US11746074B2

Provided is a method for preparing a diol. In the method, a saccharide and hydrogen as raw materials are contacted with a catalyst in water to prepare the diol. The employed catalyst is a composite catalyst comprised of a main catalyst and a cocatalyst, wherein the main catalyst is a water-insoluble acid-resistant alloy; and the cocatalyst is a soluble tungstate and/or soluble tungsten compound. The method uses an acid-resistant, inexpensive and stable alloy needless of a support as a main catalyst, and can guarantee a high yield of the diol in the case where the production cost is relatively low.
US11746070B2

The present disclosure provides processes to convert paraffins to corresponding olefins and or heavier hydrocarbons. In at least one embodiment, a process includes introducing, at a temperature of from about 50° C. to about 500° C., a hydrocarbon feed comprising paraffins to a first metal oxide comprising one or more group 1 to group 17 metal and one or more oxygen. The process includes obtaining a product mixture comprising one or more C3-C50 cyclic olefins, one or more C2-C50 acyclic olefins, one or more C5-C200 hydrocarbons, such as one or more C5-C100 hydrocarbons, or a mixture thereof. In at least one embodiment, the product mixture is substantially free of H2 (e.g., <500 ppm). The introducing can reduce the first metal oxide to form a second metal oxide. Processes may include introducing the second metal oxide to an oxidizing agent to form the first metal oxide.
US11746068B2

The present invention relates to methods of preparing pre-mixed compositions that can be combined to form pyrotechnic compositions. In exemplary embodiments, a binder ingredient is premixed with the pyrotechnic fuels and can also include other pyrotechnic additives and processing aides. Other binder ingredients can be premixed with the pyrotechnic oxidizers and can also include other pyrotechnic additives and processing aides. The resulting mixtures are not explosive and are therefore easier to store and much safer to handle. These pre-mixed mixtures can be stored in bulk until needed and rapidly combined to achieve final composition.
US11746067B2

The present invention comprises methods and compositions comprising a microalgae consortium. A composition comprises at least one genera of microalgae flocculated by Paenibacillus polymyxa strain, Strain 2, deposited under the Budapest Treaty as ATCC Accession No. PTA-12841. Methods of treating the soil comprise adding a composition of the present invention to soil.
US11746065B2

A method for manufacturing a part made of composite material in which an adhesion promoter is grafted to a coating present on the fibre surface as well as to a ceramic precursor resin. Afterwards, a ceramic matrix phase is formed in the porosity of the fibre preform by pyrolysis of the polymerised resin.
US11746064B2

Systems and methods for infiltrating porous ceramic matrix composite (CMC) preforms to form CMC articles are disclosed. One method may include positioning the porous CMC preform in an opening of a die set for an infiltration system, and flowing a molten densifier over the porous CMC preform in a first flow direction to infiltrate a plurality of voids formed between each of a plurality of ply stacks of the CMC preform. The method may also include flowing the molten densifier over the porous CMC preform in a second flow direction, distinct from the first flow direction, to infiltrate the plurality of voids formed between each of the plurality of ply stacks of the CMC preform. The second flow direction may be substantially parallel to a predetermined, unidirectional material orientation of at least one ply stack of the plurality of ply stacks of the CMC preform.
US11746060B2

A method for manufacturing a part made of composite material includes forming a ceramic matrix phase in pores of a fibrous preform by pyrolysis of a cross-linked copolymer ceramic precursor, the cross-linked copolymer including a first precursor macromolecular chain of a first ceramic having free carbon, and a second precursor macromolecular chain of a second ceramic having free silicon, the first macromolecular chain being bonded to the second macromolecular chain by cross-linking bridges including a bonding structure of formula *1—X—*2; in this formula, X designates boron or aluminium, -*1 designates the bond to the first macromolecular chain and -*2 the bond to the second macromolecular chain.
US11746059B2

A system and method of melt infiltrating components is provided. In one example aspect, an inductive heating system includes a heating source that inductively heats a susceptor. The susceptor defines a working chamber in which components can be received. During melt infiltration, the system can heat the susceptor and thus the components and melt infiltrants disposed within the working chamber at a first heating rate. The first heating rate can be faster than 50° C./minute. The system can then heat the components and melt infiltrants at a second heating rate. The first heating rate is faster than the second heating rate. Thereafter, the system can heat the components and infiltrants at a third heating rate. The third heating rate can be a constant rate at or above the melting point of the melt infiltrants. The infiltrants can melt and thus infiltrate into the component to densify the component.
US11746055B2

A zirconia powder is provided comprising a yttria source and zirconia, wherein a content of the yttria source is 4.5 mol % or more and 6.5 mol % or less and the remainder is zirconia, a ratio of a total of tetragonal and cubic crystals to an entire crystal phase of zirconia is 90% or less, a BET specific surface area is 7.5 m2/g or more and 15 m2/g or less, and an average crystallite size is 325 Å or greater. The powders are useful in producing sintered bodies having the mechanical strength and the translucency desired for use in dental prosthetic materials, and precursors thereof.
US11746054B2

A method for manufacturing a zirconia sintered body includes molding a powder composition that has a yttria content of more than 3% by mole and 5.2% by mole or less and that contains a first zirconia powder having a yttria content of 2% by mole or more and 4% by mole or less and a second zirconia powder having a yttria content of more than 4% by mole and 6% by mole or less to obtain a green body, and sintering the green body to obtain a sintered body.
US11746053B2

A refractory composition for forming a working lining in a metallurgical vessel contains a coarse-grain refractory particle fraction and a fine-grain refractory particle fraction, or at least 0.25% additive calcium oxide, or at least 0.25% titanium dioxide. The coarse-grain refractory particles can include alumina particles, magnesia particles, magnesium aluminate spinel particles, zirconia particles, or doloma particles, or a combination of any of these particles. The fine-grain refractory particles can be comprised of any low-magnesia refractory oxide. The refractory composition can be applied to a metallurgical vessel by spraying, gunning, shotcreting, vibrating, casting, troweling, or positioning preformed refractory shapes, or a combination of any of these techniques. When contacted by molten metal, the molten metal penetrates into the refractory material, wetting the coarse-grain refractory particles, and forming a refractory-metal composite barrier layer that decreases or blocks oxygen transport through the refractory lining.
US11746046B2

Chemically strengthened glass articles having at least one deep compressive layer extending from a surface of the article to a depth of compression DOC of at least about 125 μm within the glass article. The compressive stress profile includes a single linear segment or portion extending from the surface to the depth of compression DOC. Alternatively, the compressive stress profile may include an additional portion extending from the surface to a relatively shallow depth and the linear portion extending from the shallow depth to the depth of compression.
US11746045B2

A glass article comprising an alkali aluminosilicate glass that is formable by down-draw processes for example slot- and fusion-draw to thicknesses of 125 μm or less and is capable of being chemically strengthened by ion-exchange to achieve a compressive stress at its surface of at least 950 MPa, in some embodiments at least about 1000 MPa, and in other embodiments at least about 1100 MPa. The high surface compressive stress allows the glass to retain net compression and thus contain surface flaws when the glass is subjected to bending around a tight radius. The glass may be used in foldable display applications.
US11746039B2

The present disclosure relates to glass manufacturing, a glass composition, glass with a low inclusion content and a preparation method therefor and use thereof. The composition comprises 50-64 wt. % SiO2, 14-24 wt. % Al2O3, 0-7 wt. % B2O3+P2O5, 0.5-7 wt. % MgO, 1-10 wt. % CaO, 0-9 wt. % SrO, 0.1-14 wt. % BaO, 0.1-5 wt. % ZnO, 0.1-4 wt. % TiO2, 0.1-7 wt. % Y2O3+La2O3+Nd2O3, and <0.05 wt. % R2O, wherein R2O is a sum of the content of Li2O, Na2O and K2O, and the composition satisfies the following conditions: (1) a temperature T100 corresponding to a viscosity of 100 P is 1730° C. or higher; (2) a surface tension at 1300° C. is less than 420 mN/m. The glass prepared by the glass composition and the glass with a low inclusion content preparation method has the advantages of having low inclusion content, having a simple preparation process, being low in cost and so on.
US11746037B2

Provided is a method for manufacturing a glass fiber strand in which a glass fiber strand is formed by bundling a plurality of glass fiber filaments comprising molten glass drawn out from a nozzle, wherein said method for manufacturing a glass fiber strand is capable of detecting breakage of the glass fiber filaments in a more reliable manner. This method comprises: an image capturing step for generating a plurality of items of image data by continuously capturing images of a plurality of glass fiber filaments f; an image processing step for extracting, from the image data, a high luminance object having a luminance of a prescribed value or more; and a breakage detection step for detecting that a glass fiber filament f has broken on the basis of the results of the image processing in the image processing step.
US11746027B2

The invention concerns a flocculation formulation. The invention also concerns the treatment of mine tailings in the form of aqueous effluents comprising solid particles. With the method of the invention, it is possible to separate all or part of the water from an aqueous effluent comprising solid particles.
US11746017B2

A carbon nanotube aggregate includes a plurality of carbon nanotubes, a metal compound, and an oxide of the metal compound. The metal compound is contained in a space inside of each of the carbon nanotubes and/or in a space defined between the plurality of carbon nanotubes. When the metal compound is added inside the carbon nanotube aggregate, the metal compound is oxidized by reacting with oxygen or the like during or after a production process of the CNT aggregate, and the oxide is formed in the opening of the space to which the metal compound is added, so that the metal compound is capped with the oxide. Since the metal compound inside the CNT aggregate is shielded from the atmosphere, separation of the metal compound and reaction between the metal compound and oxygen and water in the atmosphere are suppressed, increasing heat resistance of the carbon nanotube aggregate.
US11746016B2

In various exemplary embodiments, the present disclosure provides a process for the conversion of certain polymers into diamond and diamond-like materials using laser pulse annealing. The process includes transforming the polymer to carbon, melting the carbon and quenching the carbon melt into to form Q-carbon, diamond, and/or graphene. The process can be applied to a polymer film such as a polytetrafluoroethylene (PTFE) tape. An object can be coated with the polymer film which can then be converted to Q-carbon, diamond, and/or graphene using laser pulse annealing. A process is also provided for making a three-dimensional object using a combination of, for example, 3D printing the polymer and converting each layer of polymer into Q-carbon, diamond and/or graphene.
US11746014B2

Disclosed is a method for producing a sulfide solid electrolyte including a step of processing a slurry by at least one treatment selected from drying and heating, wherein a solid electrolyte raw material containing a lithium element, a sulfur element, a phosphorus element and a halogen element, and a complexing agent are mixed in a reactor to give a complex slurry containing a complex formed of the solid electrolyte raw material and the complexing agent, and the complex slurry is transferred into an intermediate tank equipped with a cooling device and cooled therein.
US11746012B2

A method for making an aqueous hypochlorous acid (HClO) solution includes electrolyzing a solution of sodium chloride to produce a solution of sodium hypochlorite; and producing the aqueous hypochlorous acid solution by adjusting a pH of the solution of sodium hypochlorite to a value within a range of 3 to 8 by adding a selected weak acid to the solution of sodium hypochlorite to produce a buffer including the selected weak acid and a salt of the selected weak acid.
US11746009B2

The invention relates to a process for the start-up of an autothermal reformer, wherein syngas is produced in the autothermal reformer during start-up through steam reforming. To facilitate autoignition in the autothermal reformer reactor of the autothermal reformer, the reformed syngas is recycled to an upstream section of the autothermal reformer reactor and is mixed with process steam and a hydrocarbon containing process stream. As soon as a minimum hydrogen threshold concentration at the upstream section of the autothermal reformer reactor is reached in the mixed process stream, oxygen is added to the burner of the ATR reactor to obtain autoignition of the mixed process stream. Due to the process of the invention, an external hydrogen source for facilitating autoignition of the mixed stream can be omitted. The invention further relates to a plant configured to carry out the process of the invention.
US11746008B2

In one aspect, a process to decompose a hydrocarbon such as methane into carbon (graphitic powder) and hydrogen (H2 gas) without secondary production of carbon dioxide, employing a cycle in which a secondary chemical can be recycled and reused, is disclosed.
US11746003B2

A chip package includes a first die, a second die, a molding material, and a redistribution layer. The first die includes a first conductive pad. The second die is disposed on the first die and includes a second conductive pad. The molding material covers the first die and the second die. The molding material includes a top portion, a bottom portion, and an inclined portion adjoins the top portion and the bottom portion. The top portion is located on the second die, and the bottom portion is located on the first die. The redistribution layer is disposed along the top portion, the inclined portion, and the bottom portion. The redistribution layer is electrically connected to the first conductive pad and the second conductive pad.
US11746002B2

A method of forming a microelectromechanical device wherein a beam of the microelectromechanical device may deviate from a resting to an engaged or disengaged position through electrical biasing. The microelectromechanical device comprises a beam disposed above a first RF conductor and a second RF conductors. The microelectromechanical device further comprises at least a center stack, a first RF stack, a second RF stack, a first stack formed on a first base layer, and a second stack formed on a second base layer, each stack disposed between the beam and the first and second RF conductors. The beam is configured to deflect downward to first contact the first stack formed on the first base layer and the second stack formed on the second base layer simultaneously or the center stack, before contacting the first RF stack and the second RF stack simultaneously.
US11745997B2

A cooling system for a dispensing station includes a modular manifold that incorporates into the dispensing station. The modular manifold includes a recirculation block, an interface block, one or more expander blocks, and one or more spacer blocks that interconnect to produce the modular manifold. The modular manifold includes a recirculation line that couples at an inlet with a cooling fluid system to receive a cooling fluid therein and at an outlet with the cooling fluid system to deliver the cooling fluid from the modular manifold to the cooling fluid system. The modular manifold couples with a drink source and with a drink outlet of the dispensing station such that a drink flowing through the modular manifold from the drink source transfers heat to the cooling fluid circulating through the recirculation line resulting in a chilling of the drink prior to a dispensing thereof from the drink outlet.
US11745994B2

A vented funnel for transferring liquid from one container to another includes a base portion adapted for connection to the container, a converging portion connected to the base portion, and a vent portion located between the base portion and the converging portion. The vent portion has a plurality of vent openings extending between the base portion and the converging portion and a plurality of ribs located between the vent openings so that each vent opening is separated from an adjacent vent opening by one of the plurality of ribs. In this manner, air within the container flows through the vent openings when liquid discharged from the converging portion displaces air in the container. The ribs extend between the base portion and the converging portion so that the ribs solely support the converging portion on the base portion while defining the vent openings.
US11745990B2

In an aseptic filling apparatus, a CIP of the content filling station is performed after rotation of a wheel in the content filling station is stopped, a COP or SOP of the content filling station is performed while the wheel in the content filling station is rotating immediately after the CIP is completed, an SIP of the content filling station is performed with rotation of the wheel in the content filling station being stopped immediately after the COP or SOP is completed, and one or both of the COP and SOP of the other stations is performed in a predetermined order while wheels in the other stations are rotating in a period from the start of the CIP to the end of the SIP.
US11745980B2

An vertical transportation elevator, escalator, dumbwaiter and lift systems monitoring, maintenance, repair, inspection, testing and modernization system and method is provided. The system and method may provide real-time information to a technician, buildings, property managers, facility managers, owners of building, building engineers, regarding the current state of the equipment, status of inspections, status of testing, repairs, modernization history of maintenance real time maintenance performed on equipment and characteristics of the equipment, and future requirements of the elevator.
US11745972B2

A printing apparatus includes: an image former that forms an image on a pre-cutting sheet; a cutter that cuts the pre-cutting sheet on which the image is formed; and a hardware processor that controls the image former, wherein the hardware processor acquires image deviation information related to a deviation of an image with respect to a post-cutting sheet, and corrects at least one of a position, a tilt, or a shape of an image formed on the pre-cutting sheet so as to eliminate the deviation of the image based on the image deviation information.
US11745970B1

An apparatus and method for automatic splicing of rolls of sleeve material used in various packaging applications. The disclosed system will automatically splice the leading end of a new roll onto the trailing end of the old roll in an overlapped configuration. The apparatus performs an automatic cut and splice operation resulting in a splice of the two film rolls with tape applied to both sides of the splice joint where the new roll overlaps the cut end of the prior roll.
US11745969B2

