached to the tracheostomy tube. The attachment portion attaches the securing portion to the tracheostomy tube.
US09358347B2
A syringe assembly for fluid collection includes a housing having a sidewall defining a hollow bore therein, and an elongate plunger with the distal end of the plunger forming a chamber within the hollow bore for containing a fluid therein. The plunger is adapted for slideable movement within the hollow bore between an initial position and a retracted position. The assembly includes a hub disposed at least partially within the hollow bore and at least partially supporting a cannula therewith. The hub is adapted to automatically transition from an initial position in which at least a portion of the cannula is disposed external to the housing, to a retracted position in which the cannula is fully shielded by the housing, upon transition of the elongate plunger from the initial position to the retracted position.
US09358338B2
An article for use in manufacturing particle cassettes comprising one or more single pieces of membrane having a plurality of gas flow passages bonded thereto. The article allows convenient manufacture of particle cassettes. Two such articles may be employed to provide a finished particle cassette and a production line in which a plurality of gas flow passages are conveyed on a single membrane is disclosed.
US09358337B2
The invention is related to an apparatus comprising a valve body comprising at least two inlet channels and at least one outlet channel and forming a central cavity connecting the at least two inlet channels and the at least one outlet channel, wherein the central cavity encloses a blocking assembly arranged for closing each of the at least two inlet channels by default and for opening an inlet channel when fluid pressure is applied from that inlet channel; wherein each of the at least two inlet channels is configured for fluid communication with a respective reservoir of at least two reservoirs. The invention is further related to a medical device for delivering at least two drug agents from at least two separate reservoirs comprising an apparatus of the aforementioned kind.
US09358333B2
A medical connector for delivering a liquid at a high flow rate to a patient. The connector includes a gas inlet passage that is configured for connecting to a source of pressurized gas, a spike configured for piercing a stopper of a container, and a liquid outlet passage in fluid communication with the spike. The liquid outlet passage is configured for connecting to tubing through which the liquid in the container can be administered to a patient. The spike has a shield having a first closed end and a second open end such that the first closed end is breakable by the spike when the spike is inserted through the stopper of the container, and the second open end has an annular elastomeric member that attaches to the spike via compressive pressure applied by the annular elastomeric member.
US09358322B2
Disclosed herein are soft tissue fillers, for example, dermal and subdermal fillers, based on hyaluronic acids and pharmaceutically acceptable salts thereof. In one aspect, hyaluronic acid-based compositions described herein include a therapeutically effective amount of at least one anesthetic agent, for example, lidocaine. The present hyaluronic acid-based compositions including lidocaine have an enhanced stability, relative to conventional compositions including lidocaine, for example when subjected to sterilization techniques or when stored for long periods of time. Methods and processes of preparing such hyaluronic acid-based compositions are also provided.
US09358310B2
The invention provides stabilized, biocompatible gold nanoparticles that are stabilized with material from epigallocatechin Gallate (EGCg), which is a polyphenols- or flavonoids-rich plant material that can be obtained from green tea. The EGCg is an antioxidant reducing agent derived from green tea. The gold nanoparticles of the invention can be radioactive or non radioactive and are formed via a simple room temperature fabrication method. In preferred embodiment method of making, an aqueous solution containing gold salts is provided. The aqueous solution is mixed with EGCg in a buffer, such as deionized water. The gold salts react to form biocompatible gold nanoparticles that are stabilized with a coating of EGCg. The thermodynamically feasible redox couple of AuCl4-/EGCg leading to the reduction of AuCl4- by EGCg to form gold nanoparticles. In another embodiment, pre-cooled gold salt and EGCg solutions form multi-layered EGCg coated particles.
US09358306B2
The present disclosure relates to compositions and methods of killing cells. In particular examples, the method includes contacting a cell having a cell surface protein with a therapeutically effective amount of an antibody-IR700 molecule, wherein the antibody specifically binds to the cell surface protein, such as a tumor-specific antigen on the surface of a tumor cell. The cell is subsequently irradiated, such as at a wavelength of 660 to 740 nm at a dose of at least 1 J cm−2. The cell is also contacted with one or more therapeutic agents (such as an anti-cancer agent), for example about 0 to 8 hours after irradiating the cell, thereby killing the cell. Also provided are methods of imaging cell killing in real time, using fluorescence lifetime imaging. Also provided are wearable devices that include an article of clothing, jewelry, or covering; and an NIR LED incorporated into the article, which can be used with the disclosed methods.
US09358297B2
The present invention relates to aqueous solutions useful as pharmaceutical compositions of posaconazole for intravenous administration. These compositions include a solubilizing agent, such as a modified β-cyclodextrin in an acidified solution, which can also include a chelating agent such as disodium edetate (EDTA). In clinical trials, a 200 mg posaconazole dose of the selected composition was found to achieve acceptable pharmacokinetic properties.
US09358294B2
The subject matter of the invention is a method for preparing a vaccine composition comprising at least aluminum oxyhydroxide (AlOOH), and at least the hepatitis B surface antigen and the Haemophilus influenzae type b antigen. According to the invention, the hepatitis B surface antigen is kept adsorbed on the AlOOH, whereas the Hib antigen is kept nonadsorbed. To this end: the hepatitis B surface antigen is adsorbed onto AlOOH in order to obtain an AlOOH/HBsAg complex, then—said AlOOH/HBsAg complex is mixed with the Hib antigen in the presence of cationic amino acids at a concentration of at least 100 mg/l, and of phosphate ions at a concentration of 35 to 45 mMol/l.
US09358289B2
The present invention provides isolated monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to PD-1 with high affinity. Nucleic acid molecules encoding the antibodies of the invention, expression vectors, host cells and methods for expressing the antibodies of the invention are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies of the invention are also provided. The invention also provides methods for detecting PD-1, as well as methods for treating various diseases, including cancer and infectious diseases, using anti-PD-1 antibodies. The present invention further provides methods for using a combination immunotherapy, such as the combination of anti-CTLA-4 and anti-PD-1 antibodies, to treat hyperproliferative disease, such as cancer. The invention also provides methods for altering adverse events related to treatment with such antibodies individually.
US09358288B2
A method of identifying a combination of antibodies with a combined improved anti-tumor activity is provided. The method comprising: (a) identifying binding epitopes of anti ErbB-2 antibodies; and (b) selecting a combination of at least two antibodies of the anti ErbB-2 antibodies exhibiting binding to different epitopes on the ErbB-2, at least one of the different epitopes being localized to a dimerization site of the ErbB-2, the combination of antibodies being with the combined improved anti-tumor activity. Also provided are novel antibody combinations uncovered according to the present teachings.
US09358286B2
The invention provides means and methods for producing one or more Ig-like molecules in a single host cell. Novel CH3 mutations enabling the production of monospecific and/or bispecific Ig-like molecules of interest are also provided.
US09358285B2
Methods of stimulating or enhancing an immune response in a host are disclosed. The methods include contacting a monocyte with 15 kD granulysin thereby producing a monocyte-derived dendritic cell. In one example, the method further includes contacting the monocyte or monocyte-derived dendritic cell with a target antigen, such as a tumor antigen or an autoimmune antigen. In another embodiment, the method includes contacting the monocyte with an additional agent that enhances maturation of dendritic cells or induces immunological tolerance. The methods are of use in vivo, in vitro and ex vivo. In another aspect, the disclosure relates to compositions and methods for the treatment of tumors.
US09358275B2
A stable pharmaceutical composition in liquid form or in solid form, containing factor VII. The composition is free of mannitol, sucrose, and any antioxidant.
US09358268B2
A method including introducing into a blood stream a delipidated high density lipoprotein (HDL) and a bioactive agent. A composition including a delipidated high density lipoprotein (HDL) and an auxiliary agent in a form suitable for delivery into a blood vessel. A composition including Apo A1 comprising a hydrophobic ligand suitable to interact with cell surface binding sites. A composition including Apo A1 and an agent selected to one of increase the ATP-binding cassette protein 1 (ABCA1) transporter expression in macrophages and protect ABCA1 from thiol-mediated degradation.
US09358252B2
Polysaccharide preparations lacking substantial anticoagulant activity are provided herein. Methods of making and using such preparations are provided.
US09358250B2
Provided herein are therapies for the treatment of pathological conditions, such as cancer, and method of using SCD1 antagonists.
US09358249B2
In certain embodiments this invention pertains to the discovery that inhibition of the expression and/or activity of eukaryotic initiation factor 4A (eIF4A) inhibits the aging process. Accordingly, in certain embodiments, methods are provided for inhibiting/slowing aging. The methods typically involve administering to a mammal an agent that inhibits the expression and/or activity of eukaryotic initiation factor 4A (eIF4A) in an amount sufficient to inhibit expression or activity of EIF4A, where the agent is not resveratrol.
US09358247B2
The present invention relates to a method of inhibiting growth of a cancerous cell. The method includes the step of exposing the cancerous cell to an anti-cancer therapy and an effective amount of a steroid saponin.
US09358245B2
Disclosed is a method of manipulating the rate of gastrointestinal transit in a mammalian subject. Also disclosed is the use, in the manufacture of a medicament for the treatment of constipation, of a selective inhibitor of methanogensis, a methanogen-displacing probiotic agent, or a prebiotic agent that inhibits the growth of methanogenic bacteria or promotes the growth of competing non-methanogenic intestinal flora. Alternatively, in accordance with the invention, is disclosed the use in the manufacture of a medicament for the treatment of diarrhea, of methane or a methane precursor, a methanogenic or other methane-enhancing probiotic agent, or a methanogenesis-enhancing prebiotic agent.
US09358244B2
The present invention relates to solid dosage forms of oleyl phosphocholine (C18:1-PC), or OlPC, for oral administration. Further, the present invention relates to methods for the preparation of the present solid dosage forms and the use thereof as a medicament and especially a medicament for treatment of parasitic diseases, such as leishmaniasis, chagas and malaria, and cancer both in humans and animals. Specifically, the present invention relates to a solid dosage form comprising: 6 to 25 weight % of the solid dosage form oleyl phosphocholine; 20 to 35 weight % of the solid dosage form lactose; 35 to 50 weight % of the solid dosage form cellulose; 5 to 20 weight % of the solid dosage form croscarmellose; 1 to 10 weight % of the solid dosage form hydroxypropylmethyl cellulose; and 0.05 to 1 weight % of the solid dosage form of a lubricant.
US09358231B2
The present invention relates to novel compounds which are able to modulate b-raf kinases, and the use of such compounds in the treatment of various diseases, disorders or conditions.
US09358230B1
Abuse-resistant, controlled release opioid tablets are a combination containing an opioid antagonist such as naloxone at a level above that needed to suppress the euphoric effect of the opioid, if the combination were crushed to break the controlled release properties causing the opioid and opioid antagonist to be released as a immediate release product as a single dose. The controlled release nature of the table prevents the accumulation of orally effective amounts of opioid antagonist when taken normally. The opioid antagonist is contained in a controlled-release matrix and released, over time, with the opioid.
US09358229B2
Provided herein is a combination therapy comprising a JAK kinase inhibitor and a dual PI3K/mTOR inhibitor, as well as methods of treating various cancers through the use of such a combination therapy.
US09358224B2
Pharmaceutical formulations to be administered by pressurized metered dose inhalers (pMDIs), comprising a compound of general formula (I) may be used for the treatment and/or prevention of inflammatory or obstructive airway diseases.
US09358223B2
An implantable drug depot useful for preventing, reducing or treating bleeding at a surgical site beneath the skin in a patient is provided. The implantable drug depot comprises a therapeutically effective amount of clonidine or a pharmaceutically acceptable salt thereof, and at least one biodegradable polymer. The drug depot is capable of releasing clonidine or a pharmaceutically acceptable salt thereof over a period of at least three days.