A sheet space-detecting device detects a space between a rear end of a preceding first fiber reinforced plastic sheet and a front end of a following second fiber reinforced plastic sheet in a conveyance path for fiber reinforced plastic sheets and includes: a light-detecting sensor that projects detection light on an area including the rear end of the first fiber reinforced plastic sheet, the front end of the second fiber reinforced plastic sheet, and a reference surface exposed from the space and receives reflected light thereof; and a spacer that supports the rear end of the first fiber reinforced plastic sheet and the front end of the second fiber reinforced plastic sheet in a state where the rear end and the front end are separated from the reference surface, in an area including at least a light-projected area on which the detection light is projected.
US11745967B2

Provided is a paper sheet replenishing box (paper feed device) for replenishing reserve fund in each circulation-type paper sheet storage unit, wherein paper sheets of each denomination can be replenished from one paper sheet replenishing box in which paper sheets of different denominations having different sizes are accommodated together to a circulation unit of the respective circulation-type paper sheet storage units. The paper sheet replenishing box includes a first tray piece 201 in which a plurality of pieces of first paper sheets P1 are placed in a stacked state, a second tray piece 211 arranged immediately below the first tray piece, on which a plurality of pieces of second paper sheets P2 having a different longitudinal dimension from that of the first paper sheet are placed in a stacked state, and rear-end regulating members 204 and 214 that align front end positions in a transport direction of respective paper sheet bundles to predetermined positions. After all the first paper sheets in a bundle on the first tray piece have been fed by a feed unit 160, an uppermost surface of the second paper sheets in a bundle on the second tray piece becomes a state capable of coming in contact with the feed unit.
US11745964B2

An autonomous transport vehicle includes a frame forming a payload section configured to hold one or more pickfaces, a transfer arm movably mounted to the frame, a drive section connected to the frame, and a controller connected to the drive section, the controller being configured to effect an on-the-fly sortation of pickfaces carried by the autonomous transport vehicle according to a predetermined case out order sequence where the controller commands the drive section so that two or more pickfaces are picked from one or more first case unit holding locations and placed at one or more different second case unit holding locations according to the predetermined case out order sequence.
US11745963B1

The object collecting heads for object collecting systems includes several embodiments of object collecting heads including light and heavy-duty object collecting heads. The object collecting heads are used to grasp and convey differently sized and randomly shaped objects from a surface to an object holding bin of the object collecting system and are attached to the object holding bin using an adjustable support assembly. Both object collecting heads have three blocks including an upper block, a lower left block, and a lower right block. The lower blocks are connected to each other and the adjustable support assembly by an angled lower block bracket. The upper block is attached to the lower blocks by spring-loaded hinges, such that the upper block is urged toward the lower blocks to grasp an object therebetween. The light-duty object collecting head is a chain-based head, while the heavy-duty object collecting head is a roller-based head.
US11745951B2

The invention relates to a drive device (1) for a conveyor carriage (4) of a conveyor device (2), comprising a drive source (6) for generating a drive force (FTr) and a drive force transmission device (8) for transmitting the drive force (FTr) to a drive surface of the conveyor carriage (4). The conveyor carriage (4) has at least one counter bearing element (12) in particular which is designed as a counter bearing for the drive force transmission device (8).
US11745946B2

Platform assembly for use with sorting articles comprises platforms connected to each other to form at least one level surface for transit thereabout by a plurality of vehicles. Each platform defines a first orientation in which the platform is in a retracted position and a second orientation in which the platform is in an extended position with a horizontal disposition. Each platform includes a first panel comprising a plurality of markers thereon, the markers forming a grid on the first panel for transit thereabout by the plurality of vehicles. Each marker includes a magnetic signature for determining an orientation of the marker. A container is positioned about at least one of the plurality of markers. In operation, the vehicle is directed by a control system to deposit an article carried thereon into a container associated with a marker based on the location and orientation of the marker.
US11745943B2

A refuse vehicle includes a chassis, a body, a lock, a tailgate, an ejector, an actuator, a second actuator, and a processor. The body defines a receptacle for storing refuse. The lock is coupled to the body and is configured to releasably secure a movable tailgate. The receptacle contains the ejector. The ejector can transition from a first position that is spaced from the tailgate to a second position proximate the tailgate. The actuator is configured to transition the ejector from the first position to the second position. The second actuator is configured to move the tailgate. The processor is configured to selectively unlock the tailgate and transition the ejector from the first position to the second position in response to receiving a single input to thereby eject refuse from the receptacle without receiving multiple inputs.
US11745941B2

A waste receptacle includes a cinch tab and a cinch defined by the cinch tab. The cinch includes an opening configured to admit a liner portion of a waste liner. The cinch also includes a notch continuous with and extending away from the opening. At least a portion of the opening narrows in width in a direction extending away from the notch. The opening and the notch are configured to retain the liner portion to at least partially secure the waste liner to the waste receptacle.
US11745937B2

A web of cleaning products and a method of manufacturing the same is disclosed. The web includes first and second carrier sheets and a plurality of pouches containing a cleaning composition. Each of the pouches is disposed in a respective depression formed in an upper surface of the first carrier sheet. A first internal atmosphere is enclosed within each of the pouches. The first carrier sheet is sealed to the second carrier sheet such that a second internal atmosphere exists between the second carrier sheet and the plurality of pouches. The second internal atmosphere has a greater absolute pressure than the first internal atmosphere so that the plurality of pouches and at least a portion of the cleaning composition in the plurality of pouches are compressed into the plurality of depressions in the first carrier sheet by the second internal atmosphere.
US11745935B2

A wrap for smoking articles, which encloses a group of smoking articles and has, at the top and at the front, a first extraction opening obtained through the wrap by means of a “U”-shaped through cut. The first extraction opening is normally closed by a reusable closing portion, which consists of the part of the wrap surrounded by the through cut and it can be lifted to free the first extraction opening and then lowered again to engage the first extraction opening. A support element is comprised, which is arranged inside the wrap at the first extraction opening, it is glued to the wrap at least by means of a re-stick glue, and it has a second extraction opening, which is smaller than the first extraction opening and it is entirely contained in the first extraction opening.
US11745933B2

A double-walled cup and a process for production of the cup are described. The cup includes an inner cup and a tube-shaped outer sleeve, which is formed from a blank of paper material joined at its ends. The tube-shaped outer sleeve is slid axially onto a prefabricated inner sleeve and secured. The tube-shaped outer sleeve is formed from a flat blank by joining the ends of the blank before being slid on, whereby the ends of the blank are joined by an adhesive applied to a limited area of the outer sleeve. The ends of the blank are joined by a thermoplastic material in the form of an adhesive, which for example can be a hot-melt adhesive or a sealing varnish.
US11745931B2

A cooling element for cooling a body, comprising a heat conduction layer coterminous with a proximal side of the cooling element, a heat retardant layer coterminous with a distal side of the cooling element, and a heat sink volume disposed between the heat conduction and heat retardant layers, extending from a proximal boundary with the heat conduction layer to a distal boundary with the heat retardant layer. The heat sink volume comprises a porous material including a first substance; and the heat conduction layer comprises a porous material including a second substance. The first and second substances have thermal properties such that the first substance will solidify at a first temperature, the second substance being in the liquid state at the first temperature. The heat retardant layer has a lower mean thermal conductivity than the heat conduction layer.
US11745929B2

A system and method for storing, shipping, preserving and ripening produce. Packaging of respiring produce, particularly avocados, in sealed tray systems. The tray systems include a lower bowl-shaped tray having an upper lip to which a flexible film is adhered. The flexible film has an aperture covered by a breathable membrane. The film permits passage of water vapor to reduce the chance of mold formation during packaging and shipping. The breathable membrane controls gaseous exchange at different temperatures and has pores that open above the threshold temperature. The breathable membrane alters the O2 and CO2 within the tray above the threshold temperature, thus slowing up the ripening process at elevated temperatures.
US11745926B2

A seal for use with a container for storing and dispensing consumer products is described. The seal includes a cover layer having pre-formed lines of separation defining one or more releasable portions, an adhesive layer on the cover layer, and one or more patches on the adhesive layer. Each patch is associated with a respective one of the releasable portions 6 and consists of a hot melt polymer. The hot melt polymer can be applied to the adhesive layer using a suitable coating or spraying process.
US11745925B2

A disposable package is configured to promote recycling of its component parts. A thermoformed thermoplastic blister has front and back product bubbles which extend from a peripheral flange and are hinged together to be folded into a product compartment such that the product bubbles extend through openings in front and back cards. The front card is affixed to the back card to close the product bubble and so as not to adhere to the blister flanges. A front extraction tab extends from the peripheral flange and is accessible on two opposed sides for gripping by a user to engage and remove the blister from the front card and the back card.
US11745923B2

A cable tie includes a strip of material having a pair of longitudinally extending sides spaced from each other by a width W. In one form the strip includes a plurality of additional openings that are configured to receive the shank of a fastener. In one form, a plurality of first and second size openings are formed in the strip and spaced from each other along the longitudinal axis. Each of the first size openings have a first length LF parallel to the longitudinal axis and are located in a corresponding one of a first set of wide portions. Each of the second size openings are spaced from each other along the longitudinal axis so that one or more of the second size openings are located between pairs of the first size openings, with each of the second size openings located in a corresponding one of a second set of wide portions and having a length LS parallel to the longitudinal axis that is less than LF In one form, the strip includes a first plurality of notch pairs spaced from each other by a first distance D1, a second plurality of the notch pairs is spaced from each other by a second distance D2 that is less than the distance D1, and a plurality of elongate openings, with each opening located in the strip between two adjacent notch pairs that are spaced by the first distance D1.
US11745896B2

Flight guidance systems and methods that provide an airport selection in response to an EO condition in a single engine plane. The airport selection takes into consideration factors such as optimal approach type, runway length, weather, terrain, remaining battery time, and the like. Additionally, various also generate and display a visual indication of a remaining glide range when the EO condition is happening; the remaining glide range determination is based, at least in part, on terrain.
US11745883B2

A electric aircraft power distribution system includes a first battery pack connected to at least a first load and to a common bus that connects the first battery pack in parallel to at least a second battery pack; a first electrical component electrically connected between the first battery pack and the first load and configured to disconnect the first load from the first battery pack in response to current above a first threshold current, wherein the first electrical component has a first disconnection time at the first threshold current; and a second electrical component electrically connected between the first battery pack and the common bus and configured to disconnect the first battery pack from the common bus in response to current above a second threshold current, wherein the second electrical component has a second disconnection time at the second threshold current that is higher than the first disconnection time.
US11745877B2

A biplane flying device includes a fuselage, an upper wing, a lower wing, a first propulsion assembly and a second propulsion assembly. The upper wing is connected to one side of the fuselage. The upper wing has a first end and a second end opposite to each other. The lower wing is connected to the fuselage and opposite to the upper wing. The lower wing has a third end and a fourth end opposite to each other. The first end is opposite to the third end, and the second end is opposite to the fourth end. The first propulsion assembly is connected between the first end, the third end and the fuselage. The second propulsion assembly is connected between the second end, the fourth end and the fuselage.
US11745873B2

To improve safety during a fall of a flying apparatus, a flying apparatus (1) according to a representative embodiment of the present application includes a body unit (2), a lift-force generating part (3) that is connected to the body unit and generates a lift force, a flight control part (14) that controls the lift-force generating part, an abnormality detecting part (15) that detects an abnormality during flight, a parachute device (4) including a parachute (41, 41A) and a parachute accommodating part (42) that accommodates the parachute, and a fall control part (16) that ejects the parachute from the parachute accommodating part according to the detection of the abnormality by the abnormality detecting part.
US11745871B2

Disclosed are an anti-drone method using a GPS spoofing signal and a system thereof. According to an embodiment of the inventive concept, an anti-drone method may include injecting a GPS spoofing signal to analyze a drone feature of a target drone and hijacking the target drone by injecting a GPS spoofing signal into the target drone based on a drone hijacking strategy corresponding to the analyzed drone feature among predefined drone hijacking strategies. The analyzing of the drone feature may include injecting the GPS spoofing signal to analyze a safety device mechanism (GPS fail-safe) and a path-following algorithm of the target drone.
US11745867B2

A pylon conversion actuator, for use in tiltrotor aircraft, that converts the tiltrotor between hover flight mode and forward flight mode. Pylon conversion actuator selectively retracts and extends between a retracted position to an extended position. Pylon conversion actuator includes an extendable arm, a motor, and an actuator platform.
US11745861B2

Systems and method for active vibration control on an aircraft. An active vibration control system (AVCS) is configured for an aircraft having an aircraft structure and a gun. The AVCS includes at least one control sensor on the aircraft, at least one force generator on the aircraft, and at least one controller in electronic communication with the sensor and the force generator. The controller is configured for determining, using the at least one control sensor, force generating commands for controlling vibrations acting on the aircraft structure, sending the force generating commands to the at least one force generator, causing the at least one force generator to produce a vibration canceling force, determining that the gun is firing, and in response to determining that the gun is firing, determining different force generating commands and sending the different force generating commands to the at least one force generator.
US11745854B2

A foldable propeller for air mobility includes a link assembly including a plurality of links facilitating blades to be rotated around a hub as a moving portion vertically slides such that the blades are folded to each other or unfolded from each other.
US11745838B2

A boat lift is attached to piles driven into the earth or to another object. The boat lift is held in horizontal position relative to piles or the object to which it is attached, but vertical movement of the boat lift relative to the object is permitted. The boat lift is connected to the piles by modular units or cube constructs that have a post extending there through. The post has a blade extending from it. The blades are attached at an angle, according to the application, to pile guides that engage piles. The pile guides vertically traverse the piles, permitting the boat lift to move vertically relative to the object, but fixing the horizontal position of the boat lift.
US11745837B2

A storage structure is configured to be buoyant or retained above a water line. The storage structure includes a frame having a back beam, a left beam attached to the back beam, a right beam attached to the back beam and a front beam attached to the left beam and the right beam to form a substantially rectangular configuration, wherein prior to a last of the beams being secured together an interior space accessible through an opening. The storage structure includes a bladder configured to be positioned through the interior space though the opening wherein the bladder is sized to be retained within the interior space whether the storage structure is above the water line or buoyant, the bladder including a vent, a fill port and a drain wherein an amount of water within the bladder is manipulated to provide ballast or buoyancy to the storage structure. The storage structure includes at least one floor panel secured to the frame over the bladder, side walls extending from a perimeter of the floor panel, wherein one side wall includes a door for ingress and egress to the storage structure. The storage structure includes a roof attached to the side walls.
US11745831B2

A bar gripping assembly is configured to join a bar to a marine accessory on a marine craft. The bar gripping assembly has a single piece housing having an upper housing portion and a lower housing portion. A marine accessory is formed as part of the upper housing portion. A first wall slot and a second wall slot are arranged through the lower housing portion. A hollow portion adjacent to a weakened wall on the lower housing portion that has a lower portion opening and an upper portion. A strap is arranged through the first wall slot, the second wall slot, and around the lower portion opening. The strap compresses the lower housing portion against the bar to join the marine accessory to the marine craft.
US11745830B2

A bilge pump system for removing residual fluid from a vessel surface, includes at least one collection unit having a collection base with a collection inlet and a collection outlet, and a pump having a pump inlet flow-connected by at least one tube to the collection outlet. A discharge tube is flow-connected to the pump outlet, wherein the collection inlet comprises at least one opening on a bottom face of the collection base arranged to be on the vessel surface. A sponge is arranged within the opening of the collection base and in liquid communication with the vessel surface. The sponge can be fitted into place by lips or lugs protruding from the collection base.
US11745817B2

A dropper seatpost assembly is disclosed. The dropper seatpost assembly includes a lower post and an upper post configured to telescopically move with respect to the lower post. The dropper seatpost assembly also includes a translating mechanism configured to maintain an orientation such as a lateral orientation, a rotational orientation, or both a lateral orientation and a rotational orientation of the upper post with respect to the lower post as the upper post telescopically moves with respect to the lower post, the translating mechanism comprising two or more vertically offset features.
US11745812B2

Provided is a running device including a frame (11) and a first wheel part (15) and a second wheel part (35) arranged with an appropriate distance therebetween along a running direction (R). The first wheel part (15) includes a first left support arm (17) and a first right support arm (26) arranged on the frame (11) in a manner to be swingable within a plane extending along the running direction (R). The second wheel part (35) includes a second support arm (36) arranged on the frame (11) in a manner to be swingable within a plane perpendicular to the running direction (R). The first left support arm (17) has first left wheels (19, 21) respectively on both sides thereof, and the first right support arm (26) has first right wheels (28, 30) respectively on both sides thereof. The second support arm (36) has a second left wheel (38) and a second right wheel (40) respectively on both sides thereof.
US11745796B2

A driving support Electronic Control Unit (ECU) initializes a target trajectory calculation parameter at a start of Lane Change Assist Control (LCA), calculates, based on the target trajectory calculation parameter, a target trajectory function representing a target lateral position in accordance with an elapsed time from the start of LCA; and calculates a target control amount according to the target trajectory function. When it is determined that the own vehicle has crossed a boundary white line, the driving support ECU again initializes the target trajectory calculation parameter, and calculate the target trajectory function based on the target trajectory calculation parameter.
US11745795B2

A steer axle assembly for an axle including a first steering component, a second steering component, and a movable joint assembly coupled to the first steering component and the second steering component. The movable joint is configured for axial movement and rotational movement to provide for relative movement between the first and second steering components. The first steering component is produced from a first material having a first coefficient of thermal expansion. The second steering component is produced from a second material having a second coefficient of thermal expansion, wherein the second coefficient of thermal expansion is different from the first coefficient of thermal expansion.
US11745792B2

A steering device includes a steering member, a steering operation mechanism, a reactive force motor, a steering motor that drives the steering operation mechanism, a steering torque sensor, and an electronic control unit. The electronic control unit sets a manual steering angle command value. The electronic control unit computes a reactive-force-related composite angle command value. The electronic control unit computes a steering-related composite angle command value based on a steering-related automatic steering angle command value and the manual steering angle command value. The electronic control unit causes a rotational angle of the reactive force motor to follow the reactive-force-related composite angle command value. The electronic control unit causes a rotational angle of the steering motor to follow the steering-related composite angle command value. The electronic control unit estimates a first disturbance torque.
US11745791B2

A control device for an on-board device including an actuator is configured to: supply power to a first microprocessor and a first driver circuit from a first power source through a first power supply path; supply power to a second microprocessor and a second driver circuit from a second power source through a second power supply path; and use the first and second driver circuits to drive the actuator. In this control device, the negative electrodes of the first and second power sources are electrically connected to a common ground portion. Specifically, the first negative electrode of the first power source and the second negative electrode of the second power source are connected to the common ground portion respectively through independent first and second connector portions.
US11745790B2

The disclosure specifies a gear assembly for an electric-motor assisted steering system, comprising an electric motor, a worm shaft which can be driven by the electric motor and which meshes with a worm wheel. The worm shaft has a recess on an end face which faces the electric motor, in which recess there is arranged an elastic element which applies an axial force to the worm shaft in the direction away from the electric motor. In the axial direction, the elastic element is supported by one end on an adjustment element, which is formed in such a way that it permits expansion of the elastic element in the axial direction when the axial force on the worm shaft exceeds a defined threshold value, and limits expansion of the elastic element when the axial force on the worm shaft lies below the defined threshold value.
US11745789B2

A handwheel actuator assembly includes a handwheel shaft configured for connection to a handwheel, the handwheel shaft extending longitudinally about an axis. The handwheel actuator assembly also includes a motor operatively coupled to the handwheel shaft. The handwheel actuator assembly further includes a planetary gear assembly disposed within the motor. The handwheel actuator assembly yet further includes an electronic control unit (ECU) in operative communication with the motor.
US11745788B2

A steer-by-wire steering device is provided with: a first stopper shaped hollow; a second stopper shaped hollow and structured such that a steering shaft is coupled to the second stopper, the second stopper including a small diameter portion and a large diameter portion; a nut engaged to a thread formed on an outer circumference surface of the small diameter portion such that the nut is positioned between the first stopper and the large diameter portion of the second stopper; and a hollow guide ring having an outer circumferential surface and an inner circumferential surface, the hollow guide ring provided between a housing and the nut such that the outer circumferential surface is coupled to the housing and the nut is coupled to be supported in the inner circumferential surface in a circumferential direction.
US11745782B2

A stroller seat is mounted on a stroller and is provided with: a main part extending from a backrest to a seating part of the stroller and having a space therein through which air flows; an extension part protruding from at least one of the two side portions of the main body and having a space therein which communicates with the space of the main body; and a fan attachment part which is provided on the extension part and to which an electric fan can be attached. The main body has, on a surface to be in contact with a human body, an air discharge unit for discharging air therein to the outside. Air introduced by the electric fan attached to the fan attachment part flows into the main body through the extension part.
US11745780B2

A lockable cover panel for a shopping cart and a shopping cart comprising the same is disclosed. The shopping cart can comprise a frame, a plurality of wheels, and a main compartment. The shopping cart can further comprise a collapsible secondary compartment comprising a first panel and a lower panel and defining a top opening. A cover panel can pivotably attach to the first panel and extend across the top opening.
US11745779B2

A cart includes a chassis and attached wheels; an upper basket attached to the chassis; and a lower basket attached to the chassis. In some embodiments, the cart includes no widthwise push bar in a rear of the cart such that access is unobstructed to the upper and lower baskets from the rear of the cart by a person. In some embodiments, the chassis defines on each lateral side of the cart a pair of vertically spaced handles, each handle surrounding and defining an opening. The handles preferably include handle bars shaped in an oval. On each cart side a curved elongate member extends between and connects the handles, and the curved elongate members represent the rearmost part of the cart. The rear area of the upper basket defines a seat for an infant, and a rear ledge of the lower basket defines a seat for a toddler.
US11745776B2

Embodiments of the present disclosure are directed to a cart frame and modular, motorized cart. In some examples, the cart frame may comprise a wheel assembly, handles, and a kickstand. A modular article (e.g., litter, stretcher, game basket, etc.) may be attached to the top portion of the cart frame via at least one fastener (e.g., buttons, snaps, hooks, buckles, quick-detach mounts, etc.). The handles may be foldable and extendable. The kickstands may also be foldable and extendable. The handles, in some embodiments, may serve a dual purpose by folding to a certain length to function as a kickstand. In other examples, the cart may comprise an engine that may be gas-powered or electric. A battery may be affixed to the cart frame that powers the electric engine. Other objects may also be attached to the cart frame or modular article, such as a winch, tow bar, light, bumper, etc.
US11745773B2

The electric vehicle can include: a payload interface, a payload suspension, a chassis, a set of bumpers, a sensor suite, a controller, a chassis suspension, and an electric powertrain. The electric vehicle 100 can optionally include a payload adapter, a power source, a cooling subsystem, and/or any other suitable components. The electric vehicle functions to structurally support a payload, such as a cargo container (e.g., intermodal container, ISO container, etc.), and/or to facilitate transportation of a payload via railway infrastructure.
US11745763B2

A travel assistance method and a travel assistance device for a vehicle is capable of avoiding any risk that may arise. The method includes obtaining a risk potential of an object detected by the vehicle, associating the risk potential of the object with an encounter location at which the object is encountered, accumulating the risk potential at the encounter location, and using the accumulated risk potential to obtain a primary estimated risk potential of the object predicted to be encountered at the encounter location. The primary estimated risk potential is lower than the risk potential obtained when detecting the object. The method further includes obtaining a secondary estimated risk potential using a predicted travel movement of another vehicle that avoids a risk due to the primary estimated risk potential, and when traveling at the encounter location again, autonomously controlling travel of the vehicle using the secondary estimated risk potential.
US11745760B2

A path planning of the ADV is performed. A set of obstacle boundaries are generated for one or more obstacles, where each of the set of obstacle boundaries has a corresponding buffer distance ranging from a predetermined minimum buffer distance to a predetermined maximum buffer distance. A set of paths of the ADV is generated using quadratic programming based on the set of obstacle boundaries in parallel, where each path of the set of paths corresponds to one of the set of obstacle boundaries. A path is selected from successful paths of the set of paths based on a corresponding obstacle boundary having a smallest corresponding buffer distance, where the ADV is at least a predetermined distance away from the one or more obstacles in the successful paths. The ADV is controlled to drive autonomously according the selected path to avoid the one or more obstacles.
US11745752B2

A vehicle control system can have an in-vehicle camera that monitors a state of the driver; a center display and a meter device that notify the occupant of information; and a controller that executes automatic stop control in the case where the driver abnormality is determined. The controller can perform: a first operation to decelerate the vehicle to a specified speed when the abnormality is determined; a second operation to further decelerate and stop the vehicle after the first operation; a third operation to change a lane of the vehicle between the first operation and the second operation; and a fourth operation to move the vehicle to a road shoulder between the first operation and the second operation. The controller can notify the operation performed, and notify of a stop of the operation in the case where the operation performed is stopped.
US11745750B2

A method may include obtaining input information that describes a driving operation of a vehicle and obtaining a rule that indicates an approved driving operation of the vehicle. The method may include parsing the rule using a domain-specific language to generate rule conditions in which the domain-specific language is a programming language that is specifically designed for analyzing driving operations of vehicles. The method may include representing the input information as observations relating to the vehicle in which each of the observations is comparable to one or more of the rules. The method may include comparing the observations to one or more respective comparable rule conditions and generating a grading summary that evaluates how well the observations satisfy the respective comparable rule conditions based on the comparison. A future driving operation of the vehicle may be adjusted based on the grading summary.
US11745745B2

Systems and methods for improving driver attention awareness are disclosed herein. One embodiment monitors the attention status of the driver of a vehicle; detects, based on the monitoring, the commencement of a distracted-driving incident; records, during the distracted-driving incident, information pertaining to the distracted-driving incident; detects, based on the monitoring, the end of the distracted-driving incident; and reports, at the earliest opportunity after the end of the distracted-driving incident and prior to the conclusion of the current trip, the information to the driver.
US11745741B2

A method detects unintended acceleration of a motor vehicle during a closed-loop speed control mode by determining external forces on the vehicle via a controller, and then calculating a desired acceleration using a measured vehicle speed and the external forces. The method includes determining an actual acceleration of the vehicle, including filtering a speed signal as a first actual acceleration value and/or measuring a second actual acceleration value using an inertial measurement unit (IMU). During the speed control mode, the method includes calculating an acceleration delta value as a difference between the desired acceleration and the actual acceleration, and then using the acceleration delta value to detect the unintended acceleration during the speed control mode. A powertrain system for the motor vehicle, e.g., an electric vehicle, includes the controller and one or more torque generating devices coupled to road wheels of the vehicle.
US11745738B2

A method of controlling a propulsion system inverter includes identifying at least one route characteristic of a portion of a route being traversed by a vehicle. The method further includes Receiving at least one inverter characteristic. The method further includes generating a target thermal profile of the propulsion system inverter corresponding to thermal fatigue associated with the at least one thermal characteristic. The method further includes generating a signal to selectively instruct the adjustment of at least one of the vehicle speed control input, a torque demand corresponding to the vehicle speed control input, and the portion of the route based on the target thermal profile of the propulsion system inverter to improve inverter life.
US11745731B2

To obtain a vehicle control device capable of creating a route that facilitates tracing by a vehicle in autonomous driving and improving positional accuracy of the vehicle at the time of tracing. A vehicle control device (520) of the present invention includes an oversteer angle determination unit (508) that determines whether or not a steering angle of a vehicle (10) is an oversteer angle, a stationary steering determination unit (509) that determines whether or not stationary steering operation is performed on a vehicle, a route storage mode detection unit (505) that determines whether or not a route storage mode is set, a specific operation detection unit (507) that determines whether a steering angle is the oversteer angle or the stationary steering operation is performed in the route storage mode, and an output unit that outputs a control command of steering angle restriction control that restricts steering operation of a driver in the route storage mode in a case where the specific operation detection unit determines that a steering angle is the oversteer angle or the stationary steering operation is performed.
US11745727B2

Aspects relate to systems and methods for mapping a parking area for autonomous parking. An exemplary method includes receiving a point of interest designator for a point of interest, a drop-off location designator for a drop-off location, a parking location designator for a parking location, and a parking path designator for a parking path between the drop-off location and the parking location, receiving survey data of the point of interest from a remote device having at least a locating sensor, wherein survey data includes a drop-off geofence for the drop-off location, a parking geofence for the parking location, and a parking waypath for the parking path, and generating a parking map for the point of interest, wherein the parking map includes the drop-off location designator, the parking location designator, the parking path designator, the drop-off geofence, the parking geofence, and the parking waypath.
US11745724B2

Methods and systems are provided for controlling and diagnosing a mechanical vehicle component. In one example, a method may include determining an input device state and an electric machine torque at a diagnostic controller, and identifying a fault condition based on these determinations. Further, the diagnostic controller may trigger an active fault state of the mechanical vehicle component to avoid unintended vehicle acceleration, particularly at low speeds.
US11745716B2

An interface between an adapter push rod and a parking brake diaphragm seal includes an axial projection at one end of the push rod, a thread extending axially between a free end of the projection and a remainder of the push rod, and a washer having an approximately conical wall extending radially inwardly from an outer circumference of the washer towards a central mounting connection having a radial flange. A nut is threaded over the free end of the projection, and an opening in a hardened element is aligned axially with the projection to receive the projection. A circumferential groove defined in a side of the radial flange forms a boundary between the approximately conical wall and a remainder of the washer, and a portion of the diaphragm seal is pressed by the nut and the hardened element into the circumferential groove to produce a sealing bead.
US11745708B2

A controller for a vehicle, a system, a vehicle, a method, a computer program and a non-transitory computer-readable storage medium are disclosed. The controller is configured to receive an indication of a measured speed of the vehicle, and determine whether a gradient on which the vehicle is located is below a threshold gradient. The controller is also configured to provide an output signal to cause a brake of the vehicle to be automatically applied to hold the vehicle stationary, in dependence on: the received indication of the measured speed of the vehicle being below a threshold speed; and the determination that the gradient is below the threshold gradient.
US11745705B2

An anti-lock braking system for a triple axle trailer having three axles and six wheels is disclosed. The system includes a first wheel speed sensor coupled to the first wheel of the trailer, a second wheel speed sensor coupled to the third wheel of the trailer, a spring mount pivotably coupled to the body of the trailer, a first suspension member coupled to the first wheel and to the spring mount and a second suspension member coupled to the second wheel and to the spring mount. The system includes a hydraulic braking actuator having a first channel coupled to the first wheel and the second wheel and a second channel coupled to the third wheel. The spring mount pivots in response to an applied brake torque to increase a normal force applied to the second wheel as compared to a normal force applied to the first wheel.
US11745700B2

Systems and methods are provided for controlling power modes of a vehicle and for providing passive entry to the vehicle. A sleep command can be sent from a central controller to multiple domain controllers to enter a sleep state. When the sleep command is received by a first domain controller, a sleep state is entered. When the sleep command is received by a second domain controller, a stealth state is entered. While in the stealth state, the second domain controller periodically wakes up from a sleep state to monitor a condition. In response to detecting a first condition, the second domain controller returns to the sleep state. In response to detecting a second condition, the second domain controller sends a notification of the second condition to the central controller.
US11745698B2

A vehicle security system is provided for a vehicle having a braking system that includes a parking brake, the parking brake being capable of being switched between a driving position and a braking position. The vehicle security system is configured to secure the vehicle after an accident. The vehicle security system comprises a control unit configured to ascertain an accident of the vehicle and to switch the parking brake of the vehicle into the braking position in response to ascertaining an accident of the vehicle, and a sensor configured to capture and make available first vehicle data that represent a rotary location of the vehicle. The control unit is configured to carry out the ascertainment of an accident on the basis of the first vehicle data.
US11745694B2