US09358215B2
This application provides a high throughput method of making nanoparticles that utilizes plates comprising wells (e.g., 96-well plates).
US09358211B2
The present invention is directed to a crosslinked or non-crosslinked polymer particle, wherein the crosslinked polymer particle comprises a copolymer of poly(alkylene glycol-graft-acrylate) that is crosslinked by at least one hydrolysable monomer or crosslinking agent. The present invention is also directed to a polymer particle comprising a crosslinked polymer particle that is a product of starting materials comprising (a) a hydrophilic monomer, (b) a hydrophobic monomer, and (c) a hydrolysable crosslinking agent (the crosslinking agent may be absent in the case of non-crosslinked particles). The present invention is still further directed to a polymer particle comprising a crosslinked copolymer, where the crosslinked copolymer includes structures represented by Formulas (I), (II), and (III), as defined in the specification. Other embodiments of the present invention also include methods of manufacturing polymer particles.
US09358209B2
The invention provides a water-based composition for treating an infection by a dermatophyte fungus comprising econazole or a pharmaceutically acceptable salt thereof. Also provided are methods of treatment utilizing the water-based foam composition, as well as its preparation.
US09358206B2
Disclosed are compositions and methods for treating a patient with a pharmaceutically active agent other than insulin selected from the group consisting of peptides, peptidomimetics, and proteins, wherein the pharmaceutical composition is in the form of an emulsified nasal spray comprising: a macrocyclic permeation enhancer, a liquid carrier comprising water, and a therapeutically effective amount of a pharmaceutically active agent other than insulin selected from the group consisting of peptides, peptidomimetics, and proteins; wherein the macrocyclic permeation enhancer is a Hsieh enhancer emulsified in the liquid carrier.
US09358203B2
Disclosed are compositions and methods for their use comprising effective amount of Silybum marianum extract and Momordica grosvenori fruit extract.
US09358194B2
Succinic acid esters of resveratrol and topical compositions containing the esters.
US09358190B2
The present invention relates to a dyeing composition. More particularly, the present invention provides a dyeing composition comprising an ether-based nonionic surfactant, an ether-based oil and alcohol. Preferably, the ether-based nonionic surfactant, the ether-based oil and the alcohol have the same number of carbon atoms. The dyeing composition according to the present invention comprises the ether-based nonionic surfactant, the ether-based oil and the alcohol, forms a multi-lamellar liquid crystal structure, allows for ease of material application and maintains excellent color formation, and particularly, mitigates pungent smell, eye irritation and the like.
US09358189B2
The present invention relates to water-dispersible core-shell microcapsules essentially free of formaldehyde. In particular it concerns core-shell microcapsules having a shell obtained by reacting polyisocyanates or polyoxirans cross-linkers and oligomeric compositions which are the reaction products between a polyamine component and a particular mixture of glyoxal and a C4-6 2,2-dialkoxy-ethanal. The present invention comprises also the invention's core-shell microcapsules as part of a perfuming composition or of a perfuming consumer product.
US09358179B2
A mobile massage and spa unit includes a body, a lighting system and a massage table. The body includes a front, rear, and side walls and a divider extending between the side walls to divide the body into a front section and a rear section. A perimeter of the rear section is defined at least partially by a surface of the divider, a surface of the rear wall, and surfaces of the side walls. Such surfaces are coated with a reflective material. The lighting system includes one or more controllable RGB fixture mounted within the rear section and configured to emit a selected color light. The emitted light is reflected via the coated surfaces to illuminate the rear section with the selected color light. The massage table is disposed within the rear section and centered between the side walls thereof. A working area is defined completely around the massage table.
US09358168B2
A patient support apparatus includes a patient support surface to support a patient. The patient support surface has at least one air bladder that is inflated and/or deflated to achieve a turn assist function and/or a therapy function of the patient support surface. A graphical user interface (GUI) is configured to receive user inputs from a caregiver to initiate the turn assist or therapy functions. The patient support apparatus has control circuitry coupled to the GUI. The GUI is controlled by the control circuitry to display information indicating that the patient is improperly positioned on the patient support surface for either the turn assist function or the therapy function. Alternatively or additionally, the control circuitry indicates that the patient is improperly positioned for raising a head section of a bed frame.
US09358163B1
A detachable electric drive unit for a wheelchair is provided. The detachable electric drive unit includes a housing having an interior volume and two guide rails disposed on opposing sides of the housing. Each guide rail includes a channel to receive a wheelchair wheel and has at least two wheels attached to opposing ends of each guide rail. A roller assembly is disposed within the channels of each guide rail. An electric motor is coupled to the roller assembly in each guide rail. The electric motor drives the roller assembly imparting rotational motion to the wheelchair wheels supported within each channel.
US09358151B2
An apparatus and method of relieving hot flashes or body overheating or insomnia by applying to the body of a person in need of relief therefrom a cooled elongate flexible pillow filled with pellets having sufficient weight and flow properties to provide a comforting wrapping effect on the back of the neck. A preferred filler is wheat berries. In a particular embodiment, the pillow is draped over the stellate-ganglion area of the neck.
US09358145B2
A method for controlling appetite by means of a satiation device is disclosed. The device, which includes a flexible webbing defining proximal and distal openings and a biasing structure, is attached to the patient's stomach with the proximal opening positioned adjacent and below the patient's gastro-esophageal junction. The biasing structure imparts pressure against the wall of the patient's stomach adjacent the gastro-esophageal junction.
US09358142B2
Catheter for delivering an expandable prosthetic device. The catheter has a guidewire channel for delivering a side branch guidewire to a side branch target site. An expandable prosthetic device can be loaded on to the distal end of the catheter.
US09358139B2
An expandable, bistable open cell design incorporates the following features: a first relatively stiff portion (152) having first and second ends and a first relatively flexible portion (154) connected to the first and second ends of the first relatively stiff portion, the first relatively stiff portion and the first relatively flexible portion substantially surrounding a first open area (156) of the stent structure; a second relatively stiff portion (158) having first and second ends and a second relatively flexible portion (160) connected to the first and second ends of the first relatively stiff portion, the first relatively stiff portion and the first relatively flexible portion substantially surrounding a second open area (162) of the stent structure; and an opening (110) formed through the first relatively stiff portion and the second relatively flexible portion such that the opening connects the first and second open areas, thereby creating first and second intermediate ends (152a, 152b) of the first relatively stiff portion and first and second intermediate ends (160a, 160b) of the second relatively flexible portion. The first intermediate end (152a) of the relatively stiff portion is connected to the first intermediate end (160a) of the relatively flexible portion so as to create a first inward apex (170), the second intermediate end (152b) of the relatively stiff portion is connected to the second intermediate end (160b) of the relatively flexible portion so as to create a second inward apex (172), and the stent structure is configured such that, in a collapsed configuration, the first inward apex (170) is in contact with the second inward apex (172) and, in an expanded configuration, the first inward apex is biased to move in a first circumferential direction and the second inward apex is biased to move in a second circumferential direction that is different than the first circumferential direction.
US09358129B2
The present invention provides an expandable fusion device capable of being installed inside an intervertebral disc space to maintain normal disc spacing and restore spinal stability, thereby facilitating an intervertebral fusion. In one embodiment, the fusion device includes a central ramp, a first endplate, and a second endplate, the central ramp capable of being moved in a first direction to move the first and second endplates outwardly and into an expanded configuration. The fusion device is capable of being deployed down an endoscopic tube.
US09358127B2
The present invention provides an intervertebral implant for implantation in a treated area of an intervertebral space between vertebral bodies of a spine. The implant includes a spacer portion having an inferior and superior surface, wherein the inferior and superior surfaces each have a contact area capable of engaging with anatomy in the treated area, and the inferior and superior surfaces define a through-hole extending through the spacer body. The present invention further provides screw holes extending from a side portion to the inferior and superior surfaces of the spacer portion and a plate portion rigidly coupled to the spacer portion through a coupling means, wherein the plate portion contains screws holes for receiving screws. A screw back out prevention mechanism adapted on the plate portion and prevents the back out of screws from the screw holes.
US09358124B2
An apparatus for inserting an implant between vertebrae includes a body having a through bore, a central shaft movable within the through bore, the central shaft having a proximal end and a distal end. The apparatus includes a pair of distractor arms having proximal portions and distal portions, the proximal portions pivotally coupled to the body and distal portions for engagement between the vertebrae. Tracking slots are formed in and extend through surfaces of and along a longitudinal axes of the distractor arms and an attachment tip is operably connected to the central shaft, the attachment tip is configured to grip the implant. The apparatus includes a single guide member projecting outward from the attachment tip and the attachment tip is removably connectable to the central shaft in multiple configurations.
US09358120B2
Coiled spinal implants for disc, vertebral body, and spinal motion segment replacement or reconstruction comprise a plurality of loops and spaces between the loops, with the loops formed of a hollow material and having a plurality of apertures or a longitudinal gap that extend(s) through the sidewalls of the loops and into the hollow center. The coiled implants include one or more balloons within the hollow center, the spaces between the coil loops, and/or within the central void that the coil surrounds. Filling the balloon expands the loops and thereby increases the height of the coil. Bone graft material or bone cement may be deployed from the apertures or gap.
US09358117B2
A system for replacing a trochlear groove region of a femur. The system includes a prosthesis that includes a bone contact surface and a periphery that defines an outer perimeter. The bone contact surface has a plurality of protrusions and a spatial configuration with respect to one another. Additionally, the system includes a first template that has a plurality of guide holes and a first periphery that defines an outer perimeter that substantially corresponds with the periphery of the prosthesis. Also, included in the system is a second template that has a plurality of guide holes and a second periphery that defines an outer perimeter that substantially corresponds with the periphery of the prosthesis. The plurality of guide holes of the second template are spatially arranged with respect to the second periphery to substantially match the spatial configuration of the plurality of protrusions of the prosthesis.
US09358112B2
A method for performing annuloplasty includes accessing a left ventricle of a heart to provide a discrete plication element to the left ventricle, and engaging the plication element to tissue near a mitral valve of the heart. Engaging the plication element includes causing the plication element to gather a portion of the tissue to create a plication. In one embodiment, accessing the left ventricle of the heart to provide the plication element includes accessing the left ventricle of the heart using a catheter arrangement.
US09358101B2
An intraocular lens comprising a lens optic coupled to at least one haptic and at least one deformable connecting bar positioned between the lens optic and the at least one haptic.
US09358096B2
A drug eluting stent can include a stent body having a polymeric coating with a lipophilic and/or hydrophilic element. A drug that has a bioactivity that inhibits cell proliferation can be disposed in the polymeric coating. The drug can be present in the polymer at an amount greater than or equal to about 150 μg/cm2. The polymeric coating and drug are configured to cooperate so as to form a diffusion pathway with tissue when the stent is disposed in a body lumen such that the drug preferentially diffuses into the tissue over a body fluid passing through the body lumen such that a maximum systemic blood concentration of the drug is less than about 40 ng/ml.
US09358084B2
A lidded plastic container has a plunger in the lid which pushes clear trays (that usually float) down into a cleaning solution. The container may include vent holes in its lid to allow gas evolving cleaning agents to vent without building up pressure inside the container.
US09358071B2
A method of sterilizing an article is provided. The method includes providing sterilization wrap system with which to wrap the article to be sterilized. The sterilization wrap system comprises a plurality of wrap units configured in a stack, at least one wrap unit in the stack being detachably attached to at least one other wrap unit in the stack.
US09358055B2
Techniques are generally described related to a method and system for treating an injury with a bone screw. One example bone screw may be configured to fracture at a pre-selected frangible location so that the point of failure is not in an inaccessible location, e.g., deeply embedded below the surface of a treated bone. The bone screw may further include a material disposed over the frangible location that is designed to temporarily strengthen the screw and selected to be absorbed by the body over a period of time after installation of the screw in the bone. One example bone screw may include an unthreaded portion that is configured to facilitate removal of an embedded screw fragment from a bone in the event that the screw fails in vivo.