For example, even when an occupant is seated offset in a left-right direction, an airbag is reliably expanded and deployed. An airbag device contains: an airbag that protects at least a side portion of a shoulder region, upper arm region, and chest region of an occupant seated on a vehicle seat; and an inflator that supplies gas to the airbag. The airbag has a pair of side part protection chambers that are housed on at least both left and right sides of the vehicle seat. The side part protection chambers, when expanded and deployed, expand and deploy forward independently from both left and right sides of the vehicle seat. A pair of the inflators are provided to allow gas to be supplied to each side part protection chamber, and the ignition timing of the inflators can be controlled separately.
US11745693B2

A seat-mounted airbag device includes an inflator that is operated when a vehicle collision is detected or predicted and ejects gas and an airbag body that includes a front-rear chamber and a tip chamber. The front-rear chamber is deployed forward of a seat through a clearance between a window and a head of an occupant from a side portion of a headrest on a window side by the gas ejected from the inflator and disposed between the window and the head of the occupant. The tip chamber is deployed inward in a seat width direction from an end portion of the front-rear chamber on a seat front side and disposed forward of a face of the occupant on the seat front side. The airbag body housed in the side portion includes an outward wound portion wound outward in a roll shape with a seat up-down direction as an axial direction.
US11745690B2

An apparatus for mounting a curtain airbag cushion, the apparatus including an intermediate connection tab and a strap sewn onto a curtain airbag cushion, a mounting plate coupled to the intermediate connection tab, and a ramp bracket assembled with the mounting plate and fixedly coupled to a vehicle body together with the mounting plate, in which the mounting plate and the ramp bracket are assembled as a coupling hook of the mounting plate passes through a hook hole of the ramp bracket.
US11745688B2

A roof airbag for a vehicle is proposed. The roof airbag for a vehicle has an airbag cushion configured to be unfolded downward from an inner roof to protect a passenger seated on a seat, and the airbag cushion has a shape bent toward the passenger by a main tether and a sub-tether, thus securing a restraining force for the passenger and safely protecting the passenger from an impact, and the airbag cushion is unfolded downward while avoiding insertion between a roof-side portion of the roof and a headlining by the sub-tether. Specifically, the airbag cushion is prevented from being transversally contracted and an unfolding shape of the airbag cushion is maintained. Furthermore, the fluidity of a gas flow in the airbag cushion is secured, so that the airbag cushion is rapidly unfolded.
US11745687B2

A curtain airbag for a vehicle comprising: an airbag main body, an air chamber defined by the airbag main body; and a strip-shaped component, abutting the airbag main body. The strip-shaped component is electrically conductive, and is configured to deform or break when the airbag main body is twisted so that resistance of the strip-shaped component changes.
US11745674B2

A wire harness including: a plurality of electric wires; an exterior tube that has an internal space into which the plurality of electric wires are inserted; a first protective body that is insulative, is provided between the plurality of electric wires in the internal space of the exterior tube, and is formed with an insulating reinforced fiber; and a second protective body that is provided so as to fill a gap between an inner circumferential surface of the exterior tube and outer circumferential surfaces of the plurality of electric wires, and covers an outer circumference of the first protective body and outer circumferences of the plurality of electric wires, wherein the first protective body is shorter than the second protective body in a side view of the wire harness.
US11745670B2

A protective case system for use with an electronic device includes a protective case, a handle, and an adapter. The protective case removably receives the electronic device and a display screen of the electronic device remains accessible when the electronic device is installed in the protective case. The handle is attached to and extends outward from a back surface of the protective case. The handle is configured for carrying the protective case and the installed electronic device. The adapter is configured to be removably attachable to the handle and bendable by a user to a plurality of positions. The adapter is configured to function as a multi-position stand for the protective case and the installed electronic device. The adapter is further configured to removably affix the protective case and the installed electronic device to headrest posts of a seat.
US11745663B1

A front-view system is disclosed. The front-view system may include: a detector configured to detect whether a forward vision of a driver is obstructed; a front camera configured to capture a front view of a vehicle and transmit an image of the captured front view of the vehicle; at least one display mounted in the vehicle; and a controller configured to receive the image of the captured front view of the vehicle from the front camera in response to receiving information indicating that the forward vision of the driver is obstructed, and display the received image of the front view of the vehicle on the at least one display. A front-view method using the front-view system is further disclosed.
US11745662B2

An electrochromic mirror module including a light-transmissive substrate, an opaque touch sensing layer and an electrochromic device is provided. The light-transmissive substrate has a visible surface and a back surface disposed opposite to the visible surface. The opaque touch sensing layer and the electrochromic layer are disposed on the back surface. Distribution areas of the opaque touch sensing layer and the electrochromic layer are different on the back surface. An electrochromic mirror module including reflective layer and electrochromic device is also provided.
US11745661B2

An omni-directional self-orienting structure for a motorcycle, ATV, UTV, off road vehicle, snowmobile, bicycle or other vehicle. The structure extends from the vehicle and will deflect or breakaway under an applied force such as an impact, for example by a tree branch strike or crash. The structure can re-position and re-orient itself once the force is removed. Examples of the structure are hand guards, side mirrors, turn signals, extended lights, mounts and antennas. Apparatus and method claims are provided.
US11745651B2

A communication controller that receives moving body related information detected by a sensor and transmits a parameter for generating a sound based on this moving body related information, and a sound generating unit that includes a circuit that generates a basic sound signal having a predetermined sound waveform, receives the parameter received by the communication controller, and outputs a sound signal obtained by adjusting the sound waveform of the basic sound signal based on the received parameter.
US11745649B2

A vehicle panel including a perforated pattern and a method of manufacturing the same, whereby a pattern can be realized through minimal means and a simple method, thereby reducing the amount of time taken and the expense incurred for the production of a product. Additionally, large-area patterning is possible, so the method can be applied to large parts. Moreover, the vehicle panel is capable of realizing a uniform lighting pattern without variation in luminance. When power is turned off, only a perforated pattern is viewed and, when power is turned on, a logical pattern with various designs is viewed, advantageously improving the aesthetic appearance of metal parts.
US11745648B1

The disclosure provides a vehicle approach notification device and a picking truck. The vehicle approach notification device includes a first illumination portion provided on a cab capable of elevation; a second and a third illumination portion provided on a vehicle body incapable of elevation; and a control unit that (1) turns on the first illumination portion and off other illumination portions when a travel state of the vehicle body is backward travel and an elevation position is lower than a predetermined threshold value; (2) turns on the second illumination portion and off other illumination portions when the travel state is backward travel and the elevation position is equal to or higher than the threshold value; (3) turns on the third illumination portion and off other illumination portions when the travel state of vehicle is forward travel; and (4) turns off all illumination portions when the travel state is travel stop.
US11745636B1

A vehicle mounted multi tricycle carrier with tilting carrier platforms that enable loading multiple tricycle to the carrier without a person hand lifting the tricycle from the ground. The carrier incorporates a lifting boom accessory. The lifting boom is attached to the lower carrier structure and a second platform added to the lift boom allowing two tricycles to be carried.
US11745630B2

A passive safety system is provided for a vehicle. The passive safety system includes a support frame configured to be secured on the vehicle in a fixed position and a support surface configured to support a payload carried by the vehicle. The support surface is configured to float with respect to the support frame. The passive safety system includes an energy conversion device between the support frame and the support surface, and includes a frictional surface configured to engage a portion of the support surface when the support surface tends to move in a predetermined direction with respect to the support frame to thereby convert kinetic energy of the support surface into frictional energy and increase the stopping/braking distance.
US11745629B2

A child safety seat includes a seat shell and a buffering part. The seat shell includes a backrest portion and two sidewalls, the backrest portion having a front surface facing forward that is suitable to provide support for a child's back, the two sidewalls being respectively disposed at a left and a right side of the seat shell for restricting sideways movements of a child who sits in the seat shell, one of the two sidewalls having a sidewall portion located in front of the front surface. The buffering part is connected with the seat shell, the buffering part being operable to protrude sideways at an outer side of the sidewall portion.
US11745619B2

Multiple chemistry battery systems and methods for using such systems in electric vehicles are disclosed. In one embodiment, an example electric vehicle may include a drive motor configured to impart motion to one or more wheels of the electric vehicle, a plurality of batteries configured to power the drive motor, and one or more controllers. The plurality of batteries may include a first battery including a first cell having a first chemistry, and a second battery including a second cell having a second chemistry different from the first chemistry. The one or more controllers may be configured to cause the first battery and the second battery to power the drive motor, and to cause the drive motor to charge the first battery and the second battery.
US11745615B2

A power system includes a charge circuit connecting a low voltage circuit to a high voltage circuit; a charge control unit configured to execute an auxiliary charge control to charge a low voltage battery; a BCM configured to accept an ON operation or an OFF operation; and an auxiliary charge timing setting unit configured to set an auxiliary charge timing at which the auxiliary charge control is to be executed during a standstill period, the standstill period starting from acceptance of the OFF operation and ending at acceptance of the ON operation. If a soak time is shorter than an auxiliary charge-allowing period, the charge control unit executes the auxiliary charge control at the auxiliary charge timing set by the auxiliary charge timing setting unit, whereas if the soak time is longer than the auxiliary charge-allowing period, the charge control unit does not execute the auxiliary charge control.
US11745614B2

A high-voltage portable charging system for remote recharging of an electric vehicle includes a housing, an array of battery cells forming a high-voltage battery disposed in the housing, and a low-voltage battery disposed in the housing. A coupler assembly has a cord and a vehicle connector configured to connect to a vehicle charge port. A switching arrangement is powered by the low-voltage battery and is configured to electrically connect the high-voltage battery to the cord when in a first condition and to de-energize the cord when in a second condition.
US11745611B1

A system for control of an electric powertrain is provided. The powertrain includes a battery configured for providing electrical energy at a first relatively higher voltage in direct current. The powertrain further includes a power inverter including a first phase circuit, a second phase circuit including first and second switches, and a third phase circuit including third and fourth switches. The powertrain further includes a motor configured for receiving alternating current electrical energy from the power inverter. The system further includes a computerized controller operating a charging cycle. The charging cycle includes deactivating the first phase circuit of the power inverter and selectively cyclically activating the first switch, the second switch, the third switch, and the fourth switch to direct electrical energy provided at a second relatively lower voltage in direct current through the motor to provide a flow of electrical energy at the first voltage to the battery.
US11745609B2

A connection device for electrical connection of a vehicle to a charging cord provided with a charging socket includes a housing, a power contact disposed within the housing, and a printed circuit board mounted in the housing having a first face provided with a first metal pad which is compressed between the printed circuit board and a surface of the power contact, and a second face provided with a first temperature sensor which is arranged opposite the first metal pad. A method of electrical connection of a vehicle to a charging cord provided with a charging socket is also provided.
US11745608B2

An electrical connector apparatus that magnetically aligns electrical contacts in a suspended magnetic connector with mating electrical contacts in a vehicle magnetic connector and holds the connectors together during an electric vehicle charging process.
US11745606B2

The invention relates to a method for automatically connecting a charging connector (12) to a charging connector socket (21) of a vehicle (2), preferably a land vehicle (2), comprising at least the following steps: first optical capturing (100) of the charging connector socket (21) and/or the vehicle (2) as a first image by means of at least one first image capturing unit (13) which is arranged to be movable with the charging connector (12), determining (200) the position of the charging connector socket (21) and/or of the vehicle (2) based on the first image, reducing (300) the distance between the charging connector (12) and the charging connector socket (21) and/or the vehicle (2) by means of a positioning unit (10), and second optical capturing (400) of the charging connector socket (21) and/or of the vehicle (2) as a second image by means of the first image capturing unit (13).
US11745601B2

An auxiliary device system battery and a small electric power load are connected to a first power supply line, and power supply power stepped up by a DC/DC converter in a zone ECU is supplied to a second power supply line. A large electric power load and a capacitor are connected to the second power supply line, and when the large electric power load is driven, the capacitor is connected to supply necessary power supply power, and voltage fluctuation is prevented. When an ignition is OFF, a switch circuit is closed, a dark current is supplied from the capacitor, and electric charge is discharged to prevent deterioration. Alternatively, the auxiliary device system battery is connected to a second power supply line side, and a dark current is supplied to a first power supply line side when the ignition is OFF using a capacitor or a dedicated circuit.
US11745593B1

A vehicle electrical system for a vehicle includes a power source, two low-voltage buses, two power-distribution boxes each electrically connected to the power source and to one of the low-voltage buses and positioned to control electrical flow from the power source to that low-voltage bus, and two low-voltage batteries each electrically connected to one of the power-distribution boxes and arranged to supply electricity to one of the low-voltage buses via that power-distribution box. Each power-distribution box is programmed to perform a test on its low-voltage battery, the tests being isolated from the other low-voltage battery.
US11745577B2

A torque converter includes a torque converter body and a rotary electrical machine. The torque converter body includes a cover, an impeller, a turbine, and a first stator. The rotary electrical machine includes a rotor and a second stator. The rotary electrical machine is disposed inside the torque converter body.
US11745572B2

A transmission mechanism is provided with an output gear drivingly coupled to at least one of a pair of output members and placed coaxially with the pair of output members. A direction in which a rotating electrical machine and an inverter device are arranged side by side in an axial view is defined as a first direction. A direction perpendicular to both an axial direction and the first direction is defined as a second direction. A first output member that is one of the pair of output members is placed between the rotating electrical machine and the inverter device in the first direction, at a position in the second direction where both the rotating electrical machine and the inverter device are placed. The output gear is placed in such a manner as to overlap each of the rotating electrical machine and the inverter device in the axial view.
US11745563B2

A control system (300) for a transport engineless refrigeration unit (301), the control system including: a controller (302) for communication between a vehicle (307) and a plurality of vehicle devices, the controller comprising: a vehicle data connection (306) for transmitting data to and from a vehicle; a vehicle engine on/off connection (308) for triggering start-up of the vehicle engine; a plurality of device data connections (314), each device data connection transmits data to and from at least one device external to the controller; and a device power connection (313), the device power connection supplies power from the controller to at least one device external to the controller.
US11745561B2

A heat management device may include: a heat circuit comprising a heat exchanger passage, a radiator passage communicating with the heat exchanger passage, and a battery passage communicating with the heat exchanger passage by bypassing the radiator passage; a heat exchanger cooling heat medium by heat exchange; a radiator exchanging heat between outside air and the heat medium in the radiator passage; a control valve changing a channel of the heat medium in the heat circuit; a pump pumping out the heat medium in the heat circuit from the heat exchanger passage to the battery passage and from the heat exchanger passage to the radiator passage; and a controller. The controller may execute: a heating operation for heating the heat medium in the battery passage by a battery; and a circulation operation for cooling the heat medium in the radiator passage by the radiator.
US11745560B2

A blower unit includes a casing defining a first passage and a second passage, a first internal-external air switching member, a second internal-external air switching member, and a partition defining an opening. During a two-layer internal/external air mode, the first internal-external air switching member opens an external air inlet and closes an internal air inlet and the second internal-external air switching member closes the external air inlet and opens the internal inlet, so that the external air is directly introduced into the first passage through the external air inlet and the external air in the second passage is introduced into the first passage through the opening of the partition and the internal air is directly introduced into the second passage through the internal air inlet and the internal air in the first passage is introduced into the second passage through the opening of the partition.
US11745552B2

A machine includes a frame and an oscillating hitch. A first cylinder couples to a first side of the oscillating hitch and a first side of the frame. A second cylinder couples to a second side of the oscillating hitch and a second side of the frame. A first isolating mechanism couples to the first cylinder and rotates in response to a first rotation of the first cylinder relative to the frame or the oscillating hitch. A first angle sensor senses a first angular displacement of the first isolating mechanism about a first rotational axis. A second isolating mechanism couples to the second cylinder and rotates in response to a second rotation of the second cylinder relative to the frame or the oscillating hitch. A second angle sensor senses a second angular displacement of the second isolating mechanism about a second rotational axis.
US11745548B2

A method for estimating an effective radius of a tire of a vehicle, the method may include (i) obtaining sensed information that reflects (a) a distance passed by the vehicle during one or more driving sessions, (b) a rotational speed of at least a wheel that comprises the tire during the one or more driving sessions, (c) values of tire radius affecting parameters during the one or more driving sessions, wherein the tire radius affecting parameters comprise a vehicle speed and at least some other tire radius affecting parameters; (ii) selecting at least one portion of the one or more driving sessions; and (iii) determining the effective radius of the tire of the vehicle based on (a) sensed information gained during the at least one portion, the sensed information comprises values of the tire radius affecting parameters during the at least one portion, and (b) one or more relationships between the effective radius of the tire and tire radius affecting parameters.
US11745538B2

A bicycle rim is made with a plurality of layered, each of which is formed of structural fibres incorporated in a polymeric material. The rim has a radially outer peripheral channel with an upper bridge extending between the wings for holding a tyre. The peripheral channel comprises an inner layered structure, extending between wings and at least one wrapping layered structure, wound on the inner layered structure at least at the end of the wings, the inner layered structure and the wrapping layered structure being included in the plurality of layered structures.
US11745534B2

To prevent ink from dripping, drying, and the like. A writing utensil includes: a shaft tube; a writing chip that protrudes more toward the front than the shaft tube so as to discharge ink when pressed against a written face; and an ink supply part that supplies ink to the writing chip from a rear side, wherein the writing chip is at a separate position that is separated toward the front across a space with respect to the ink supply part and is moved due to a predetermined operation to a contact position where the writing chip comes into contact with the ink supply part from a front side.
US11745532B2

Flexographic printing members amenable to aqueous (or organic) development do not exhibit the deleterious effects on printing performance characteristic of some conventional alternatives. Embodiments of the invention utilize a photopolymerizable layer comprising, consisting of, or consisting essentially of a photopolymerization initiator and a water-dilutable (but not water-soluble) monomer.
US11745520B2

The present invention relates to a portable sublimation printer capable of simultaneously controlling up/down of a platen roller of a portable thermal sublimation printer and up/down of a printing medium pickup roller with a rack and pinion mechanism. A portable sublimation printer having a small thickness and a light weight to a rack apparatus of a portable sublimation printer is provided.
US11745517B2

A container body decorator (10) has a controller (300) with a software stored in a memory. A plurality of ink-jet printing heads (108) is in communication with the controller (300). A segmented image transfer blanket (116) has a circumferential configuration with an inner surface opposite a printing surface. A printing site (124) is located along the segmented image transfer blanket (116). A container body handling module (200) delivers container bodies to the printing site (124).
US11745516B2

A method for printing includes analyzing print quality requirements for a printing area; adjusting settings for heater elements (e.g., energy and/or firing durations) of strobe lines based on the requirements analysis; and providing a plurality of individual strobe signals to the strobe lines. The strobe signals can be transmitted simultaneously, for example with a field-programmable gate array. Analyzing print quality requirements can include separating the printing area into one or more areas of interest, such as rows and/or columns. For each area of interest individual print quality settings (e.g., darkness, contrast, and/or media sensitivity) may be selected.
US11745513B2

A liquid supplying device includes a tank and a cartridge configured to be attached to the tank. The cartridge includes a first storage chamber. The tank includes a second storage chamber, a liquid passage, a gas passage, and an air communication portion. The liquid passage has a first end formed with a first opening, and a second end formed with a second opening. The gas passage has a third end formed with a third opening, and a fourth end formed with a fourth opening. In an attachment state where the first storage chamber is in communication with both the second opening and the fourth opening, the first storage chamber has a portion positioned above the liquid passage and the gas passage, and the second storage chamber is positioned below the liquid passage and the gas passage.
US11745507B2

In various examples, a fluid ejection device may include a fluid ejection die formed with a first material and that includes a bondpad and a plurality of fluid ejectors, and a cover layer adjacent the fluid ejection die. The cover may be formed with a second material that is different than the first material and may include a first region that overlays the bondpad and a second region that overlays the plurality of fluid ejectors. In various examples, the first and second regions are separated by a break in the cover layer. The break may be filled with a third material that is different than one or both of the first and second material.
US11745488B2

[Object] To provide a method for the production of a thin plate-like laminate having a film-like resin layer in which a concave/convex shape can stably be formed with high accuracy on the film-like resin layer laminated on a thin plate-like substrate. [Achieving Means] There are provided a step of creating a mold retention structure 100 in which molds 110, which have been heated to a thermal deformation temperature of a film-like resin composition 84, are arranged on both surface sides of a workpiece 85, and a step of introducing the mold retention structure in which the heated molds are arranged between two compression rollers 52, 54 and compressing outer surfaces of the molds by rotating the compression rollers to integrally thermocompression-bond the film-like resin composition and a substrate 81 to form a thin plate-like laminate 80 having a film-like resin layer 82.
US11745485B2

An epoxy resin composition for carbon-fiber-reinforced composite material includes (A) a bisphenol F-type epoxy resin that is liquid at 25° C., (B) a polyfunctional amine-type epoxy resin, and (C) 3,3′-Diaminodiphenyl sulfone. With respect to 100 parts by mass of the entire epoxy resin in the epoxy resin composition, the content of component (A) is 40 to 60 parts by mass, the content of component (B) is 30 to 45 parts by mass, and the total content of components (A) and (B) is 85 to 100 parts by mass. The content of component (C) satisfies 1.04≤x/y≤1.35, where x is a molar number of active hydrogen atoms in the amine of component (C) and y is a molar number of all epoxy groups in the epoxy resin composition.
US11745484B2

A food wrap for wrapping ovenable foods includes a polyester layer having a thickness of about 12 μm having a first surface and a second surface opposite the first surface, a barrier layer comprising aluminum oxide covering at least a majority of the first surface of the polyester layer, a paper layer adhered to the barrier via an adhesive, where the paper layer has a grammage of about 35 g/m2, and a coating layer covering at least a majority of the paper layer, where the coating layer covers an ink label.
US11745482B2

The present disclosure relates to a fluororesin substrate laminate for a high-frequency circuit, the fluororesin substrate laminate including a fluororesin substrate and an adhesive layer provided on the fluororesin substrate, wherein the adhesive layer includes a resin composition containing: (A) a maleimide compound having a saturated or unsaturated divalent hydrocarbon group; and (B) an aromatic maleimide compound.
US11745478B2

The present disclosure provides a transparent elastic composite film, which includes a first film layer; a thermoplastic polyurethane layer; and a second film layer; wherein the first film layer and the second film layer have a crosslinked network structure; the first film layer includes acrylic resin and aliphatic polyisocyanate, wherein the acrylic resin includes hydroxyl-containing acrylic resin, and a weight ratio of the acrylic resin to the aliphatic polyisocyanate is 1/1 to 1/1.2, and a weight ratio of the hydroxyl-containing acrylic resin to the acrylic resin is 0.1/1 to 0.18/1.
US11745475B2

A textured release sheet includes a substrate including a top side and a bottom side. A matte surface is formed on the bottom side thereof, wherein the matte surface of the surfacing material is a coating of an radiation curable material applied to the bottom side of the substrate. The coating is an UV curable acrylate mixture applied to the substrate, wherein the UV curable acrylate mixture is irradiated with UV-radiation via an excimer laser emitter to produce a UV-irradiated layer wherein the UV curable acrylate mixture is only crosslinked on the surface thereof, which produces a matting surface through the effects of a micro-convolution.
US11745467B2

An object including a. a fiber reinforced plastic and b. a ceramic material, wherein the ceramic material is prepared by plasma electrolytic oxidation of aluminium. A process for the preparation of the object, including the steps of a. providing aluminium, a fiber reinforced plastic and a resin, or providing aluminium and a precursor of a fiber reinforced plastic comprising fibers and a resin, b. treating, at least partially, the aluminium with plasma electrolytic oxidation to provide a ceramic material, c. attaching the ceramic material to the fiber reinforced plastic with the resin, or attaching the ceramic material to the fibers with the resin, d. curing the resin to provide the object including the fiber reinforced plastic and the ceramic material at least partly bound to the fiber reinforced plastic.
US11745465B2

External thermal insulation composite systems described herein include a concrete or masonry wall and a multilayer thermal insulation board disposed on the concrete or masonry wall. The multilayer thermal insulation board includes at least one closed cell foam layer comprising polyurethane and polyisocyanurate having an open cell volume of less than 20% by volume according to ASTM D 6226 and at least one open cell foam layer comprising polyurethane and polyisocyanurate having an open cell volume of greater than 80% by volume according to ASTM D 6226.
US11745455B2

In a method for producing an unvulcanized ring-shaped rubber member a front edge portion of a band-like rubber member conveyed by a conveyor is disposed on an outer circumferential surface of a forming drum, and the forming drum is rotated to wind a length of the band-like rubber member on the outer circumferential surface and a rear edge portion is held by rear edge holding portions arranged side by side in a width direction. Using distribution data on a length of the band-like rubber member in the width direction, an amount of movement of movement portions in a front-rear direction is controlled to adjust the degree of elongation around the held portion of the rear edge portion in the front-rear direction that is held by each of the rear edge holding portions, and the front and rear edge portions are bonded to produce a ring-shaped rubber member.
US11745447B2

A tacking device may comprise: a handle; a main body extending from a first end of the handle to a second end of the handle; and a plurality of soldering irons, each soldering iron in the plurality of soldering irons extending from a first side of the main body through the main body to a second side of the main body, each soldering iron in the plurality of soldering irons including a piercing end disposed on the second side of the main body.
US11745443B2

Composite structures and methods of forming composite structures are provided. The composite structures can include one or more composite structure components. Each composite structure component is formed from a composite panel that includes one or more sheets of material. The sheets of material include a thermoplastic material and a plurality of reinforcing fibers. A composite panel can be formed in three dimensions to form a composite structure component. Multiple composite structure components can be fused to one another to form a composite structure. In addition, each composite structure component and the composite structure formed therefrom can include an aperture. An interior volume can be formed between adjacent composite structure components. Methods for forming a composite structure can include a step of simultaneously molding and fusing composite structure components.
US11745441B2

A method for the manufacture of a fiber-composite article for a bicycle frame or other bicycle component uses an outer mold configured to define an outer surface of the fiber-composite article and an inner mold configured to define an inner surface of the fiber-composite article. The method comprises: securing in the inner mold a supportive armature for a space-filling mandrel, the mandrel being configured to occupy a space within the inner surface of the fiber-composite article during lay up and curing of the fiber-composite article; forming the mandrel by injection molding a solidifiable fluid into the inner mold, around the armature, the solidifiable fluid being configured to form a solidified, molded material; applying a fiber composition to the mandrel; securing the mandrel with the fiber composition in the outer mold; heating the fiber composition in the outer mold to form the fiber-composite article and concurrently heating the solidified, molded material. In this manner, the fiber composition is compressed into the outer mold due to expansion of the solidified, molded material.
US11745431B1

A rapid DLP 3D printing control parameter optimization method combining continuous and layered molding includes the following steps: confirming the maximum printable distance of each slice by analyzing the printable area of the model slice. The liquid-liquid interface printing scene was further established, and the flow behavior of the resin between the printed object and the fluorinated oil after printing a layer of slices was simulated and recorded. Next, determine the printing mode of the current slice by slicing the maximum printable distance and numerical simulation model. Then, based on Poiseuille flow, Jacobs working curve and Lambert-Beer law, the resin curing time of continuous and layered printing, the maximum filling distance of continuous printing, the best lifting distance of layered printing, and the corresponding printing platform lifting of the two methods are expressed speed. Finally, camera monitoring is used to determine the print origin before printing starts. This method can achieve fast printing of any model by obtaining the optimal control parameters, while being portable and printable.
US11745427B2

A hybrid laser printing (HLP) technology that utilizes ultrafast laser in sequential additive-subtractive modes to create 3D hydrogel constructs. The approach involves the synergistic use of additive crosslinking and subtractive ablation processes that are conventionally mutually exclusive. HLP can be operated at virtually any penetration depth and allow fabrication of multi-layer hydrogel constructs at micrometer resolution. HLP was used to print ready-to-use functional chips using commonly used hydrogels for potential cellular communication and migration applications. HLP was also found to be compatible with in situ printing of cell-laden hydrogel constructs. HLP makes shaping of soft hydrogels into 3D multiscale functional devices possible.
US11745423B2

Methods and apparatus for additive manufacturing. In a method for additive manufacturing, a build sheet can be positioned on a print substrate of a printer. An object can be printed on the build sheet. The object can be detached from the build sheet. Advantageously, the build sheet can prevent the object from shifting on the build sheet during printing. Removing the build sheet from the object does not result in significant deformation or bending of the object. Damage to the object can be prevented. The object does not require additional cleaning or finishing for removing any residual or material. The build sheet can be ready for reuse. The build sheet can advantageously have mechanical strength to sustain removal of the build sheet from the object.
US11745413B2

Methods of nanomanufacturing based on continuous additive nanomanufacturing at fluid interfaces (CANFI). This approach is a fabrication technique that involves, for example, photocuring or “printing” self-assembled layers. CANFI presents a fabrication capability with significant transformative potential improve (i) the spatial resolution, (ii) the speed, and (iii) the range of material compositions that can be printed. Various articles of manufacture can be made using the methods.
US11745412B2

Described herein are apparatuses, systems, and methods for fabricating tissue constructs, such as by fabricating perfusable tissue constructs by embedding a sacrificial material into a composite matrix yield stress support bath. A composite matrix bath can include a microgel filler and a hydrogel precursor. An extrusion tip can be used for embedded printing of perfusable tissue constructs by disposing sacrificial material into the composite matrix bath while the extrusion tip travels along a predefined course through the composite matrix bath. This sacrificial material can be the printed tissue construct or can be removed to render the matrix bath a perfusable tissue construct. The composite matrix bath can include acellular or cell-laden hydrogels. The sacrificial material can include a salt and a physiological buffer or a non-cytotoxic porogen material. The hydrogel precursor can include at least one of gellan and gelatin. Cross-linking can be carried out chemically, thermally, enzymatically, or physically.
US11745404B2

A rubber strip manufacturing method that includes a step of extruding a rubber from an extrusion orifice of an extruder includes: a step of forming a long rubber member by extruding the rubber from the extrusion orifice that is circular; and a step of forming a rubber strip by passing the long rubber member through a gap between a pair of rotating rollers. The gap has a shape that is the widest in a central portion in a direction parallel to rotation axes of the rollers and that narrows as a distance from the central portion increases.
US11745401B2

A manufacturing equipment, for manufacturing a molded circuit board assembly of a camera module, includes an upper mould, a lower mould, a mould fixing arrangement, and a temperature controlling arrangement, wherein the mould fixing arrangement controls opening and closing of the upper mould and the lower mound. When a substrate board is placed between the upper mould and the lower mound, a molding cavity is further formed between the upper mould and the lower mound, wherein in the molding cavity, a supporting frame forming groove is formed for forming the module support, and a light window forming element is used for forming a light window. The temperature controlling arrangement provides a molding temperature, the module supporting frame is integrally molded on the substrate board to form the molded circuit board assembly.
US11745400B2

A mold comprising a first mold element and a second mold element releasingly engagable between an open position and a closed position to define a mold cavity in the closed position and a first part line between the first mold element and second mold element. The first mold element comprises a first mold portion and a second mold portion configured to be reversible separable with respect to one another to define a second part line therebetween disposed interiorly with respect to a periphery of the first part line. At least one vent is disposed in the second part line. In one embodiment, the at least one vent comprises a passageway configured to permit mold material in the mold cavity to enter but not to exit the passageway to cause at least partial curing of the mold material in the passageway.
US11745398B2

A foaming method and apparatus for products comprising a frame (T) on which a first containment jig mould (1) is supported, at least one foaming unit, and a loading trolley (20) provided with a controlled conveyor (21) for transferring said components from an inlet line (Li) inside said containment jig (1), wherein it includes at least a second containment jig (10) arranged above said first containment jig (1) constrained to the same fixed frame (T), a removal trolley (30) arranged on the side opposite said loading trolley (20) with respect to said containment jigs (1, 10), between said containment jigs (1, 10) and an outlet line (Lu), wherein said loading trolley (20) and removal trolley (30) are vertically movable, by means of respective controlled lifts (22, 32), between a lower position and one or more service positions in which they are arranged adjacent to said jigs (1, 10).
US11745392B2