US09358052B2
The present invention relates to a device for fixation of bone fragments at bone fractures. The device comprises at least two fixation means (5, 6) and a securing plate (4). With the object of preventing or counteracting re-dislocation, the respective fixation means (5, 6) each have a first fixing portion (19) for fixing the fixation gleans in an inner bone fragment (3), a second fixing portion (21) for locking the fixation means to the securing plate (4) which is disposed on the outside of an outer bone fragment (2) and allows movement of the outer bone fragment relative to it, so that the fixation means are prevented from changing their angular position relative to the securing plate and relative to one another, and a middle portion (22) which is situated between the fixing portions and runs through the outer bone fragment, along which middle portion the outer bone fragment can slide inwards towards the inner bone fragment in which the fixation means is fixed.
US09358050B2
An orthopedic assembly is described that comprises an orthopedic device, an anchor, and a locking mechanism. The orthopedic device can be a plate member having an aperture that is configured to receive the anchor. The anchor can include a head, neck and shank portion. The head portion can include a plurality of arms separated by grooves that are capable of splaying. The assembly is configured such that when the locking mechanism is inserted into the head portion, this causes expansion of the arms of the head. This expansion locks and secures the anchor to the orthopedic device. Various instruments are provided that can deliver the locking mechanism to the anchor, and can provide impact to lock functionality.
US09358042B2
Lead extraction is the removal of one or more leads from inside the heart utilizing a lead removal catheter having a tubular sheath that is placed in the blood vessel, either subclavian or femoral. The sheath of the lead removal catheter may accidentally tear or perforate the blood vessel as it is advanced over the lead toward the heart. Such an occurrence must be dealt with quickly to prevent harm to the patient or subject. An expandable member, such as a balloon, attached to the exterior of the sheath of a lead removal catheter can be deployed temporarily adjacent the perforation in the vessel wall. Inflation of the balloon not only stops (or substantially stops) the bleeding, but, upon inflation, the balloon may include one or more channels that allow blood to continue to flow through the channel(s) until the blood vessel perforation can be repaired.
US09358041B2
The present invention generally provides methods and devices for removing fluid from a surgical instrument. Surgical access devices and seal systems are generally provided having one or more valves or seal assemblies to create a closed system between the outside environment and the environment in which the surgical access device is being inserted. In one embodiment, a seal assembly is provided and can include a seal having an opening configured to receive a surgical instrument therethrough and a fluid remover in the form of an absorbent element, a scraper element, a wicking element, or any combination thereof can be associated with the seal and configured to remove fluid from the opening and/or a surgical instrument.
US09358026B2
A gripping instrument with two jaw parts, which are connected to each other by a pivot joint and are movable toward each other, by pushing together of two grip arms connected to the jaw parts, and are movable away from each other, by pushing apart of the grip arms, wherein the grip arm has a bending joint, by means of which, when the grip arms are pushed together, a force limited by a resiliency of the bending joint is transmitted, via the grip arm with the bending joint, to the corresponding jaw part, and which bending joint includes a directional abutment, wherein an applied manual force acts directly through the directional abutment during the pushing apart.
US09358022B2
A minimally invasive endovascular device for treating a blocked or obstructed biological lumen, such as a blood vessel fully or partially obstructed by deposits of biological matters in or non-biological matters. Certain embodiments of the present invention comprise two capture members that are configured to be placed on either side of the obstruction and enclose around the obstruction for removal. Embodiments of the present invention also provide methods for implementing an endovascular device according to aspects of the present invention.
US09358005B2
An end effector is disclosed which comprises a first jaw, a second jaw, a staple cartridge, an anvil, and at least one layer positioned intermediate the first jaw and the second jaw. The layer may include a pattern of holding features defined on a tissue contacting surface of the layer. The pattern of holding features can extend between a proximal end of the layer and a distal end of the layer. The pattern of holding features may be defined by a network of interconnected channels skew to a longitudinal axis of the layer. The network of interconnected channels may be configured to mitigate and/or control the flow of patient tissue relative to the layer.
US09357997B2
Instruments and techniques to pass a suture, particularly in instances where access to confined spaces and the ability to pass a suture through difficult to penetrate materials are needed. According to certain embodiments, a suture passer is provided including a housing, a needle assembly, and a barrel assembly. The needle assembly may include a needle that is displaceable along a linear motion axis of the housing, and which is adapted to engage a suture. The barrel assembly may include a foot having an opening in a proximal facing surface to receive passage of the needle. The foot may include an elbow having proximal and distal portions, with the proximal portion having a distal facing surface that extends along a proximal portion axis diverging distally away from the motion axis, and the distal portion extending distally from the proximal portion and having a proximal facing surface that extends along a distal portion axis that is arranged transverse to the motion axis.
US09357995B2
An internal bracing system is disclosed for stabilizing a joint such as the knee, shoulder, ankle or the like. The internal bracing system includes an extra-articular tension band mechanism and an anchor assembly therefore. The internal bracing system adds substantial control to unstable joints which is effective in limiting the pathological joint motions and internal slippage. The anchor anchoring assembly designed to affix a tethering device to various bony structures which form a joint, for the purpose of providing stability. The anchor assembly includes an anchor and a set screw. A double helix thread/chamber structure between the anchor and set screw securely holds the tether without binding.
US09357990B2
Fixation assemblies having a button captured by a continuous (i.e., closed) loop of thread, such as ultra high molecular weight polyethylene (UHMWPE) fiber are disclosed herein. Preferred assemblies are constructed such that the intact button cannot be detached from the continuous loop without breaking or opening the loop of fiber. The closed fiber advantageously contains at least one or two stitched, or otherwise secured or reinforced, sections positioned on the loop.
US09357989B2
A generic bone implant, or set of standardized implants, is created based on using a guide device to develop an axis normal to an articular surface of bone and collecting only one or two data points. A generic cutting tool is used to cut the bone to a point where a generic implant can be used. Several improved tools relating to the procedure for using such an implant, as well as methods for using implants consistent with the invention are further described, including: single-axis and biaxial drill guide tools and methods, generic single-axis implant methods and devices, generic biaxial implant methods and devices, tools and methods for holding or delivering an implant, removal or revision tools and methods, digital measuring systems and methods, and set of measuring gauges for determining the appropriate implant dimensions.
US09357988B2
A spinal surgery retractor and method of use. The retractor includes a slotted keyway for integrating a keyed spinal distractor. The retractor and distractor combination slide together to displace a portion of the intervertebral disk space to restore or maintain intervertebral spacing and facilitate retraction of surrounding soft tissues while disk space surgery is performed. The distractor head and mating portion of the retractors have matching profiles that enable the retractor to maintain distraction of the vertebra after removal of the distractor portion of the tool, permitting access to increase at the operating site.
US09357986B2
A medical instrument for dilating osseous structures, with a shaft on whose distal end a tool point is positioned and on whose proximal end a handle is positioned, such that the handle and the tool point are in active connection with one another by means of an actuating element in such a way that by actuating the handle the tool point can spread radially at least partially and where the distal end of the actuating element has a thickened configuration. To provide a dilating instrument that is sufficiently stable and allows for sensitive actuation, it is proposed with the invention that the tool point should consist of several segments that can radiate radially outward and enclose the thickened distal end of the actuating element essentially completely, when the tool point is in the closed position.
US09357982B2
A tampon assembly includes a flexible and relatively thin impermeable portion having two opposite side faces and an outer edge which is oval in shape so that the oval shape of the impermeable portion has a largest dimension as measured through the center of the impermeable portion and a smallest dimension as measured through the center of the impermeable portion, and the largest dimension is at least about 1.5 times the size of the smallest dimension. The assembly further includes an absorbent pad portion which is secured to one side face of the impermeable portion so that when the assembly is positioned within a user, the absorbent pad portion is positioned in a condition for absorbing fluids and the outer edge of the impermeable portion sealingly engages the walls of the vaginal canal.
US09357976B2
An imaging system includes a computer programmed to reconstruct original CT projection data, estimate noise in image space, forward project the image noise estimate to generate an initial projection noise estimate, modify the initial projection noise estimate using a statistical property of noise in projection space, remove noise in the original CT projection data by subtracting the modified noise estimate therefrom to generate noise-removed projection data, and reconstruct a final image based on the noise-removed projection data.
US09357972B2
A radiological image sensor has an electronic substrate and an imaging chip held within a housing, the imaging chip having electronics that create a dead space, with a cable attached to the housing at a cable button connector, the dead space being at a short distal side of the generally rectangular sensor opposite the short mesial side at which the cable exits the cable button connector. The mesial side of the sensor either does not have a dead space created by electronics of the imaging chip or the dead space found on the mesial side of the sensor is less than approximately 4 mm, and, preferably, approximately 2 mm or less. The cable can be a flat cable with a length of approximately one meter or less that can be connected to a round cable.
US09357971B2
An X-ray CT photographic apparatus including: a beam shaping mechanism that regulates an irradiation range of an X-ray generated from an X-ray generator and shapes the X-ray into an X-ray cone beam; and a main body controller that changes a read region, where an X-ray detection signal is read in the X-ray detector, according to the irradiation range of the X-ray cone beam. The main body controller changes the irradiation range of the X-ray cone beam to an x-axis direction during an X-ray CT photography such that only a set CT photographic region is irradiated with the X-ray cone beam according to the set CT photographic region input through a CT photographic region setting unit. The main body controller changes a read region in an X-ray detector with respect to the x-axis direction in a detection surface of the X-ray detector during the X-ray CT photography.
US09357969B2
Methods, implantable medical devices and systems configured to perform analysis of captured signals from implanted electrodes to identify cardiac arrhythmias. In an illustrative embodiment, signals captured from two or more sensing vectors are analyzed, where the signals are captured with a patient in at least first and second body positions. Analysis is performed to identify primary or default sensing vectors and/or templates for event detection.
US09357968B2
Implantable sensor system including a sensor which is situated in a housing, the housing having a measurement region which is permeable for the parameters to be detected by the sensor, wherein the measurement region has an erodible protective coating which is permeable for the parameters to be detected by the sensor.
US09357967B2
An introducer sheath/temperature probe assembly that is insertable into a blood vessel of a human or veterinary patent to measure the temperature of blood flowing through that blood vessel. The introducer sheath/temperature probe assembly may be used in conjunction with an indwelling heat exchange catheter system to warm or cool all or a portion of the patient's body to a desired target temperature and to maintain such target temperature for a desired period of time.
US09357961B2
A portable unit comprises a sampling mechanism used by a patient to take a sample of a bodily fluid or tissue that can be tested for any property indicative of a medical condition of the patient, a microprocessor for determining a treatment for the condition based on a test of the sample, and an administration mechanism for administering the treatment based on the determination by the microprocessor. Operationally, the unit samples a bodily function, evaluates the sample, determines from stored protocols and criteria if treatment is required, and administers treatment. Two-way wireless communication between the unit and one or more remote networks enables numerous functionalities, including (i) collection and collation of medical information and records relating to multiple users of information stored by their units for access by healthcare providers, regulatory agencies, insurance carriers, pharmaceutical companies, and others, (ii) unit maintenance and resupply of consumables, and (iii) direct user-to-user communication.
US09357945B2
An endoscope system includes: a position and posture calculating portion that estimates a position of a distal end and a longitudinal direction of a distal end portion; a condition determining portion that, based on the shape information at the position of the distal end that is estimated, determines whether or not an angle that a core line direction of the luminal organ and the longitudinal direction estimated by the position and posture calculating portion form is equal to or less than a predetermined threshold value; and a position and posture information recording portion that, when the angle that the core line direction and the longitudinal direction form is equal to or less than the predetermined threshold value, records information regarding the position and the longitudinal direction of the distal end.
US09357933B2
Various embodiments of the invention disclosed herein comprise a system of wearable devices that collectively allow for the continuous, non-invasive, measurement and monitoring of blood pressure, without the use of an inflatable cuff. The system incorporates: 1) An optical module, which is comprised of a coherent source of light, a semi-transparent hologram, optics for viewing the interference pattern developed between the illuminated hologram and arterial blood, a Charge-Coupled Device (CCD) array, and processing electronics with Bluetooth capability that facilitates digitization and wireless transmission of the fringe pattern to, 2) a personal digital assistant (PDA) that is worn on a waist belt. The PDA and associated software allow for continuous calculation and monitoring of real-time arterial blood pressure from the digitized fringe patterns received. The system further comprises 3) a personal computer (PC) with wireless capacity and connection to the internet. Continuous BP function, alerts, condition and medical assessment is conducted through PDA-PC communications with internet based medical facility.
US09357928B2
A method of noninvasively imaging tissue within a body includes irradiating the tissue using an imaging laser including a Raman-based laser tuner, the radiation including a plurality of laser pulses, each having energy greater than 100 mJ; receiving an acoustic signal generated by vibrational energy in the tissue, wherein the vibrational energy is a result of selective overtone excitation of molecules in the tissue by the radiation; and automatically converting the acoustic signal to an image representative of the tissue using a processor. An imaging system includes an imaging laser configured to irradiate tissue with a plurality of laser pulses using a Raman-based laser tuner. An ultrasonic transducer receives an acoustic signal generated by vibrational energy in the tissue due to overtone excitation by the radiation. A processor is configured to automatically produce an image representative of the tissue using the received acoustic signal.
US09357921B2
Devices, systems and methods are disclosed which relate to remotely monitoring the health of an individual. The individual wears a health monitoring device, with an attached strap, capable of sensing characteristics of the individual. These characteristics may include voice level and tone, movements, blood pressure, temperature, etc. The device allows individuals to constantly monitor their health without having to physically visit a doctor or other health care professional. Wireless communication, for instance with an Internet Protocol Television (IPTV) set-top box, allows measurements to be made and evaluated by a ‘computerized’ healthcare service provider. For a more accurate evaluation, measurements are sent over the INTERNET to a service. The device communicates with services in order to diagnose the individual based upon the characteristics.
US09357920B2
System and Method pertaining to the modification and integration of an existing consumer digital camera, for example, with an optical imaging module to enable point and shoot fundus photography of the eye. The auto-focus macro capability of existing consumer cameras is adapted to photograph the retina over an extended diopter range, eliminating the need for manual diopter focus adjustment. The thru-the-lens (TTL) auto-exposure flash capability of existing consumer cameras is adapted to photograph the retina with automatic flash exposure eliminating the need for manual flash adjustment. The consumer camera imaging sensor and flash are modified to allow the camera sensor to perform both non-mydriatic focusing of the retina using infrared illumination and standard color flash photography of the retina without the need for additional imaging sensors or mechanical filters. These modifications and integration of existing consumer cameras for fundus photography of the eye significantly improve ease of manufacture and usability over existing fundus cameras.
US09357918B1
A system and method for drug screening for testing an iris for use of a chemical known to have a neurological effect that interferes with normal functioning of the iris and the voluntary muscles of the eye. The system and the method involve testing and documenting reactivity of the iris under known light conditions and can test for the presence of horizontal nystagmus. The identity of a subject can be confirmed by applying an iris pattern recognition model of a captured image of an iris of the eye compared with an image of an iris stored in a library of baseline color or a library of infrared eye images. The system and the method involves providing alarms when one eye pupil diameter exceeds or falls below the opposite eye pupil diameter and when horizontal gaze nystagmus has been determined to be present.
US09357916B2
Methods for analyzing and visualizing OCT angiography data are presented. In one embodiment, an automated method for identifying the foveal avascular zone in a two dimensional en face image generated from motion contrast data is presented. Several 3D visualization techniques are presented including one in which a particular vessel is selected in a motion contrast image and all connected vessels are highlighted. A further embodiment includes a stereoscopic visualization method. In addition, a variety of metrics for characterizing OCT angiography image data are described.
US09357914B2
An ophthalmologic apparatus includes an acquisition unit configured to acquire information about a pupil of a subject's eye, and a control change unit configured to change a method of fogging control for moving a fixation target image away from the subject's eye according to the information acquired by the acquisition unit.
US09357908B2
A blade extending tower is provided for setting blade depth on retractors having telescoping or extending blades. The blade extending tower features a base, a column extending from the base, and mating features on the column configured to engage the blades of a retractor to extend the blades to a desired blade depth. Blade depth of the retractor is set buy sliding the retractor onto the blade extending tower such that the mating features of the blade extending tower engage the blades or the retractor, stopping the blades progression while the rest of the retractor continues along the length of the column. Thus the blades of the retractor are extended from the retractor to a depth determined by the configuration of the blade extending tower.
US09357907B2
A device for performing examination through the uterine cavity, preferably to carry out a computed tomography virtual hysterosalpingography, by the use of a speculum and a cannula or probe, wherein the device comprises a support for centering in the speculum and the probe is retained in a central end of the support to guarantee the centering of the probe within the cervix and the holding of the probe in the desired position during the test.
US09357905B2
An airway device is provided for opening a patient's airway. The airway device provides dual tubes which allow the patient to breathe on his/her own, to be ventilated, or to be intubated. The airway device includes a camera which provides constant visualization of the patient's tissues during insertion of the airway device and during the entire medical procedure. A transmission lumen monitors heart and breath sounds. Information from the camera and the transmission lumen is relayed to a microprocessor to allow for monitoring which may be remote. An airway assist device may be used with the airway device for properly positioning the patient's tongue is also disclosed. The airway assist device is inserted into the patient's vallecula to manipulate the patient's tongue.
US09357904B2
An electronically controlled high frequency jet ventilation laryngoscope includes a laryngoscope handle and a laryngoscope blade. An oxygen supply tube is set within the laryngoscope handle and the front end of oxygen supply tube is placed on the front end of the laryngoscope blade. The laryngoscope also includes an electronic controller having a shell body, a display screen, a solenoid valve, a power supply module, a control module and a control switch. The shell body is fixed at the top of the laryngoscope handle; the display screen and control switch are on the shell body; the power supply module and control module are within the shell body; the solenoid valve is on the oxygen supply tube within the laryngoscope handle; the display screen, control module and control switch are connected with the power supply module; and the control module is connected with the display screen and the solenoid valve, respectively.
US09357901B2
A system for graphically visualizing an orientation of a steerable distal portion of an elongate instrument is disclosed. The system includes an instrument having an elongate body. The elongate body includes a proximal portion and a steerable distal portion. The system also includes at least one tensioning member attached to said steerable distal portion, wherein the actuation of said at least one tensioning member results in an approximate y-bend and an approximate x-bend of said steerable distal portion, and wherein said approximate y-bend and approximate x-bend define an approximate overall bend of said steerable distal portion. The system further includes a graphical user interface and an icon representing said approximate overall bend on said graphical user interface.
US09357899B2
Support structures for dishwashers are disclosed. An example dishwasher for treating dishes according to a cycle of operation includes a tub defining a treating chamber with an opening, a frame coupled to and structurally supporting at least a portion of the tub, a dish rack mount coupled to the frame, and a dish rack coupled to the dish rack mount, wherein the weight of the dish rack is substantially borne by the frame.
US09357896B2
It is an object of the present invention to provide effective technique for a higher cleaning effect and higher operability of a cleaning element. According to the representative cleaning element 110, a distance d1 between adjacent ones of the fusion bonded parts 114 is longer than a length d2 or d3 formed on both of the pair adjacent fusion bonded parts 114 and 116 in the respective longitudinal end regions of the cleaning element 110.
US09357890B2
An environmentally-friendly portable toilet that is waterless, odorless and cost efficient, that uses a continuous bag supply having a predetermined single dose or portion of at least one chemical automatically deposited therein, the at least one chemical functional to kill pathogens in waste that is deposited through an opening in the seat and a corresponding opening of the continuous bag supply; the waste-filled continuous bag supply is at least temporarily sealed by activation of a mechanical sealing mechanism, and released downwardly into a base section, which is connected to a hard plastic sitting unit, forming an integral, closed system for waterless sanitation.
US09357885B2
A bathing vessel includes a base support having a base board that extends between a top, a bottom, first and second side edges, and first and second ends. Two legs are attached on the bottom of the base board, inboard from the respective first and second side edges. The base board is at least partially encapsulated in a polyurethane material.
US09357875B1
Disclosed herein is a combination outdoor cooking and firewood support apparatus having a frusto-conical frame designed to support firewood in a substantially upright orientation along a periphery of the frame in a manner such that the firewood lean toward the center of the frame. A cooking grate can be positioned on the upper end of the frame over the interior area so that food can be cooked over heat generated by the leftover coal from the burnt firewood that fell into the interior area of the frame. The apparatus can be collapsed into a flattened configuration when some of the arms are detached from at least one of the frame members while other arms remain attached to the frame members.
US09357871B2
The present invention relates to a coffee machine for producing and dispensing coffee-based beverages comprising a hydraulic pump (35), at least one dispensing device (13) comprising a filter unit (31) apt to contain ground coffee and a supply unit (14) apt to supply water to the filter unit when the filter unit is engaged with the supply unit and a hydraulic circuit which brings the hydraulic pump into fluid communication with the supply unit of the dispensing device, the hydraulic circuit comprising a supply duct (11) which supplies hot water under pressure to the supply unit, characterized in that it further comprises a system for controlling the dispensing pressure which comprises a control unit (22), a pressure sensor (21) disposed along the hydraulic circuit and apt to generate a control signal representative of the pressure detected, the pressure sensor being electronically connected to a control unit to detect the dispensing pressure, and a hydraulic variable-flow valve (36) disposed along the hydraulic circuit and apt to supply variable quantities of water to at least one dispensing device, the variable-flow valve being actuated by an electronic drive controlled electronically by the control unit in order to regulate the flow rate of water output as a function of a detected dispensing pressure value.The invention relates, moreover, to a method for controlling the dispensing pressure in a coffee machine.
US09357869B2
The present invention relates to a masticating separator for separating fruit or vegetable juice from fruit or vegetable pulp. The masticating separator comprises a housing (21), an inner wall (43) in the housing (21), an auger (22,71) rotatably mounted in the housing (21), a cavity (46) defined between an outer surface (39,86) of the auger (22,71) and the inner wall (43) to receive pulp and juice, and a juice passageway (44) separated from the cavity (46). An elongate aperture (52) is formed in the inner wall (43) extending between the cavity (46) and the juice passageway (44). Therefore, when the auger (22,71) is rotated about its longitudinal axis to urge pulp and juice along the cavity (46), juice in the cavity (46) is urged to flow through the aperture (52) to the juice passageway (44).
US09357854B2
A juvenile walker includes a seat supported for movement on a movable base. The elevation of the seat can be changed by a caregiver.
US09357842B2
A folding worktable including a frame and a board is disclosed. The frame has a pair of long borders, a pair of short borders and a number of support bars connected between the long borders. The board is locked on the frame. The worktable has four legs with telescopic units and four retractable folding braces for folding the legs. Each pair of retractable folding braces is connected to a different support bar. There are four casters on the four corners under the frame. When the retractable folding braces are folded and the legs are stored within the frame, the casters touch the ground. The board is a double sided board including a work-board and an anti-skid board which are fixed together. The worktable can also be used as a scaffold, a carrier and a repair skateboard.