According to some aspects, a method is provided of casting an object from a mold, the method comprising obtaining a mold comprising a hollow shell of rigid material, the material comprising a thermoset polymer having a plurality of pores formed therein, providing a metal and/or ceramic slurry into an interior of the mold, exposing at least part of the mold to a low pressure environment so that a net flow of gas is produced from the interior of the mold into the low pressure environment. According to some aspects, a method of forming a porous mold is provided. According to some aspects, a photocurable liquid composition is provided, comprising a liquid photopolymer resin, particles of a solid material, in an amount between 30% and 60% by volume of the composition, and a water-soluble liquid.
US11745385B2

A manufacturing system includes a tape advancing through the manufacturing system and a station of the manufacturing system. The tape includes a first portion having grains of an inorganic material bound by an organic binder. The station of the manufacturing system receives the first portion of the tape and prepares the tape for sintering by chemically changing the organic binder and/or removing the organic binder from the first portion of the tape, leaving the grains of the inorganic material, to form a second portion of the tape and, at least in part, prepare the tape for sintering.
US11745384B2

A thin-walled honeycomb body (100) having a plurality of repeating cell structures (110) formed of intersecting porous thick walls (112V, 112H) and thin walls (114V, 114H). Each repeating cell structure (110) is bounded on its periphery by the thick walls (112V, 122H) of a first transverse thickness (Tk) and the thin walls (114V, 114H) have a second transverse thickness (Tt) that subdivides each repeating cell structure (110) into between 7 and 36 individual cells (108). In the thin-walled honeycomb body (100), the first transverse thickness (Tk) of the thick walls (112V, 112H) is less than or equal to 0.127 mm (0.005 inch) and the second transverse thickness (Tt) of the thin walls (114V, 114H) is less than or equal to 0.0635 mm (0.0025 inch), and Tk>Tt. Honeycomb extrusion dies and methods of manufacturing the thin-walled honeycomb body (100) having thick walls (112V, 112H) and thin walls (114V, 114H) are provided.
US11745383B2

A pottery wheel with an improved throwing arm that pushes the clay towards the center of the spinning plate, in an arc shaped motion, defined by four directions of motion, with the throwing arm providing an inward force towards the direction of rotation and towards the axis of rotation, that also allows for micro-adjustments to be easily made, is disclosed. Various tool accessories can then be used to open the pottery and form the pottery. The embodiments of the present invention are suitable for use by children, individuals unskilled in the art of pottery, and individuals lacking fine motor skills due to the assistance provided by the features of present embodiments, including an improved throwing arm removably attached to the housing. Embodiments of the present invention also include numerous attachments designed to work in tandem with the improved pottery wheel and throwing arm assembly.
US11745370B2

A razor assembly is disclosed. The present disclosure in at least one embodiment provides a razor assembly, comprising: a cartridge including at least one blade; and a handle assembly, wherein the handle assembly includes: a heating bar disposed on the handle assembly; at least one induction coil which is disposed under the heating bar and configured to heat the heating bar in a contactless manner; and a grip portion.
US11745368B2

A personal care device has a main functional unit and an ancillary functional unit which is displaced between a non-operational position and an operational position using a biasing arrangement. A magnet arrangement is used to exert a magnetic holding on the ancillary functional unit in the operational position. This provides a stable support of the ancillary functional unit in the operational position without requiring a strong biasing arrangement.
US11745358B2

A robotic apparatus including a plurality of rigid body sections that move relative to each other by one or more multi-degree of freedom joints. The robotic apparatus can traverse a fixed frame by attaching its distal ends to the frame and moving the rigid body sections relative to each other.
US11745357B2

A robotic arm capable of reducing the size while suppressing damage to a plurality of elongated members inserted therein, is provided. The robotic arm to which an end effector is attached, includes plurality of elongated members extending to end effector, cylindrical housing defining a periphery of internal space configured to be a passage of plurality of elongated members, and an attaching structure provided to a tip end of the internal space of the cylindrical housing so as to attach the end effector to a tip-end part of the cylindrical housing. The attaching structure includes insertion holes formed corresponding to plurality of elongated members so as to insert the plurality of elongated members therein, and fixing members configured to fix the plurality of elongated members to the insertion holes, respectively. The cylindrical housing is formed so that the inner diameter is larger at the tip-end part than at a base-end part.
US11745356B2

An autonomous construction robotic system is disclosed which includes a processing unit, a robotic arm, the robotic arm is adapted to be coupled to a central attachment arm and thereby position the central attachment arm according to a plurality of degrees of freedom, a panel handling and fastening system, including a panel handling assembly coupled to the central attachment arm and adapted to pick and place a construction panel onto a framed structure within a construction zone, and a vision system adapted to provide visual information to the processing unit associated with the framed structure, wherein the processing unit processes the visual information to automatically determine placement position of the construction panel on the framed structure.
US11745355B2

A control device sets a relative relation amount between a plurality of target objects that are to be final objectives, repeatedly acquires observation data from a sensor and calculates the relative relation amount between the plurality of target objects existing in the environment from the acquired observation data. Further, the control device determines a series of the relative relation amounts in a state that is to be an objective from the relative relation amount at a time point at which control of the behavior starts until the relative relation amount as the final objectives is realized, and repeatedly determines control instructions so as to change the relative relation amount in a present state calculated from the latest observation data into the relative relation amount in a state of an objective to be transitioned to next. Then, the control device outputs the determined control instruction to a robot device.
US11745347B2

Candidate grasping models of a deformable object are applied to generate a simulation of a response of the deformable object to the grasping model. From the simulation, grasp performance metrics for stress, deformation controllability, and instability of the response to the grasping model are obtained, and the grasp performance metrics are correlated with robotic grasp features.
US11745341B2

Movement of an object can occur while a control system corrects for compliance within a robotic system. The control system can include the object to be moved, the robotic system that moves the object, a primary sensor positioned on the object, at least one ancillary sensor positioned on the object, and a controller. The sensors can record position and orientation data at different points on the object. The controller can use a sensor data and a delta value to correct for compliance in the robotic system. The delta value can be based on the differences between the primary sensor and the at least one ancillary sensor. The compliance correction can be applied to poses of the object to modify the trajectory of the object for more accurate movements.
US11745331B2

A teleoperated robotic system that includes master control arms, slave arms, and a mobile platform. In use, a user manipulates the master control arms to control movement of the slave arms. The teleoperated robotic system can include two master control arms and two slave arms. The master control arms and the slave arms can be mounted on the platform. The platform can provide support for the master control arms and for a teleoperator, or user, of the robotic system. Thus, a mobile platform can allow the robotic system to be moved from place to place to locate the slave arms in a position for use. Additionally, the user can be positioned on the platform, such that the user can see and hear, directly, the slave arms and the workspace in which the slave arms operate.
US11745321B2

An apparatus for assisted buckle release employing a generally C-shaped, V-shaped, or U-shaped assistive device adapted to depress a buckle's release button, such as a button typical of a child car seat restraint harness, and thereby assist in unlocking the buckle.
US11745320B2

A torque wrench has a lock device, which includes a locking sleeve, a restoring elastic member, a clamping member, a locking hole, a locking member, and a positioning assembly. The locking sleeve is provided with an accommodating recess, an abutting portion, and a positioning recess. When the lock device is in a lock position, the locking member is pushed by the abutting portion and pressed against a hollow shank to restrict a handle from rotating relative to the hollow shank. When the lock device is in an unlock position, the locking member is detached from the abutting portion, so that the handle is rotatable relative to the hollow shank.
US11745319B2

A torque wrench may include a head having a driving member configured to be operably coupled to a socket, a handle, a lever arm operably coupled to the head and the handle at respective opposing ends thereof, and a torque adjuster configured to enable a torque setting of the torque wrench to be adjusted. The torque adjuster may include a fixed member affixed to the lever arm and a movable member operably coupled to the fixed member. The handle may include a first end cap at a distal end thereof relative to the head and a second end cap at a proximal end thereof relative to the head, the second end cap being disposed proximate to the movable member.
US11745317B2

An adjustable socket assembly includes a collet having a first end, a second end, and a perimeter wall. The second end has a receiving aperture therein. The collet is divided into a plurality a plurality of sections. A sleeve has a bottom end that receives the collet. The sleeve has an interior surface that tapers inwardly and abuts the sections to move toward each other as the sleeve moves toward the second ends of the sections. A biasing member extends through a top end of the sleeve and engages each of the sections. The biasing member is actuated to bias the sleeve downward to close together the sections and engaged the valve actuator. An engagement head is attached to the upper end of the biasing member and engages a tool to rotate the collet.
US11745313B2

A hand tool includes a first jaw, a first handle fixed to the first jaw, a second jaw, and a second handle pivotally coupled to the second jaw, a link member, and an adjustment member. The adjustment member is operable to axially move a first end of the link member to vary a distance between the first and second jaws. The adjustment member includes an engagement surface engageable with the first end of the link member, a shank in threaded engagement with a bore in the first handle, and a flange extending from the shank opposite the engagement portion. The flange includes a first side, a second side opposite the first side, and an elongate opening extending through the first and second sides.
US11745312B2

The clamping device includes a pair of clamping members arranged in positions to clamp a rib (target portion to be clamped) of a workpiece and having contact surfaces to make contact with the rib; supports configured to support each of the pair of clamping members so as to be able to advance and retreat along a prescribed advancing/retreating direction relative to the rib, and to operate each of the pair of clamping members so as to clamp the rib when advancing; guiding units configured to make each of the pair of clamping members movable in a prescribed positioning direction due to a reaction force occurring when the pair of clamping members clamp the rib; and coil springs (biasing members) configured to elastically bias the pair of clamping members in a direction opposite the positioning direction, thereby capable of positioning the workpiece with high precision without damaging the workpiece.
US11745310B1

Disclosed herein are systems and methods for improving the performance of a fluid jet cutting system by testing and adjusting characteristics of the system based on the effect of the characteristics on forces imparted by the system to a workpiece being cut. Also disclosed are systems and methods for monitoring and validating the performance of fluid jet cutting systems, and for diagnosing such systems. In some cases, the technologies described herein can be used to determine whether components of a fluid jet system require maintenance, or that characteristics of the system require adjustment.
US11745300B2

A deburring device includes a cylindrical body with a receptacle for receiving a pipe. The cylindrical body includes an abrasive surface provided in the receptacle, which is configured to simultaneously deburr at least two surfaces of a pipe inserted into the receptacle.
US11745292B1

A glass panel processing method includes a first deformed portion formation step in which, in order to form a via-hole in a glass substrate, a first deformed portion is formed to a first depth from the upper surface of the glass substrate through irradiation with a laser beam along a planned via-hole line, a second deformed portion formation step in which, in order to cut the glass substrate into unit cells, a second deformed portion is formed to a second depth in the glass substrate through irradiation with a laser beam along a planned cutting line, and an etching step in which, the glass substrate with the first deformed portion and the second deformed portion formed therein is etched such that etching of the glass substrate along the planned cutting line is completed before completion of etching of the glass substrate along the planned via-hole line.
US11745288B2

A pressure measuring device includes a ceramic pressure sensor including a ceramic measuring membrane and a sensor mounting configured to secure the pressure sensor such that a membrane region of the measuring membrane surrounded by a membrane edge is contactable with a medium having a pressure to be measured. The sensor mounting includes a titanium or titanium alloy mounting element including an opening through which the membrane region is contactable with the medium. The membrane edge is connected directly with the mounting element by a diffusion weld produced by a diffusion welding method.
US11745286B2

An example welding-type power supply includes: power conversion circuitry configured to convert input power to welding-type power, and to output the welding-type power via a welding-type circuit; a temperature sensor configured to measure a temperature of at least one component of the welding-type power supply; and stray current detection circuitry configured to detect stray welding-type current based on the measured temperature of the at least one component.
US11745282B2

An engine-driven welder/generator is controlled by an integrated controller that is coupled to both the engine and to the welder/generator. The controller receives input signals for operational parameters of the engine, and additional signals indicative of electrical output by the welder/generator. Operation of the engine and welder/generator may thus be coordinated. The controller may control speed, timing, fuel injection, and so forth of the engine, and output of the welder/generator, such as by control of input to a field coil.
US11745281B2

A solder removal apparatus is provided. The solder removal apparatus comprises a plurality of solder-interfacing protrusions extending from a body by a length. Each of the plurality of solder-interfacing protrusions is configured to remove a corresponding one of a plurality of solder features from a semiconductor device, where each of the plurality of solder features has a height and an amount of solder material.
US11745278B2

An additive manufactured workpiece includes one or more cavities having an inner surface. A dielectric interface is formed in the cavity, and conforms to the inner surface. The additive manufactured workpiece further includes an in-situ electrode in the cavities. The dielectric interface is interposed between the in-situ electrode and the inner surface of the workpiece.
US11745277B2

A table shear may include a clamp and a shearing mechanism, the shearing mechanism supported by the clamp. The shearing mechanism may include a fixed lower shear blade, a lower shear blade backup plate supporting the fixed lower shear blade, a moveable upper shear blade and a shear compression cylinder. The shear compression cylinder abuts the movable upper shear blade.
US11745274B2

The present disclosure belongs to the field of machining of chamfers of holes. The hole chamfering device includes blades in bilateral symmetry and a blade distance adjusting, through the blade distance adjusting, the distance between the blades on the left side and the right side can be adjusted, thus, after the blades on the left side and the right side of the hole chamfering device process chamfers on the front face of a hole, the distance between the blades is reduced to enable the blades to pass through the hole to process chamfers on the back face of the hole, after processing of the chamfers on the back face of the hole is completed, the distance between the blades is reduced, the hole chamfering device not only can chamfer the front face of the hole, but also can chamfer the back face of the hole.
US11745268B2

A three-dimensional (3D) metal object manufacturing apparatus is equipped with a wire detector to determine a position of a top surface of melted metal contained in a receptacle of a heated vessel in the apparatus from time to time. The solid metal wire being fed into the heated vessel is retracted and the length of the retracted wire is determined using a signal generated by the wire detector. The determined length of the wire is used to identify the position of the top level of the melted metal in the receptacle so the receptacle can be replenished if the level has fallen below a predetermined capacity for the receptacle.
US11745261B2

A sintered gear of annular shape which has a composition including a metal, has a plurality of pores in a surface thereof, and has a relative density of 93% or more and 99.5% or less.
US11745254B2

A foundry mold includes at least one molding cavity and one pair of feeder arms. The molding cavity extends, along a horizontal axis, from a first end to a second end, and the first pair of feeder arms comprises a first feeder arm, oriented in a substantially vertical direction and connected to the first end of the first molding cavity, and a second feeder arm, substantially parallel to the first feeder arm and connected to the second end of the first molding cavity.
US11745251B2

A multiple anvil fixture possesses multiple anvils engaged to a base in a fixed relation to each other with the anvils oriented in a common direction. Each of the anvils includes a first structure and a second structure. The first structure and the second structure are slidably engaged. Each of the anvils has an extended position and a recoiled position and a biasing-element to bias the first structure and the second structure in the extended position. The multiple anvil structure can be used to rivet brackets onto containers. The anvil protrudes through the container in the extended position to help align holes in the feet of the brackets with openings in the container. The anvil then recoils beneath the container to serve for the fixation of rivets.
US11745244B2

A machine for bending an elongated workpiece without wrinkling has a roller-like bending die (2) with a vice (3) adapted to retain one end of the elongated workpiece (P) to be bent. The roller-like bending die (2), being provided with a central hole (5) and a groove profile (6) and rotatable about a rotation axis (y), bears, centrally and coaxially in its groove profile (6), a plate element (18) oscillating with respect to the bending die (2) around a rotation axis (y) thereof. The plate element (18) having a peripheral edge (19) which continues the groove profile (6) of the bending die (2) consists of at least two pieces (20, 21) which are adapted to be connected to one another to surround the bending die (2).
US11745243B2