US09357840B2
A shelving apparatus includes a frame structure formed with vertical members and horizontal members and a shelf adjustable between positions and supported, at each position, by the vertical members. The vertical members and horizontal members define a volume therebetween, and each of the vertical members include notches formed on a vertical surface of the vertical member. The shelf includes a frame; a product surface coupled with the frame; a first rod coupled to the frame and insertable into at least a portion of a respective notch of one of the vertical members; and a second rod coupled to the frame and insertable into at least a portion of a respective notch of another of the vertical members. The second rod is forcibly biased, by a biasing member coupled with the frame, against at least one of the vertical members.
US09357834B2
A cosmetic applicator brush having a twisted wire core and an array of thermoplastic bristles with free tips extending radially outwardly from the core, wherein at least some of the bristles have shapes and/or surface textures modified at one or more localities between their free tips and the core by selective irradiation of the aforesaid locality or localities with laser energy. A method of making the brush includes the steps of assembling the core and bristles to form a brush, trimming the bristles to achieve a desired brush profile, and selectively irradiating at least some of the bristles with a laser beam at localities between the bristle tips and the core.
US09357827B2
A mascara device includes a housing. The housing includes a first mascara-carrying chamber and a second mascara-carrying chamber. A first mascara applicator is removably carried by the housing within the first mascara-carrying chamber. The first mascara applicator includes a first applicator tip that is adapted to apply mascara to eyelashes of a wearer. The first applicator tip includes a circular cross-sectional outer perimeter shape. A second mascara applicator is removably carried by the housing within the second mascara-carrying chamber. The second mascara applicator includes a second applicator tip that is adapted to apply mascara to the eyelashes of the wearer. The second applicator tip includes a semi-circular cross-sectional outer perimeter shape.
US09357825B2
A nail printing device recognizes, as a first nail contour, a nail contour from a first nail image obtained by photographing a nail of a specific finger/toe, displays the first nail contour on the basis of data of the first nail contour stored in a storage section, and performs an adjustment of the first nail contour on the basis of an adjustment portion specified to the first nail contour and obtains an adjusted nail contour. After that the device recognizes, as a second nail contour, a nail contour from a second nail image obtained by photographing the nail of the specific finger/toe, reflects the adjustment performed to the first nail contour, in the second nail contour, obtains an adjusted recognized nail contour, and controls a print head to perform printing in a region of the adjusted recognized nail contour.
US09357820B2
A foldable chair includes a support unit, a fold unit and a seat unit. The support unit includes a main stick having a positioning groove. The fold unit includes a connecting member connected to the main stick and an upper slider assembly movable along the main stick. The seat unit is connected to the upper slider assembly. The upper slider assembly is operable to engage the positioning groove for preventing the fold unit from converting between an unfolded state and a folded state, and to be disengaged from the positioning groove so as to permit the fold unit to convert between the unfolded and folded states.
US09357815B2
A surface fastener member includes left and right longitudinal protective wall sections and front and rear lateral protective wall sections. Each of the lateral protective wall sections includes an outer first lateral wall section and an inner second lateral wall section. The first lateral wall section includes a continuous lateral wall body which is continuously placed between the left and right longitudinal protective wall sections at a predetermined height. The second lateral wall section includes a plurality of divided lateral wall bodies which are intermittently placed along a width direction, and a plurality of second engagement elements. According to this, when the molded surface fastener is integrally molded on a cushion body, it is possible to prevent resin material from entering an engagement element region of the surface fastener member.
US09357808B2
Disclosed is a cap shaping and forming insert device having a U-shaped structure that is placed in the front interior sweatband portion of a billed cap to prevent collapse and deformation thereof. The cap insert comprises a structure having at least two opposing vertically oriented arm members perpendicular to an elongated member disposed thereinbetween. The elongated member remains along the sweatband portion of the cap while the vertical arm members extend upward and into the interior crown of the cap. The cap insert is flexible and yet maintains a user-formed shape that can be used to maintain a desired shape of a billed cap once deployed therein. Moreover, a billed cap can be worn simultaneously with the cap insert therein. The cap insert can be washed and dried using standard methods while the cap insert is disposed therein in order to further preserve the structural integrity of the billed cap.
US09357803B2
An apparatus configured to heat smokable material to volatilize at least one component of the smokable material, wherein the apparatus comprises a region insulation having a core region which is evacuated to a lower pressure than an exterior of the insulation.
US09357793B2
A method for slicing pita chips in a conveyorized system is provided that includes transporting whole pita chips on a first conveyor belt from a first location of the conveyorized system to a second location of the conveyorized system and a third location of the conveyorized system, wherein transporting the whole pita chips from the second location of the conveyorized system to the third location of the conveyorized system, the whole pita chips are disposed in a gap between the first conveyor belt and a second conveyor belt, the first conveyor belt is below the whole pita chips and the second conveyor belt is above the whole pita chips, and slicing the whole pita chips into two halves at the third location of the conveyorized system by a slicing means, the slicing means including a blade and a blade guide.
US09357789B2
In a method for mechanically removing intermuscular bones, so-called pin bones, from fillet parts of conveyed fish abdominal flaps for each fish are separated using a continuous, curved double separating cut. Each abdominal flap is simultaneously separated into two parallelly cut, completely free-moving parts having fish skin, which are conveyed away separate front one another. The first part is obtained as a narrow, curved pinbone strip, with a width corresponding to the row of pinbones and limited thereto. The second part is obtained as an abdominal flap meat body determined by the largest part of the separated abdominal flap, free of pin bones, with a cutting length having the curvature. An apparatus for performing the double separating cut of the abdominal flaps is formed by an abdominal flap cutting device which comprises two pairs of cutting tools which cut simultaneously for complete separation of the abdominal flaps, each said pair being designed to perform the double separating cut of the abdominal flaps. A guiding device has a guide which is height-adjustable in a height corresponding to the flank-side height of the fish. The guiding device holds the pairs of cutting tools, aligns them, and guides them to perform the curved double separating cut. The cutting tools of the pair of cutting tools are arranged with a distance which is adapted to the narrow width of the pinbone strip and corresponds to it.
US09357784B2
The present invention relates to a method for physical plant treatment by means of electrostatic charge, wherein a transfer of the electrostatic charge takes place via water treated by way of an influence process, wherein the water comprises water clusters having an electron deficit due to the treatment by means of an influence process, wherein the water treated by means of an influence process can be obtained by the following process steps: Introducing the water to be treated into a galvanic element, Aligning the charges and free electrons in the electric field, Separating the charges by motion and by the influence resulting therefrom and Collecting and discharging the de-electronized positively-charged fraction. The method for physical plant treatment allows comprehensive and effective control of fungal diseases, simultaneously avoiding toxicological impact on the environment.
US09357783B2
A method for inhibiting hatching of an ectoparasite egg, the method comprising exposing the ectoparasite egg to at least one metal chelating agent and/or metalloprotease inhibitor, wherein the metal chelating agent is a compound comprising at least two heteroatoms able to simultaneously coordinate with a metal ion, at least one of the two heteroatoms being selected from nitrogen, sulfur, oxygen and phosphorus, wherein the compound comprises at least one carbocyclic ring substituted with at least one heteroatom and/or with a substituent containing at least one heteroatom, or the compound comprises at least one heterocyclic ring containing at least one heteroatom, wherein said heterocyclic ring is optionally substituted with at least one heteroatom and/or with a substituent containing at least one heteroatom is provided. Methods of treating ectoparasite infestations and compositions for use in such methods are also provided.
US09357775B2
Methods for forming rosin-derived cationic compounds are provided. The method can include attaching a cationic group to a conjugated diene on a hydrophenathrene-based ring of a resin acid (e.g., levopimaric acid, abietic acid, dehydroabietic acid, or a mixture thereof) to form a rosin-derived cationic compound. Attaching the cationic group to the conjugated diene on the hydrophenathrene-based ring of the resin acid can be achieved via a Diels-Alder reaction of a dienophile with the hydrophenathrene-based ring of the resin acid. Rosin-derived cationic compounds are also provided. The rosin-derived cationic compound can include a cationic group attached to a conjugated diene on a hydrophenathrene-based ring of a resin acid, wherein the rosin-derived cationic compound further comprises a carboxylic acid group.
US09357771B2
Foaming formulations including a quaternary ammonium compound and a foam stabilizer are disclosed. These foaming formulations are useful as leave-on liquid hand and surface sanitizers. The foaming formulations provide improved aesthetic properties and foaming appearance, while maintaining high antimicrobial capacity.
US09357770B2
A composition is provided to apply to the skin, hair, or external mucosa of a human or animal, and a method for using the composition. The composition includes for example a composition for application to skin, hair or external mucosa comprising: a) dispersed submicron particles of hydrophobic agent(s) having average particle size from 100 nm to 999 nm; b) an aqueous-solvent fluid; and c) rheological modifying agent(s); wherein the aqueous-solvent fluid is 10% to 95% wt. of one or more water miscible solvent(s), 4.99% to 89.99% wt. water, and 0.01% to 10% wt. of the rheological modifying agent(s); and wherein the hydrophobic agents comprise 0.01 to 70% wt. of the skin, hair or mucosal composition; and wherein the composition is substantially surfactant-free.
US09357769B2
A polyacrylamide based agricultural composition as a microemulsion is provided in form of a water-in-oil microemulsion with polyacrylamide dissolved in the water phase where the polyacrylamide solids content is from about two up to about 15 percent by weight, which is then further diluted in water at the time of use to impart the desired characteristics of the polymer to the water phase or to the material to which the water phase is applied.
US09357763B2
A container includes an inner bag, where the interior of the inner bag includes a sterile environment for storing a material, at least one access port configured to provide fluid access to the interior of the inner bag, an overwrap bag, where the interior of the overwrap bag includes a sterile environment for storing the material and where the inner bag is enclosed within the interior of the overwrap bag, and an overwrap access port configured to provide fluid access to the interior of the overwrap bag. The material can include a biomaterial. Each of the inner bag, the overwrap bag, the at least one access port, and the overwrap access port can include a fluoropolymer such as fluoroethylenepropylene (FEP).
US09357754B2
The present invention relates to a transgenic pig that expresses sTNFR1-Fc, wherein a gene encoding sTNFR1-Fc, which is a fusion protein of the extracellular domain of human soluble tumor necrosis factor receptor (sTNFR1) and an immunoglobulin Fc region, is introduced; a method for preparing the same; an organ isolated from the transgenic pig; a somatic donor cell line inserted with sTNFR1-Fc gene; a method for preparing a blood sample comprising sTNFR1-Fc; and a method for preparing human sTNFR1-Fc from the blood sample of the transgenic pig. As the transgenic pig can suppress immune response and inflammatory response by secreting an inhibitory substance that suppresses the activity of TNF-α in blood, it can be effectively used for xenograft. Furthermore, since the transgenic pig has a blood type O, it can be transplanted for suppressing inflammatory response, regardless of a blood type of recipient.
US09357752B2
A tray for positioning in an exit path of a bee hive comprises a base, a bee entrance end, and a bee exit end. Spaced apart side walls extend upwardly from the base. The sidewalls extend generally lengthwise between the bee entrance end and bee exit end. A plurality of posts extend upwardly from the base and are positioned between the bee entrance end and the bee exit end. The posts are generally circular in cross-section. The posts act as obstacles around which the bees must walk to reach the bee exit end from the bee entrance end.
US09357744B2
In certain embodiments, a system comprises a milk collecting system, a teat cup holder, and a cleansing hose system. The milk collecting system comprises a teat cup, a milk collector, and a milking hose system connecting the teat cup to the milk collector. The teat cup holder stores the teat cup of the milk collecting system such that a nozzle of the teat cup holder substantially aligns with an opening of the teat cup. The cleansing hose system connects the nozzle of the teat cup holder to one or more cleanser sources and operable to backwash at least a portion of the milk collecting system by injecting a cleanser from one or more of the cleanser sources through the nozzle and into the teat cup.
US09357742B2
The invention provides seed and plants of the lettuce line designated SV7772LG. The invention thus relates to the plants, seeds and tissue cultures of lettuce line SV7772LG, and to methods for producing a lettuce plant produced by crossing a plant of lettuce line SV7772LG with itself or with another lettuce plant, such as a plant of another line. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant of lettuce line SV7772LG, including the gametes of such plants.
US09357736B1
A soybean cultivar designated S140158 is disclosed. The invention relates to the seeds of soybean cultivar S140158, to the plants of soybean cultivar S140158, to the plant parts of soybean cultivar S140158, and to methods for producing progeny of soybean cultivar S140158. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar S140158. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar S140158, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar S140158 with another soybean cultivar.
US09357733B2
A novel maize variety designated X03F667 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X03F667 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X03F667 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby. This invention relates to the maize variety X03F667, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X03F667. This invention further relates to methods for producing maize varieties derived from maize variety X03F667.
US09357732B2
The invention relates to the soybean variety designated 01046898. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01046898. Also provided by the invention are tissue cultures of the soybean variety 01046898 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01046898 with itself or another soybean variety and plants produced by such methods.
US09357731B2
The invention relates to the soybean variety designated 01046948. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01046948. Also provided by the invention are tissue cultures of the soybean variety 01046948 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01046948 with itself or another soybean variety and plants produced by such methods.
US09357711B2
An electrically powered gardening tool of the type which includes a speed-reduction gear mounted in place to be driven by operation of an electric motor, a crank-cam in the form of overlapped eccentric disk plates fixed to a bottom surface of the speed-reduction gear by means of connecting pins for rotation therewith, and a pair of relatively reciprocating shear blades assembled with the eccentric disk plates. In the gardening tool, an elastic bushing is disposed in a mounting hole formed in the speed-reduction gear or each eccentric disk plate of the crank-cam for engagement with the connecting pins fixed to the eccentric disk plate or the speed-reduction gear, and a stopper is provided to restrict deformation of the elastic bushing caused by load applied to the crank-cam.
US09357706B2
A harvesting header and feederhouse for use with a crop harvesting machine has a feederhouse interface at a distal end of the feederhouse and a header frame providing structural support for the harvesting header. The header frame has a top beam, a bottom beam, and first and second vertical main structures connecting the top and bottom beams. The feederhouse interface and the vertical main structures of the header frame are pivotably connected to enable the header frame to pivot with respect to the feederhouse interface.
US09357687B2
A soil aerating apparatus movable along a soil surface in a first direction during soil aerating operations comprises a frame assembly and a plurality of reciprocating arm assemblies. Each arm assembly comprises a tine holder for retaining a tine, an upper arm pivotally attached between the tine holder and the frame assembly, a lower arm pivot attached between the tine holder and the frame assembly, wherein the lower arm is positioned below the upper arm, and a drive arm pivotally attached between a crankshaft and the lower arm. In an embodiment the crankshaft comprises a plurality of central shaft sections and a plurality of eccentric shaft sections, wherein each eccentric shaft section moves in the first direction when each eccentric shaft section is positioned above the plurality of central shaft sections during soil aerating operations.
US09363931B2
A carrier for a display module, in particular for an LED display module, having an arrangement for accommodating and/or fastening a display module, and having an air inlet opening and at least one air outlet opening, connected to one another by air ducts through which cooling air can flow to cool the display module, the carrier having a central air inlet opening that is connected via air ducts to at least two air outlet openings situated at different locations of the carrier, and the air ducts being fashioned between ribs provided on the carrier. Also described is a display device having such a carrier, and a display module carried thereby.
US09363928B2
A module-type data center includes: a casing including a first intake opening, a second intake opening, and an exhaust opening; an air conditioner provided in the casing and configured to generate a first airflow by taking in outside air through the first intake opening and bringing the outside air into direct contact with a refrigerant; a fan unit provided in the casing and configured to generate a second airflow by taking in the outside air through the second intake opening; and an electronic device provided in the casing and configured to be air-cooled by a mixed airflow of the first airflow and the second airflow and release an exhaust airflow after the air-cooling to the exhaust opening. The first intake opening and the second intake opening are provided on different surfaces of the casing.
US09363924B2
Cooling methods are provided which include providing a heat sink having a housing with a compartment, a coolant inlet, and a coolant outlet. The housing is configured for a coolant to flow from the coolant inlet through the compartment to the coolant outlet, wherein the coolant is transferring heat extracted from one or more electronic components. The heat sink further includes one or more heat pipes having a first portion disposed within the compartment of the housing and a second portion disposed outside the housing. The heat pipe(s) is configured to extract heat from the coolant flowing through the compartment, and to transfer the extracted heat to the second portion disposed outside the housing. The second portion outside the housing is disposed to facilitate conducting the extracted heat into the ground.
US09363922B2
A filler panel/horizontal manager for a rack includes two latching regions that mirror each other. The latching regions include a pair of guide posts configured to enter both round-shaped and square-shaped holes and guide the filler panel into a rack. The latching region further includes a pair of locator walls configured to enter square shaped holes along with the guide posts to guide the filler panel into a rack. Each latching region includes one or more latching members having surfaces for engaging a railing of a rack. At least one pair of latching members includes an angled stepped surface configured to engage railings of different thicknesses. One or more outwardly extending cable management elements may be associated with a front face of the filler panel/horizontal manager to facilitate wire/cable management functionalities.
US09363920B1
A server includes bracket and tray. The bracket is detachably installed on guiding rails of a case. The bracket includes two side frames and two synchronous plates. The two side frames is installed on the two guiding rails of the case which are facing each other, respectively. The synchronous plates having a limiting surface are slidably installed on the front parts of the two side frames, respectively. Each of the synchronous plates has a fixing position and a free position. The tray includes a body and two limiting bars which are installed on two sides of the body which are opposite to each other, respectively. The limiting bars face the synchronous plates, respectively. When the tray is pulled out of the case, the fixing bars are stopped by the limiting surfaces, respectively, so that the tray and the bracket are pulled out of the case together.
US09363915B1
A system and method for building an electronic system with line-replaceable units (LRUs) is presented. The system includes a first LRU electronic module with a first connector on a side of the first LRU electronic module and a second LRU electronic module with a second connector on a side of the second LRU electronic module. To build the electronic system, the first connector on the first LRU electronic module is connected to the connector on the second LRU electronic module to form a first LRU electronic module and a second LRU electronic module combination with the first connector and the second connector interior to the module combination formed by the first LRU electronic module and the second LRU electronic module. The first connector and the second connector cannot be seen from outside the module combination formed by the first LRU electronic module and the second LRU electronic module.
US09363909B2
The present invention provides a positioning and adjusting device of the monitor, comprising a supporting frame, the main body of the monitor is installed on a supporting frame in an inclined way, the rear seat is hinged to the upper end of the supporting frame, the display panel is in sliding connection with the rear seat; a convex part is disposed on the backside and extended into the inner cavity of the rear seat, a convex pin is disposed next to the side of the convex part, and a hook is set on the inner cavity of the rear seat that makes the display panel in a downward positioning status, when the convex pin is moving upward along the display panel. The device can adjust the vertical position of the display panel and adjust the tilt angle of the display panel to meet the watching needs of consumers.
US09363905B2
This is directed to providing a cosmetic finish on a component constructed by connecting several elements. A single manufacturing process, such as machining or grinding, can be applied to the connected elements to remove material from some or all of the elements and to form a smooth and continuous surface across interfaces between the individual elements of the component. In some cases, settings of the material removal process can be adjusted based on the material of the component elements. For example, the settings can be adjusted based on the manufacturing or mechanical properties of each element material.
US09363891B2
A printed wiring board includes a resin insulation layer having a first surface and a second surface on an opposite side of the first surface, the resin insulation layer having an opening for a via conductor, a pad formed on the first surface of the resin insulation layer and provided to mount an electronic component, a conductive circuit formed on the second surface of the resin insulation layer, and a via conductor formed in the opening and connecting the pad and the conductive circuit. The pad has an embedded portion embedded in the resin insulation layer and a protruding portion protruding from the resin insulation layer, and the embedded portion has an external shape which is greater than an external shape the protruding portion.
US09363884B2
A composite material and an electronic device are disclosed in embodiments of the present invention, relating to the field of electronic assembly technologies. The technical problem of the existing electronic device with an excessively complicated internal structure is solved. The composite material includes an electrically and thermally conductive layer, a viscose glue layer, and an insulating layer, where the electrically and thermally conductive layer and the insulating layer are pasted at two sides of the viscose glue layer; the viscose glue layer is electrically conductive. The electronic device includes a circuit board and the composite material. Gaps are formed at the insulating layer in positions corresponding to electronic components and/or shielding frames, with the viscose glue layer exposed, the composite material is pasted onto the electronic components and/or the shielding frames via the viscose glue layer. The present invention is applied to simplify the structure of an electronic device.
US09363881B2
A plasma device includes a dielectric barrier, a first electrode structure, a second electrode structure, and a third electrode structure. The dielectric barrier has an upstream terminal and a downstream terminal and defines a space, in which the first electrode structure is disposed. A gap with multiple widths is formed between the first electrode structure and the dielectric barrier. The dielectric barrier is located between the first electrode structure and the second electrode structure. The second electrode structure includes electrode blocks sequentially arranged from the upstream terminal to the downstream terminal. The dielectric barrier, the first electrode structure, and the second electrode structure are located on the same side of the third electrode structure located at the downstream terminal. A minimum distance between the electrode blocks and the third electrode structure is not less than a distance between the first electrode structure and the third electrode structure.
US09363869B2
A method of eliminating interference at an optical sensor of a mobile device that receives light from multiple light sources. The mobile device includes an optical navigation module having a cover and an illumination device disposed around the periphery of the cover. The optical navigation module includes an optical sensor that detects light reflected from an object contacting the cover. A processor receives electrical signals from the optical sensor and interprets movement of the object. The method reduces interference between the light source of the optical navigation module and the light source of the illumination device by controlling emission of light rays from each light source. The emission of light rays may be controlled based on timing, frequency and/or coding domains.
US09363868B1
A lighting control console for controlling a lighting system has at least one dual encoder for entering input values. The dual encoder includes a first shaft rotatably mounted in a housing and a first locking mechanism, for locking different rotational positions of the first shaft, and at least one first rotation signal generator for generating a data signal showing a switchover between two locking positions. A second shaft is mounted in the housing and is coaxially rotatable with respect to the first shaft. The second shaft is provided at the dual encoder, and a second locking mechanism for locking different rotational positions of the second shaft and at least one second rotation signal generator for generating a data signal showing a switchover between two locking positions. A method for entering data, more precisely input values, at the lighting control console is also disclosed.
US09363849B2
A wireless device includes: a first radio and first transceiver configured to transmit and receive according to a first radio access technology; a second radio and second transceiver configured to transmit and receive according to a second radio access technology; a first antenna and a second antenna connected to the first radio and the second radio; a switch; and a control unit configured to control the switch to configure connections of the first and second antennas to the first and second radios. The control unit is configured to control the switch to disconnect the second radio from the second antenna in response to a receiving, by the second radio through the second antenna, a signal that is below a predetermined threshold, and to connect the second radio to the first antenna during a wakeup period of the second radio.
US09363845B1
Disclosed herein are systems and methods for carrier aggregation and fast network-switching with a single-baseband modem, carrier-aggregation-capable wireless-communication device (WCD). One embodiment takes the form of a system that includes a first RF integrated circuit (RFIC), a second RFIC, a baseband processor coupled to the first and second RFICs, a first carrier-aggregation circuit, a fast-network-switching connection manager coupled to the baseband processor, and a mode controller coupled to the baseband processor and to the fast-network-switching connection manager. The mode controller is configured to selectively place the wireless-communication device in a carrier-aggregation mode or in a fast-network-switching mode. In the carrier-aggregation mode, the WCD is operable to conduct carrier aggregation using at least the first carrier-aggregation circuit. In the fast-network-switching mode, the WCD is operable to conduct fast network switching using the fast-network-switching manager.