A multi-axis roll-forming system for forming a stepped diameter in a cylinder includes a support that spins about a rotation axis while supporting a workpiece that includes the cylinder. A first actuator translates a first roller perpendicularly to the rotation axis. A second actuator moves a multi-axis roller radially outward, relative to the rotation axis, and upward along the rotation axis. The system may also include a first roller arm to which the multi-axis roller is coupled. The first roller arm is connected to a pivot joint having a pivot axis that is perpendicular to the rotation axis. The second actuator may include a linear-drive actuator that is coupled to the first roller arm and extends along the rotation axis to force the multi-axis roller to pivot about the pivot axis.
US11745241B2

A bending machine for metal sheets includes a punch arrangement that supports a set of upper bending tools, a die arrangement that supports at least one set of lower bending tools, a tool magazine of bending tools, a replacing apparatus arranged to take bending tools from the tool magazine and mount them on the punch arrangement and/or the die arrangement and vice versa, and a gripping device configured to simultaneously clasp and move a whole set of bending tools. The tool magazine comprises a plurality of supporting guides that house respective sets of bending tools and a transfer carriage arranged to house a set of bending tools and movable between an exchange position to receive from, or provide to, the gripping device a set of bending tools and a plurality of loading positions to transfer to, or receive from, a supporting guide a set of bending tools.
US11745239B2

A profiling station, a profiling unit formed therefrom and also a profiling installation continuously form a material strip into a profile. The profiling station includes a rack frame, a profiling arrangement with a forming roller and also a first and a second counter roller as well as a drive assembly. A first roller axis and a second roller axis of the counter rollers form between them a buckling angle, wherein the counter rollers define a bending edge for the material strip to be formed. The first counter roller and also the second counter roller are driven by the drive assembly in such a way that the first counter roller has a circumferential speed at its outer circumference and the second counter roller has a circumferential speed at its outer circumference that are equal to one another.
US11745222B2

Provided is a method of controlling a conveyor for item transportation and an electronic apparatus therefor, the method including acquiring information associated with a plurality of destinations, identifying a weight for each of the plurality of destinations based on the acquired information, determining, in response to an item being identified, a destination among the plurality of destinations based on the identified weight, wherein the item is placed in the determined destination, and controlling the conveyor to transport the item to the determined destination.
US11745197B2

An adapter receives two separate fluids from a container having two separate fluid compartments and combines the fluids into a single fluid stream for delivery to a spray fluid dispenser. The adapter comprises a unitary housing having a first open end for fluid connection to the container and a second open end for fluid connection to the spray fluid dispenser. The housing defines a manifold forming a fluid passageway therein between the first end and the second end. The manifold includes two separate first conduits formed at the first end. Each of the first conduits is connected to a respective one of the fluid compartments. The manifold further includes a second conduit in fluid communication with the second end for delivery of the combined fluids to the spray fluid dispenser. The first conduits are each in fluid communication with the second conduit.
US11745194B2

The disclosure concerns an applicator (e.g. print head) for applying a coating agent (e.g. paint) to a component (e.g. motor vehicle body component), having a nozzle chamber with a plurality of nozzles for dispensing the coating agent in the form of continuous jets or droplets, the coating agent flowing during operation through the nozzle chamber to the nozzles so that the nozzle chamber is filled with the coating agent during operation. The print head further comprises a plurality of slidable valve needles associated with the individual nozzles and selectively opening or closing the respective nozzle depending on the position of the valve needles. Furthermore, the print head according to the disclosure contains an actuator chamber for receiving actuators for displacing the valve needles. In addition, the applicator according to the disclosure has a sealing element which fluidically separates the actuator chamber from the nozzle chamber in order to avoid contamination of the actuator chamber with the coating agent in the nozzle chamber. The disclosure provides that the sealing element is designed such that the individual valve needles can be displaced independently of one another without a displacement of one of the valve needles impairing the opening and closing of the nozzles at the adjacent valve needle.
US11745191B2

A dispenser for a pressurized container is provided with an outlet channel that opens into a nozzle housing intended to receive and retain a nozzle (40) provided with a retention ring (43). The nozzle housing has a tubular wall (34) that is open towards the outside at its end opposite to the outlet channel. The tubular wall (34) is provided, at a distance from its end open towards the outside, with a support surface (341) that extends over at least a portion of its periphery and behind which at least a portion of the retention ring (43) of a nozzle introduced into the nozzle housing can come into engagement.
US11745188B2

A horizontally fed disk grinding system includes a tray coupled to a trailer for receiving bulk material. The system further includes a grind hub coupled to the trailer and a cutter disk coupled to the grind hub. The grind hub is structured to rotate about a grind hub axis and the cutter disk is structured to rotate about a cutter disk axis and about the grind hub axis. A grind ring is coupled to the trailer and is structured to slide to engage the grind hub during use. A plurality of plates are coupled to the tray and structured to oscillate to feed material from the tray to the grind hub and the cutter disk, where the material is reduced to particulate form. The grind hub further includes an outlet and a conveyor rotatably coupled to the trailer to convey the particulate material away from the outlet to a selected location.
US11745185B2

A reagent container according to an embodiment is used in an automatic analyzing system configured to measure a liquid mixture of a tested specimen and a reagent. The reagent container includes a case, a bag, and an outlet. The case is stored in a reagent storage. The bag is built in the case, is more flexible than the case, and is configured to contain the reagent. The reagent is taken out through the outlet.
US11745180B2

Microfluidic systems, pumps, valves and applications of the same are provided. The microfluidic system may be a pump or a valve having a fluidic chip and an actuator controlling the opening and closing of the fluidic channel in the fluidic chip. The actuator may be disposed to tilt from the fluidic chip, forming a tilted-rotor peristaltic pump. Alternatively, the actuator may be a rolling ball actuator, and different fluidic chips may be used in different applications. For example, the fluidic chip may be a spiral pump chip having spiral channels, a rotary peristaltic pump chip having multiple output channels, or a multi-port valve chip having one port interconnected with multiple different ports. An analytical valve chip may switchably interconnect bioreactor and rinse/calibration input channels to sensor and waste output channels. The actuator of a random-access valve can move from one valve position to another without opening or closing intermediate ones.
US11745177B2

A system and method for lysing of whole blood for CO-Ox measurement uses a lysing chamber for acoustic lysing of whole blood in a module in which the lysing chamber is separate from a CO-Ox measurement chamber. The disclosed acoustic lysing system and method avoids the expense and complexity of chemical lysing methods and allows the whole blood sample to be lysed while under continuous flow through the lysing chamber. The acoustic lysing chamber is provided upstream from a CO-Ox measurement chamber. The separation of the lysing chamber from the Co-Ox measurement chamber provides freedom to arrange and orient various optical components and/or other CO-Ox measuring components around the CO-Ox measurement chamber. The decoupling of the lysing chamber from the CO-Ox measurement chamber allows for more efficient design of the ultrasonic lysing transducer and CO-Ox measurement optics.
US11745174B2

Embodiments relate to a method of producing a modified double metal cyanide complex, a method of producing a monol or polyol that includes providing the modified double metal cyanide complex, an alkylene oxide polymerization process that includes providing the modified double metal cyanide complex, a batch, semi-batch, or continuous manufacturing process that includes providing the modified double metal cyanide complex, and a polyether polyol prepared using the batch, semi-batch, or continuous manufacturing process that includes providing the modified double metal cyanide complex.
US11745173B2

A three-way catalyst article, and its use in an exhaust system for internal combustion engines, is disclosed. The catalyst article for treating exhaust gas comprising: a substrate comprising an inlet end and an outlet end with an axial length L; a first catalytic region comprising a first platinum group metal (PGM) component and a first PGM support material, wherein the first catalytic region comprises up to 5 wt. % Sn.
US11745167B2

A polymer matrix composite comprising a porous polymeric network; and a plurality of functional particles distributed within the polymeric network structure, and wherein the polymer matrix composite has an air flow resistance at 25° C., as measured by the “Air Flow Resistance Test,” of less than 300 seconds/50 cm3/500 micrometers; and wherein the polymer matrix composite has a density of at least 0.3 g/cm3; and methods for making the same. The polymer matrix composites are useful, for example, as filters.
US11745159B2

Defined sequence RNA synthesis by 3′→5′ direction is now well established and currently in use for synthesis and development of vast variety of therapeutic grade RNA and Si RNA etc. A number of such synthetic RNA requires a modification or labeling of 3′-end of an oligonucleotide. The synthesis of 3′-end modified RNA requiring lipophilic, long chain ligands or chromophores, using 3′→5′ synthesis methodology is challenging, requires corresponding solid support and generally results in low coupling efficiency and lower purity of the final oligonucleotide in general because of large amount of truncated sequences containing desired hydrophobic modification. We have approached this problem by developing reverse RNA monomer phosphoramidites for RNA synthesis in 5′→3′-direction. They lead to very clean oligonucleotide synthesis allowing for introduction of various modifications at the 3′-end.
US11745155B2

Embodiments relate to a hydraulic fracturing system that includes a blender unit. The system includes an auger and hopper assembly to receive proppant from a proppant source and feed the proppant to the blender unit for mixing with a fluid. A first power source is used to power the blender unit in order to mix the proppant with the fluid and prepare a fracturing slurry. A second power source independently powers the auger and hopper assembly in order to align the hopper of the auger and hopper assembly with a proppant feed from the proppant source. Thus, the auger and hopper assembly can be stowed or deployed without use of the first power source, which is the main power supply to the blender unit.
US11745147B2

The invention includes compositions and methods for promoting gas mixtures separations, such as a carbon dioxide and methane mixture. The composition of the invention is based on a curable polymerized room-temperature ionic liquid [poly(RTIL)].
US11745145B2

An ion-sensitive substance containing a crown ether structure composed of a repeating unit represented by formula (a): —CR1R2—CR3X—O— . . . (a) (in the formula, X is an organic group having an alkoxysilyl group at a terminal, and R1, R2 and R3 are each a hydrogen atom or a hydrocarbon group), and a part or all of the alkoxysilyl groups in the crown ether structure may be hydrolyzed to form a silanol group.
US11745140B2

Systems and methods for generating inerting gas on vehicles are described. The systems include a proton exchange membrane (PEM) inerting system, a pure water replenishment system configured to provide pure water to the PEM inerting system, wherein the pure water replenishment system is in fluid communication with the PEM inerting system to replenish water lost during operation of the PEM inerting system, and a control system configured to control operation of the pure water replenishment system to automatically replenish pure water to the PEM inerting system.
US11745138B2

Bayesian recursive estimation is used to analyze performance parameters of a membrane separation system based on historical operational data of a membrane system. Bayesian estimation considers historical data over prior time intervals to predict future membrane separation performance to avoid unexpected downtime and unanticipated maintenance. A set of state variables used for modeling performance is used with a degradation model of to anticipate performance changes and maintenance based on measured properties of permeate, non-permeate, and feed flows.
US11745133B2

Filter systems and methods described herein include one or more spacer elements positioned in the dirty air chamber along with the filter elements attached to the spacer elements. The dirty air inlet delivers a dirty air stream into the dirty air chamber along a dirty air flow axis.
US11745113B2

In a model coupler that detachably couples vehicles, energization between the vehicles in train organization is stabled regardless of curvature of a rail. A support member is swingable in line with the coupling part by extending from an attachment base side attached to a model vehicle toward a front end side facing the coupling partner and providing a front end under the coupling part. One energization part is attached to the support member and includes a first contact point formed on the attachment base side and a second contact point formed on the front end side. The first contact point is in contact with a first power collection member of the model vehicle, and the second contact point is in contact with a fourth contact point of the other energization part of the coupling partner.
US11745106B2

Disclosed are a method and system for controlling a movement of a ball in a sports game. A control method may include providing a customizing function enabling a user to generate a skill for a preset section by customizing at least one of the speed, trajectory and effect of a ball moving in the preset section in a sports game, storing at least one of the customized speed, trajectory and effect in association with the skill generated through the customizing function, and controlling a movement of the ball in the section using at least one of the speed, trajectory and effect stored in association with the activated skill in response to an activation of the skill for the section in a process in which a game instance for the sports game proceeds.
US11745102B2

A system and method for capturing and sharing console gaming data is described. Embodiments capture gameplay data directly at the gaming console, without the need for external hardware. This allows users to easily capture rich console gaming experiences and share them across a variety of outlets. In one embodiment, the methods described herein can be implemented with a patch or driver on the operating system of the user device, rendering it unnecessary to heavily modify the source code of the game.
US11745097B2

A human-machine interface involves plural spatially-coherent visual presentation surfaces at least some of which are movable by a person. Plural windows or portholes into a virtual space, at least some of which are handheld and movable, are provided by using handheld and other display devices. Aspects of multi-dimensional spatiality of the moveable window (e.g., relative to another window) are determined and used to generate images. As one example, the moveable window can present a first person perspective “porthole” view into the virtual space, this porthole view changing based on aspects of the moveable window's spatiality in multi-dimensional space relative to a stationary window. A display can present an image of a virtual space, and an additional, moveable display can present an additional image of the same virtual space.
US11745093B2

A system enables metadata to be gathered about a data store beginning from the creation and generation of the data store, through subsequent use of the data store. This metadata can include keywords related to the data store and data appearing within the data store. Thus, keywords and other metadata can be generated without owner/creator intervention, with enough semantic meaning to make a discovery process associated with the data store much easier and efficient. Usage of or communication regarding a data store are monitored and keywords are extracted from the usage or communication. The keywords are then written to otherwise associated with metadata of the data store. During searching, keywords in the metadata are made available to be used to attempt to match query terms entered by a searcher.
US11745088B1

A traction system comprising interchangeable hollow kick tails, mounting plates and traction pad material for mounting to the deck of a surfboard and skateboard, and a skateboard uniquely designed to have the same arched deck as a typical surfboard so that said mounting plates can be used to mount the hollow kick tails to surfboards and said skateboard. The kick tails are configured with a ramped face angled optimally for surfing. Different variations include a ramp to a flat top, a ramp to a vertical face, a ramp to an angled overhang and a ramp to a horizontal overhang. The wide ramp area design in the kick tails provides support for the entire rear foot while surfing and helps the surfer perform aggressive maneuvers without falling. The interchangeable kick tails can be removed from a surfboard and attached to a surfer's skateboard or removed from their skateboard.
US11745082B2

Techniques are provided for implementing a system for determining the range to a target object and orienting a map. In implementations, GPS data is used to determine the location of the system and an approximate distance from that location to the target. Based on the approximate distance, one or more parameters of operation of the system may be set. Modes of operation may be entered to further adjust parameters of operation. An optical pulse may then be projected at the target and its reflections collected and analyzed to calculate a distance measurement. A visual display may be adjusted based on the calculated distance estimate to the target.
US11745080B2

The present disclosure is directed to a system for sensor-based objective determination. An example apparatus includes memory, instructions, and processor circuitry to execute the instructions to at least compare time-synchronization data between a first signal and a second signal, the first and second signals received in response to a detected contact between a first participant and a second participant in an event, wherein the first signal is received from a first sensor operably coupled to the first participant, the first sensor to measure at least one first physical parameter of the first participant while the first participant is engaged in the event, and wherein the second signal is received from a second sensor operably coupled to the second participant, the second sensor to measure at least one second physical parameter of the second participant while the second participant is engaged in the event, and determine, based on (a) the time-synchronization data, (b) the at least one first physical parameter, and (c) the at least one second physical parameter, whether the detected contact between the first participant and the second participant exceeds one or more thresholds corresponding to a rules-based infraction associated with the event.
US11745079B2

Described herein are systems and methods of guiding a user to achieve musculoskeletal counterpulsation. A method may include receiving a cardiovascular cycle signal from a first sensor; determining a heart rate of the user based on the cardiovascular cycle signal; receiving a rhythmic musculoskeletal activity timing signal from a second sensor; determining an actual musculoskeletal activity cycle (MSKC) to cardiovascular cycle (CC) timing relationship; comparing the actual MSKC to CC timing relationship to a target MSKC to CC timing relationship; providing a recurrent prompt to the user as a timing indication for performance of a rhythmic musculoskeletal activity to guide the user to achieve a musculoskeletal activity cycle rate (MSKR) that approaches the target MSKC to CC timing relationship; and altering a feature of the recurrent prompt based on a determined alignment between the actual MSKC to CC timing relationship and the target MSKC to CC timing relationship.
US11745072B2