US09363843B2
A radio communication method including: transmitting first information from a first radio station to a second radio station before determining an activation of a second logical processing entity that is to be activated in a first processing layer of the second radio station in association with a first logical processing entity that has been activated in the first processing layer of the second radio station, the first information relating to the activation of the second logical processing entity, the first information being transmitted using a first control signal in a higher layer of the first processing layer, transmitting, when determining the activation of the second logical processing entity, second information for instructing the activation from the first radio station to the second radio station, the second information being transmitted using a second control signal in the first processing layer.
US09363838B2
Disclosed is an operating method of a serving base station in wireless communication system. The method comprises obtaining delay-tolerance information with respect to user equipment, and operating based on the delay-tolerance information. The delay-tolerance information indicates whether the user equipment is a delay-tolerant user equipment (UE), which allows a service delay. Provided is a delay-tolerance information-based operating method of user equipment in a wireless communication system. The method comprises generating delay-tolerance information and transmitting delay-tolerance information to a network. The delay-tolerance information indicates whether the user equipment is a delay-tolerant user equipment (UE), which allows a service delay. The network is operated based on the delay-tolerance information.
US09363837B2
A method for operating an IP Multimedia Subsystem Application Server to facilitate a communication session between a first user and a second user at a required Quality of Service (QoS) is provided. The method calls for receiving a notification that a Policy and Charging Rules function (PCRF) associated with the first user has not authorized the required QoS. The notification includes an indication of additional QoS required by the first user in order to achieve the required QoS. Authorization for the additional QoS for the first user is then requested from a PCRF associated with the second user. The method then calls for receiving a notification that the PCRF associated with the second user has authorized the additional QoS, and notifying the PCRF associated with the first user that the additional QoS has been authorized for the first user.
US09363828B2
According to one embodiment, a method of requesting a random access connection between a mobile terminal and a base station includes: receiving, by the mobile terminal, information comprising at least one signature root sequence index, a cyclic shift parameter, and a number of signatures used for representing a boundary between a first signature set and a second signature set; preparing, by the mobile terminal, random access signatures according to the at least one signature root sequence index and the cyclic shift parameter, wherein at least one of the random access signatures is associated with the first signature set and the remaining of the random access signatures are associated with the second signature set; and selecting, by the mobile terminal, a random access preamble from the first signature set or the second signature set based on a message size and a radio condition.
US09363827B2
The present invention addresses a method, apparatus and computer program product for vehicle gateway access in cellular network for vehicle communications. A dedicated Vehicle gateway random preamble is defined to serve the vehicle gateway access to the network in order to resolve the contention during the initial access and thus decrease access latency. In addition to that, a new cause value Vehicle gateway originated data/signaling for the RRC connection establishment request is defined to inform the network that the coming data traffic is from the vehicle communication.
US09363825B2
An indication map delivery method, an indication operation method, a device, and a system are provided. In the embodiments of the present invention, a compressed Indication Map (IM) generated by a wireless access device includes at least one of a tiny partial bitmap sub-element, a skipped indication bits sub-element, and an indication bit offset sub-element, and consecutive indication bits with the same value at positions in an original IM can be compressed into a skipped indication bits sub-element, an indication bit offset sub-element, or the like. The technical solutions of the embodiments of the present invention facilitate improvement of compression efficiency of an IM, and further reduce radio air interface resources occupied for sending the IM and improve IM sending efficiency.
US09363823B2
The present invention discloses a system and method for managing resources in a heterogeneous network, which includes a primary system and a secondary system and a communication coverage range of which is divided into a plurality of regions, the system including: a heterogeneous network resource management module configured to collect and manage resource usage status within a managed region; and a secondary system resource management module configured to acquire the resource usage status of each region from the heterogeneous network resource management module and to allocate resources to the secondary system by utilizing the acquired resource usage status of each region in accordance with a priority determined based on an efficiency of resource multiplexing between each region and the secondary system. According to the technical solution of the invention, the resource usage efficiency can be improved greatly.
US09363801B2
Hybrid Automatic Retransmit ReQuest-Acknowledgment (HARQ-ACK) index mapping and uplink resource allocation is performed and controlled for channel selection transmission. A method for transmitting HARQ-ACK information to an eNode-B (eNB) by a User Equipment (UE) includes identifying KPCell as a number of downlink subframe(s) of a Pcell associated with an uplink subframe and identifying KSCell as a number of downlink subframe(s) of an Scell associated with the uplink subframe; generating Discontinuous Transmission (DTX) response information for a cell having a smaller number of downlink subframes between the Pcell and the Scell; generating HARQ-ACK information including the generated DTX response information and response information on data received by the UE from the eNB; and transmitting the generated HARQ-ACK information to the eNB through the uplink subframe.
US09363800B2
The present invention discloses a method for determining a Physical Uplink Control Channel PUCCH resource for a user equipment and a corresponding user equipment, and a method for facilitating the determination of a PUCCH resource for a user equipment and a corresponding base station, wherein the PUCCH resource is used to transmit a Hybrid Automatic Repeat Request HARQ feed back (ACK or NACK) of the user equipment with respect to its corresponding Physical Downlink Shared Channel PDSCH. In the present invention, an index value for a Control Channel Element CCE scheduled for the user equipment in an Enhanced Physical Downlink Control Channel E-PDCCH is firstly acquired, and then based on the index value and a first parameter, the PUCCH resource used to transmit the HARQ feedback of the user equipment with respect to its corresponding PDSCH is determined, the first parameter representing a reference value that should be used when determining the PUCCH resource used to transmit the HARQ feedback of the user equipment with respect to its corresponding PDSCH, if scheduling the CCE for the user equipment in the E-PDCCH.
US09363799B2
The present invention relates to a method and apparatus for determining whether or not to transmit an uplink control signal in a first subframe according to whether or not a subframe (the first frame) corresponding to a transmission time of the uplink control signal is within an active time, or whether or not the first subframe is one of a constant number of subframes after the last subframe of the active time, and the active time is a time for the reception of resource allocation information for data retransmission.
US09363782B2
The described aspects include methods and apparatus for performing positioning for a user equipment (UE). The UE can communicate with a plurality of serving cells in a multicarrier configuration, and can indicate a plurality of serving cell identifiers corresponding to the plurality of serving cells in a message to a positioning server. The positioning server can obtain location information corresponding to at least a portion of a plurality of cells, or related eNBs, related to the plurality of serving cell identifiers, and can communicate the location information to the UE. The UE can perform positioning based at least in part on the location information.
US09363780B2
An apparatus may include a transceiver operable to receive a downlink message from a base station for a serving cell, the downlink message allocating a set of control parameters. The apparatus may also include a processor circuit communicatively coupled to the transceiver and an uplink power control module operable on the processor circuit to read the set of control parameters, and apply a signal-to-noise-and-interference (SINR) parameter based on the received set of control parameters to determine physical uplink shared channel (PUSCH) power to be applied for a PUSCH transmission. Other embodiments are disclosed and claimed.
US09363769B2
Certain aspects of the present disclosure relate to techniques for scaling transmission power. According to certain aspects, a technique for scaling transmission power may include scaling transmission power of one or more uplink channel symbols to be transmitted in a subframe, utilizing a first set of one or more scaling coefficients, scaling transmission power of one or more sounding reference signal (SRS) symbols to be transmitted in the same subframe, utilizing a second set of one or more scaling coefficients, wherein the first set of scaling coefficients is different from the second set of scaling coefficients, and transmitting the scaled one or more uplink channel symbols and the scaled one or more SRS symbols utilizing the scaled transmission power values.
US09363764B2
Devices and methods are provided for providing wireless coverage redundancy in case, for example, the backhaul of an access point (AP) base station is not available. In one embodiment, the method involves monitoring the backhaul, and in response to the backhaul being available, facilitating communication between an access terminal (AT) and the macro network via the backhaul. In addition, or in the alternative (e.g., when the backhaul is not available), a communication signal between the AT and a macro base station (or another AP base station) may be boosted.
US09363762B2
The present invention provides methods and devices for determining a transmission power and relates to the field of communication technologies. A method includes receiving, by a power determining device, capacity information of a first cell sent by a serving base station of the first cell and determining a transmission power used by a serving base station of the second cell on the specific resource of the second cell according to the capacity information of the first cell. The aforementioned method allows the capacity of the first cell to be guaranteed.
US09363755B2
Various aspects of apparatus for accessing a network through a wireless access point and methods of power savings for such apparatus include autonomously alternating between a listen state and the sleep state during a time period in which no data is detected from the remote apparatus, and progressively increase the sleep state interval during the time period for at least a portion of the time period.
US09363752B2
Certain aspects of the present disclosure provide methods and apparatus for generating a frame with timing information for a target wake time (TWT) and an identification of the TWT. An example method generally includes generating a frame generating a frame comprising timing information for a target wake time (TWT) and an identification of the TWT to which the timing information applies, and outputting the frame for transmission.
US09363747B2
A connection management resource receives performance information indicating bandwidth availability associated with multiple wireless access points in a wireless network. The connection management resource analyzes the performance information to identify an ability of each of the multiple wireless access points in the wireless network to provide a prospective new user access to a remote network. Based on the analysis of the performance information, the connection management resource produces a notification indicating the ability of each of the multiple access points to provide wireless bandwidth to the prospective new user to access the remote network. Via the notification, the prospective new user of a wireless access point is able to determine what to expect for bandwidth after establishing a respective link with the wireless access point.
US09363745B2
Systems and methodologies are described that facilitate device-side access point list management. Blacklists of access points unsuitable for providing network access to a related mobile device can be maintained as well as whitelists of suitable access points. The lists can be managed using an interface provided at the mobile device. In addition, lists can be modified according to provisioned network updates. Also, the lists can be of maximum size such that older entries can be purged upon insertion of newer entries based on a number of factors; timed entry deletion is provided as well. Access points in the lists can be stored and presented according to various identifiers related to the access points.
US09363735B2
Disclosed are a device and a method for providing simultaneous data transmission service based on heterogeneous networks. A transmission device of system for simultaneous data transmission service system is configured to (i) divide data into two or more partial data, (ii) insert virtual network access information into each of the divided two or more partial data, and (iii) then transmit the divided two or more partial data to a reception device over two or more networks in a heterogeneous network. When a problem occurrence is identified in a first network of the two or more networks, the transmission device is configured to switch the first network to another second network of the two or more networks to transmit the divided two or more partial data intended to be transmitted over the first network.
US09363733B2
In embodiments of mesh network commissioning, a commissioning device establishes a secure commissioning communication session between the commissioning device and a border router of a mesh network to securely establish network communication sessions for joining one or more joining devices to the mesh network. The commissioning device can activate joining for the mesh network, and receive a request from a joining device to join the mesh network. The commissioning device can establish a secure joiner communication session between the commissioning device and the joining device, authenticate the joining device using an encrypted device identifier, and join the joining device to the mesh network.
US09363730B2
A method and apparatus for improving a mobile problem caused by a narrow handover region in a boundary region between virtual cells constructed by a plurality of small base stations are provided. A plurality of Virtual Cells (VCs) include a plurality of Distributed Base Stations (DBSs) whose VCs cooperatively communicate with each other. An Intermediate Distributed Base Station (I-DBS) is located in a region where adjacent at least two VCs among the plurality of VCs are superimposed, and belongs to a different VC according to a time division scheme.
US09363721B2
An in-device coexistence interference report control method of a network for terminal to inform the network of interference among heterogeneous radio communication modules coexisting in the terminal is provided. The method includes determining, at a terminal when a terminal capability enquiry message is received from a base station, whether the base station supports an In-Device Coexistence (IDC) interference report, transmitting, when the IDC interference report is supported, a terminal capacity information message to the base station, receiving a Radio Resource Control (RRC) connection reconfiguration message including information on whether terminal's IDC interference indicator transmission is permitted from the base station; and transmitting an RRC connection reconfiguration complete message to the base station in response to the RRC connection reconfiguration message. The in-device coexistence interference indication control method is advantageous in preventing the UE from transmitting useless in-device coexistence interference indication messages, resulting in reduction of unnecessary signaling.
US09363717B2
Embodiments herein relates to a radio network node (12) for controlling a handover process of a user equipment (10) from a first cell (11) to a second cell (14). The user equipment (10) is served in the first cell configured to be controlled by the radio network node. The radio network node comprises an operating circuit configured to operate according to a handover process, which handover process is triggered by a first trigger parameter when a connection to the user equipment is active, and by a second trigger parameter when the connection to the user equipment is inactive.
US09363714B2
An architecture that can redirect communications upon detection of a handover failure in a Long Term Evolution (LTE) network is described. The architecture can obtain information indicative of a handover failure that is available in a first portion of the LTE network (e.g., a serving gateway) that has no control over the communication path. The architecture can utilize the information to instruct a second portion of the LTE network (e.g., a mobility management entity), one that can control the communication path but conventionally has no access to the handover information, to reroute the communication path to avoid unresponsive or failing network entities.
US09363709B2
A system, method, device, and computer program product for configuring a communications network for a user, including assigning a network identifier to a communications network of a user, the network identifier being unique to an instantiation of the communications network; and automatically generating a plurality of unique network configuration settings for one or more network devices of the communications network based on the network identifier.
US09363707B2
Systems, methods, and devices for communicating short control frames are described herein. In some aspects, a method of wireless communication includes generating a control frame comprising a physical layer preamble having a signal field, the signal field including an indicator indicating the control frame is a control frame type of frame. The method further includes transmitting the control frame.
US09363691B1
A wireless communication device is capable of communication with a media server over a first communication network and capable of communication with a media device over a second communication network. The wireless communication device comprises a wireless communication interface and a processing system. The processing system is configured to monitor for an application request, wherein the application request indicates an application provided by the media server for display on the media device. The processing system is further configured to determine a first bandwidth available on the first communication network and a second bandwidth available on the second communication network, and determine if the first bandwidth and the second bandwidth support the application based on the application. The wireless communication interface is configured to, if the first bandwidth and the second bandwidth support the application, receive the application from the media server and transfer the application to the media device, wherein the media device displays the application.
US09363689B2
A communications network comprises performance determination circuitry and link control circuitry. The performance determination circuitry is operable to determine performance of a microwave backhaul link between a first microwave backhaul transceiver and a second microwave backhaul transceiver. The microwave backhaul link backhauls traffic of a mobile access link. The link control circuitry is operable to, in response to an indication from the performance determination circuitry that the performance of the microwave backhaul link has degraded, adjust one or more signaling parameters used for the mobile access link. The link control circuitry is operable to, in response to the indication that the performance of the microwave backhaul link has degraded, adjust one or more signaling parameters used for the backhaul link in combination with the adjustment of the parameter(s) of the access link.
US09363688B2
Embodiments of the present invention provide a repair method for missing detection of a control channel and relate to the field of communications. The method includes detecting whether a user equipment misses detecting a physical downlink control channel. After it is detected that the user equipment misses detecting the physical downlink control channel, a repair is performed using a repair policy.
US09363687B2
According to one embodiment, a method for transmitting acknowledgement/not-acknowledgement (ACK/NACK) of a user equipment in a wireless communication system. Includes: receiving uplink-downlink (UL-DL) configuration 5 information on a plurality of subframes; receiving data in at least one subframe among the plurality of subframes; configuring ACK/NACK for the received data; and transmitting the ACK/NACK through a UL subframe.
US09363681B2
The embodiments of the present invention disclose a method for establishing a cell reselection list is provided. A network and a terminal establish frequency indexes for the cell reselection list, so that when a network side delivers an RAT and frequency priority information, the priority information may be delivered according to frequency indexes in a frequency list, thus implementing cell reselection that is based on the priority for the terminal.
US09363680B2
In order to transmit data packets in multi-RAT networks, a method and system of network controllers are provided including simultaneous establishment of radio connections over multiple different Radio Access Technologies or RATs, with User Equipment or UE 13, being one radio connection firstly established over one primary RAT under a single PDP context and one or more radio connections established over at least one secondary RAT, different from the primary RAT, and under the same single PDP context; simultaneous transmission of data packets over the different RATs towards the UE 13 and combination of the transmitted data by higher layer protocols at the UE 13. In the present method/system, a connection is established for user plane transmission on the same PDP context between a primary network controller 11 of the primary RAT and the secondary network controller 12 of a secondary RAT. More than one secondary RAT may be involved.
US09363669B2
Methods and systems for enabling activation of a wireless communication device to operate with a server on a wireless communication network. An activation request is pushed from the server to the device, the activation request being authenticated with a signature signed with a server certificate. After the device verifies the activation request using server certificate and signature, a mutually authenticated communication session is established between the device and the server for activation of the device on the server.
US09363667B2
Methods and systems for monitoring, analyzing and acting upon voice calls in communication networks. An identification system receives monitored voice calls that are conducted in a communication network. Some of the monitored voice calls may be conducted by target individuals who are predefined as suspects. In order to maintain user privacy, the system selects and retains only voice calls that are suspected of being conducted by predefined targets. The techniques disclosed herein are particularly advantageous in scenarios where the network identifiers of the terminal used by the target are not known, or where the target uses public communication devices. In accordance with the disclosure, content-based identifiers such as speaker recognition or keyword matching are used.
US09363663B2
A method, non-transitory computer readable medium and apparatus for providing a cellular communication service for any device via a communications network are disclosed. For example, the method receives a log-in request of a user from a device, if the log-in request is authenticated, synchronizes the device with a configuration associated with the user and provides the cellular communication service via a subscription plan subscribed to by the user.
US09363652B2
A method and system for reporting short message (SM) capability over an IP multimedia subsystem (IMS) using a session initiation protocol (SIP) are disclosed. A wireless transmit/receive unit (WTRU) registers with a core network and sends a message indicating its SM capability via the IMS to the core network. The core network then updates the WTRU capabilities based on the message and routes an SM to the WTRU via the IMS.
US09363641B2
Disclosed are a system and a service method for providing a digital content based on a moving path of a user. A service method may include storing and managing data in which coordinates of a map are converted to Geo-Hash coordinates according to a Geo-Hash algorithm, receiving location information from a terminal of a user, converting the location information to the Geo-Hash coordinates, and providing, to the terminal, information about digital content allocated to a Geo-Hash area including adjacent Geo-Hash coordinates based on the Geo-Hash coordinates. The terminal may be configured to determine the digital content to be provided to the terminal based on information about the digital content allocated to the Geo-Hash area and new location information of the terminal.
US09363638B1
Systems and methods for creating a database of geofences and registering geofences, with each geofence in the database being associated with an IP address, preferably an IPV6 address. Each geofence is defined using at least one geographic designator, preferably real property boundaries. Entitlements can be associated with geofences relating to permissive and prohibitive activities within the geofences.
US09363629B2
A method of obtaining a location of a user includes obtaining first location information of the user; searching a pre-stored first map for a plurality of candidate areas corresponding to the first location information; selecting at least one search area from the plurality of candidate areas corresponding to the first location information based on second location information of the user; and determining the location of the user using at least one search area.
US09363615B2
In this system, a terminal A retrieves terminal's input delay time Tia from input of an audio signal to start of transmission of the audio signal, transmission delay time Tn from the start of transmission of the audio signal to reception of the audio signal by a partner terminal B, partner's reception buffering delay time Tbfb from reception of the audio signal to output of the audio signal by a reception buffer portion BFb of the partner terminal B, and partner's output delay time Tob from input of the audio signal to output of the audio signal by an audio reproduction portion DRob of the partner terminal B. The terminal A then sums up these delay times to determine input/output delay time Ttab from the input of the audio signal by the terminal A to the output of the audio signal by the audio reproduction portion DRob of the partner terminal B.
US09363613B2
Disclosed herein, among other things, are methods and apparatus for providing an environmentally sealed hearing assistance device that is easy to manufacture. One aspect of the present subject matter includes a method of manufacturing a hearing assistance device. A hearing assistance device electrical component is placed into a mold and a liquid polymer resin is inserted into the mold. The polymer resin is cured into a solid state to encase the electrical component. In various embodiments, the hearing assistance device is assembled using the encased electrical component. The polymer resin is adapted to resist moisture ingress and to protect the electrical component from corrosion, shock and vibration, in various embodiments.
US09363611B2
A rotary sound transducer having an improved output at higher frequencies. The invention includes stiff vanes that are preferably rigidly attached to a hub. A torsional actuator is provided in each vane. The torsional actuator selectively twists the tip portion of each vane. The torsional actuator for each vane is activated by an input energy source corresponding to the sound waves that are desired. The input force may also be electromechanical energy, purely mechanical energy, or some other form of energy.
US09363609B2
Embodiments show a method for fabricating a cavity structure, a semiconductor structure, a cavity structure for a semiconductor device and a semiconductor microphone fabricated by the same. In some embodiments the method for fabricating a cavity structure comprises providing a first layer, depositing a carbon layer on the first layer, covering at least partially the carbon layer with a second layer to define the cavity structure, removing by means of dry etching the carbon layer between the first and second layer so that the cavity structure is formed.
US09363604B2
A speaker box includes a case includes an upper side and a lower side opposite to the upper side, an electroacoustic transducer received in the case and including a first pole plate with a plurality of first gaps for communicating with the magnetic gap, a second pole plate attached on a lower surface of the first pole plate. The second pole plate defines a second main member, a plurality of second auxiliary members extending from a periphery of the first main member, and a plurality of second gaps corresponding to the first gaps. Each of the second auxiliary members defines a longer auxiliary member and a shorter auxiliary member respectively.
US09363602B2
Embodiments of the subject invention relate to a method and apparatus for providing virtualized audio files. Specific embodiments relate to a method and apparatus for providing virtualized audio files to a user via in-ear speakers or headphones. A specified embodiment can provide Surround Sound virtualization with DTS Surround Sensations software. Embodiments can utilize the 2-channel audio transmitted to the headphones. In order to accommodate for the user moving the headphones in one or more directions, and/or rotating the headphones, while still allowing the user to perceive the origin of the audio remains is a fixed location, heading data regarding the position of the headphones, the angular direction of the headphones, the movement of the headphones, and/or the rotation of the headphones can be returned from the headphones to a PC or other processing device. Additional processing of the audio files can be performed utilizing all or a portion of the received data to take into account the movement of the headphones.
US09363598B1
An audio-based system may perform audio beamforming and/or sound source localization based on multiple input microphone signals. Each input microphone signal can be calibrated to a reference based on the energy of the microphone signal in comparison to an energy indicated by the reference. Specifically, respective gains may be applied to each input microphone signal, wherein each gain is calculated as a ratio of a energy reference to the energy of the input microphone signal.
US09363584B1
A non-transitory computer-readable storage medium may include instructions stored thereon that. When executed by at least one processor, the instructions may be configured to cause a computing system to at least determine which links connecting old super blocks to old spine blocks via a plurality of Optical Circuit Switches (OCSs) in a network to disconnect to accommodate at least one new super block and at least one new spine block being added to a switching network, the determining including determining a maximum of m links per OCS to disconnect, connect the old super blocks to the at least one new spine block via the OCSs associated with the links to be disconnected, and connect the at least one new super block to the old spine blocks via the OCSs associated with the links to be disconnected.