Embodiments of the present invention are directed to an adjustable-incline climbing wall. The climbing wall includes one or more climbing panels supported by a frame and a system for adjusting the incline of the frame to provide a climbing wall of a desired incline. The incline of the climbing wall may be adjusted by activating an actuator, which extends the upper portion of the frame a distance from a support wall, tilting the climbing wall to a desired incline. When the climbing wall is substantially vertically oriented, the system for adjusting the incline of the climbing wall may extend only a small distance from the support wall so that the adjustable-incline climbing wall has a relatively small footprint. In some embodiments, the climbing wall may also include one or more fitness accessories that can be brought to an optimal height for a particular user through adjustment of the climbing wall incline.
US11745071B2

A device to strengthen a person's arm muscles through the utilization of a portable device including a handle portion and a weight component with the two components separated by a flexible rod is provided. Such a device allows for the user to grip the handle portion and act as if they are throwing such a handle portion while the weight end moves along an arc defined through the length of the flexible rod. The resultant action is the generation of centripetal force along the defined arc with the reactive centrifugal force providing resistance to the user's arm muscles in a manner that is unique and heretofore unattainable through the utilization of a portable exercise device. The flexible rod component provides at least 1 foot (100 cm) of spacing between the handle portion and the weight portion.
US11745069B2

A golf putting stroke practicing device includes a box-like housing designed to lie on any appropriate surface such as a carpeted floor wherein the front and bottom panels of the housing are provided with semi-circular/half-round cutouts that together create the realistic illusion of a regulation golf hole. The front of the housing is configured to deflect errant shots away from the hole opening. The device is easily carried and stored and can hold a number of regulation balls when not in use.
US11745066B2

Embodiments of golf club heads, golf clubs, and methods to manufacture golf club heads and golf clubs are generally described herein. In one example, a golf club head includes a body portion having an interior cavity, a ledge portion extending outward from a back wall of the body portion, a filler material comprising a rubber compound in the interior cavity, a first set of mass portions that is closer to a toe portion edge of the body portion than to a heel portion edge of the body portion, and a second set of mass portions that is closer to the heel portion edge than to the toe portion edge. A face portion is coupled to the body portion to enclose the interior cavity and includes at least one back groove located proximate to a perimeter edge of the face portion. Other examples and embodiments may be described and claimed.
US11745055B2

A system and method for monitoring performance of a physical exercise routine. The system comprises a plurality of motion and position sensors configured to generate sensory information including at least a rate of movements of a user performing the physical exercise routine; a database containing routine information representing at least an optimal execution of the physical exercise routine; a training module configured to: compare the generated sensory information to the routine information to detect at least dissimilarities respective thereof, wherein the dissimilarities indicate if the pace of performing the physical exercise routine is incorrect; provide feedback to the user with at least instructions related to correcting the pace of performing the physical exercise routine; and a display for displaying the feedback.
US11745048B2

A bi-directional exercise machine has a work arm, first and second cams coupled to the work arm, a resistance mechanism, and a pulley assembly that couples the resistance mechanism to the work arm via the first and second cams so that movement of the work arm is resisted by the resistance mechanism according to first and second resistance profiles provided by the first and second cams, respectfully. A primary pulley cable has a first end coupled to the first cam and a second end coupled to the second cam. When the work arm is in a rest position, the ends of the primary pulley cable extend from cable tracks of the cams, respectively, at a tangent so that the resistance mechanism applies a resistance force on the work arm via the pulley assembly immediately upon movement of the work arm out of the rest position.
US11745046B2

A barbell rack (1) installable on a wall, comprising: a first upright (2) and a second upright (3) fixable to the wall and distanced from one another; a first pole (5) and a second pole (6) respectively associated to the first upright (2) and second upright (3), each of said poles (5, 6) having a plurality of holes (7) adapted to receive a support shelf (8), means for hinging (9; 10) each pole (5, 6) to the corresponding upright (2, 3) in such a way that each pole (5, 6) is movable between a use position, in which it is at a maximum distance from the corresponding upright (2, 3), and a rest position, in which it is at a minimum distance from the corresponding upright (2, 3).
US11745041B2

An exercising assembly for fitness training and rehabilitation includes a first base, which is positionable on a substantially horizontal surface. An engagement module is selectively engageable to the first base so that the engagement module is positioned proximate to a first end of the first base. A plurality of attachment elements is engaged to the first base, the engagement module, and to a plurality of tensioners. The attachment elements are selectively mutually couplable. A plurality of first interface elements is selectively engageable to the engagement module. Respective attachment elements of the plurality of attachment elements are engaged to each of the first interface elements. Respective tensioners thus are extendable between a respective first interface element and one or more of the first base and the engagement module. The respective tensioners provide resistance to the user moving the first interface elements.
US11745040B1

An exercise apparatus includes a seat to accommodate a person in a seated position, an upper back rest to support the person's back, a foot rest to the person's feet, and a lap engaging member spanning the person's lap. A first resistance device is connected to opposite ends of the lap engaging member to resist movement of the lap engaging member away from the seat. A second resistance device is connected to a handle to resist movement of the handle from a position behind the back rest toward the back rest. A person sits on the seat and performs a combination exercise involving both: (a) a hip thrust exercise, wherein the person thrusts her hips and the lap engaging member upward and away from the seat; and (b) a lat pull down exercise, wherein the person pulls the handle from an arm's length distance behind the back support to a position more proximate the upper back support.
US11745037B2

The invention relates to a control and regulating system of an oxygen-reducing system, comprising at least one inert gas generator (30a, 30b), at least one oxygen concentration sensor (31a, 40), at least one actuator (32, 33, 41) for releasing inert gas, wherein the control and regulating system comprises a plurality of signal-connected controller modules (22, 24), each configured or configurable so as to enable the execution of one or more regulating functions, wherein the regulating functions are decentrally distributed to at least two signal-connected controller modules (22, 24).
US11745031B2

A surgical instrument includes an end effector and a handle assembly. The end effector is configured to operate at a first energy level and at a second energy level. The end effector is further configured to transition between an open position and a closed position. The end effector is configured to grasp tissue in the closed position. The handle assembly includes a body, a trigger, and an activation element. The trigger is configured to pivot in a first direction relative to the body to actuate the end effector from the open position to the closed position. The activation element is configured to activate the end effector at either the first energy level or the second energy level. The trigger is configured to either activate the activation element or determine whether the end effector operates at the first energy level or the second energy level.
US11745030B2

A motion-enable device includes a mechanical switch and a capacitive sensor with a sensing region that is located adjacent to the mechanical switch. The mechanical switch enables a first signal when closed or actuated that indicates that the mechanical switch is in an active state. The capacitive sensor enables a second signal when a conductive object is disposed in the sensing region, where the second signal indicates that the capacitive sensor is in an active state. Enablement of operation of an apparatus depends on receipt of both the first signal and the second signal. The mechanical switch and the capacitive sensor act as the two separate switches required by functional safety requirements for a motion enable device. Because the sensing region of the capacitive sensor is adjacent to the mechanical switch, the first and second signals are generated when an operator actuates the mechanical switch with a single digit.
US11745028B2

Systems and methods are provided for generating surface brachytherapy applicators in which catheter channel trajectories are generated laterally from both sides of a cut plane bisecting an initial model of the surface brachytherapy applicator model, thereby mitigating the effects of patient-surface-induced curvature. The catheter channels may be defined based on catheter channel trajectories that are spatially distributed, relative to the cut plane, on both sides of the cut plane, and spatially offset relative to a patient-facing surface of the surface brachytherapy applicator model. In some example embodiments, catheter channel trajectories are spaced relative to the cut plane such that neighbouring catheter channel trajectories are evenly spaced along a set of contours. Prior to fabrication, the local radius of curvature of catheter channels may be adjusted in a manual or automated manner to exceed a threshold.
US11745026B2

The present invention provides for devices and methods of treating wounds, including general wounds, gum disease and gingival tissues post scaling/root planning, using a diode laser which generates a beam of light having a wavelength in the visible portion of the electromagnetic spectrum (400 nm-700 nm). Further disclosed are devices and methods capable of stimulating tissue regeneration at the site of a wound.
US11745025B2

Disclosed are a deep body spread microwave hyperthermia device for personal uses and an operation method thereof. The operating method may include generating a control signal to control patches attached to the skin of a user, dividing the control signal into a first signal and a second signal having a phase different from a phase of the first signal, transmitting the first signal and the second signal to patches attached to different positions, among the patches, and producing hyperthermia in a body of the user by radiating radio waves based on the first signal or the second signal received by each of the patches.
US11745021B2

A Graphical User Interface (GUI) for an external device used to program an implantable stimulator device is disclosed. The GUI includes aspects useful in adjusting the current magnitude provided at one or more of the stimulator device's electrodes. In particular, the GUI includes an amplitude slider, which allows the user to slide an indicator to increase or decrease the current magnitude at different rates depending on the length of the slide. The GUI further allows the user to prescribe drop back functionality, which reduces the current magnitude by a prescribed amount when the indicator is released. In one example, drop back functionality can be engaged in accordance with a rate threshold, and thus drop back functionality will only occur when the rate of increase equals or is above the threshold when the control button is released.
US11745018B2

A method and device for dynamic device based AV delay adjustment is provided. The method comprises electrodes that are configured to be located proximate to an atrial (A) site and a right ventricular (RV) site. The method utilizes one or more processors for detecting an atrial paced (Ap) event or atrial sensed (As) event, and measures an AV interval corresponding to an interval between the Ap event or the As event and a sensed ventricular (Vs) event. The AV interval is associated with a current heart rate (HR). The method automatically dynamically adjusts a first AV delay based directly on the measured AV interval, identifies a scale factor associated with the current HR, calculates a second AV delay by scaling the first AV delay based on the scale factor and manages a pacing therapy, utilized by the IMD, based on the first and second AV delays.
US11745015B2

A method of neurostimulation titration. The method includes setting titration parameters for an electrical signal delivered by an implantable medical device, initiating titration with the titration parameters and an aggressiveness profile, performing titration by increasing at least one of a current amplitude, a frequency, a pulse width or a duty cycle of the electrical signal until a threshold is reached or a side effect is detected, pausing the titration while waiting for commands from the patient or caregiver, and resuming the titration in response to receiving authorization from an external device.
US11745000B2

A device and method for selectively applying a composition a treatment surface (e.g., skin) to impart an aesthetically pleasing appearance to the surface. The device may include a detector for obtaining image data corresponding to an image of an area of skin. The device may also include an applicator for selectively applying a fixed amount of the composition to the skin to a location within the area of skin as determined by the device. The fixed amount is selected to reduce the artifact magnitude by a predetermined coverage level when applied to the skin. The device may include a processing arrangement for receiving image data from the detector, determining an artifact magnitude of the location based on the image data, comparing the artifact magnitude to a threshold, and directing the applicator to apply the composition to the skin when the artifact magnitude is above the threshold.
US11744999B2

According to some embodiments, a skin treatment assembly comprises a handpiece comprising a distal end, the handpiece comprising a recess or cavity configured to receive a cartridge or other fluid container, a tip configured to be positioned along the distal end of the handpiece, the tip being configured to contact a skin surface of a subject during use, and at least one rollerball configured to extend to or near the tip, wherein the rollerball is configured to be in fluid communication with an interior of a cartridge or other fluid container secured to the handpiece, wherein the at least one rollerball is configured to contact the skin surface of the subject during use and to facilitate the delivery of fluids to said skin surface as the rollerball is moved relative to said skin surface.
US11744994B2

A lavage catheter for the treatment of a maxillary sinus is described. The catheter comprises a proximal portion and a distal portion. The distal portion comprises an irrigation tip. The irrigation tip has a tip opening through which fluid may be delivered by one handed operation of the catheter. A method for lavaging the maxillary sinus includes inserting the lavage catheter into a patient's anatomy and advancing the irrigation tip into the maxillary sinus using one hand.
US11744986B2

A single or multiple lumen catheter is disclosed which includes an expandable lumen. The expandable lumen is movable from a collapsed or sealed configuration to an open or expanded configuration. In the open configuration, the expandable lumen is dimensioned to receive a guidewire or stylet or facilitate the introduction of fluids into a patient.
US11744984B2

An IV device assembly may include a lumen forming a fluidic channel within the IV device assembly. The lumen may be fluidically coupled to a vascular access device (VAD) coupler via a funnel coupler, and an IV device assembly coupler at a proximal end of the lumen. The IV device assembly may also include one or more of the following: a collapsible sleeve formed coaxially around a first portion of the lumen and mechanically coupled to the funnel coupler, a patency instrument formed along a second portion of the lumen within the collapsible sleeve and into the VAD coupler, a translation handle that translates the patency instrument out of a distal end of the VAD coupler, and a fixed grip formed around the lumen to maintain a position of the IV device assembly relative to the translation handle.
US11744981B2

Systems, computer-implemented methods and/or computer program products that facilitate real-time response to defined symptoms are provided. In one embodiment, a computer-implemented method comprises: monitoring, by a system operatively coupled to a processor, a state of an entity; detecting, by the system, defined symptoms of the entity by analyzing the state of the entity; and transmitting, by the system, a signal that causes audio response or a haptic response to be provided to the entity, wherein transmission of the signal that causes the audio response or the haptic response is based on detection of the defined symptoms.
US11744976B2

A trap bowl is provided to accumulate liquid droplets from a filter, as a liquid content. The trap bowl includes a transparent vertical prism. The transparent vertical prism includes a face that forms a vertical transparent surface facing against a content of the section. The face can provide a first angle of total reflection when content of the section is a type of gas, and a second angle of total reflection when the content of the section is the liquid content. A light source may emit a light beam incident on the face at an angle of incidence. The angle of incidence results in reflection of the light beam, striking the light receiver, when the face has the first angle of total reflection, and results in refraction of the light beam, missing the light receiver, when the face has the second angle of total reflection.
US11744974B2

A respirator mask liner is provided for positioning between a respirator mask and the face of a wearer. The mask liner includes a flexible sheet material having an outer perimeter edge portion and a hole that is spaced inwardly from the outer perimeter edge portion. At least one tab projects outwardly from portions of the perimeter edge portion, and may be unitarily formed with the sheet material. The mask liner is configured so that when it is to be placed between the face of the wearer and the respirator mask, the tab or tabs project outwardly beyond the gasket portion of the respirator mask, so that the tabs may be used for adjusting the liner or securing the liner to the mask. Optionally, the mask liner has a surface texture with a ribbed and undulating pattern of raised portions, and/or incorporates an anti-microbial substance.
US11744972B1

A cuff assembly for a tracheostomy tube includes an outer bladder and an inner cuff. The inner cuff is positioned adjacent to the tracheostomy tube, and the outer bladder is positioned adjacent to the inner cuff. The outer bladder is made with a less elastic material and operates at a higher relative pressure. The inner cuff is made with a more elastic or hyper-elastic material and operates at a lower relative pressure. A secondary airflow opening is formed on a lateral wall of the tracheostomy tube between the cuff assembly and a main distal opening of the tracheostomy tube.
US11744965B2

A vaporizing article, comprises a vaporizer drive circuit; one or more memories configured to store a percentage of at least one constituent in an inhalation media, one or more compensation values for at least one compensation category for the at least one constituent, and instructions; and a control circuit comprising a processor coupled with the one or more memories configured to run the instructions, the instructions configured to cause the processor to: receive a dose target for a constituent; determine whether to perform compensation for an inhalation media dose in order to ensure the dose target is met; when compensation is to be performed, determine the properly compensated inhalation media dose based on an associated compensation value for the constituent; and control the vaporizer drive circuit so as to dispense a compensated dose of the inhalation media.
US11744953B2

The present invention relates to a system for obtaining medicament related information of specific medicaments, the in system comprising a device (10, 50) for obtaining medicament related information, the device comprising a recording unit, said recording unit comprising a reader (20, 32; 86, 88, 92, 122), capable of reading information pertained to specific medicaments, said recording unit further comprising a memory module (22, 104) capable of storing information read by said reader (20, 32; 86, 88, 92, 122), wherein said reader (20, 32; 86, 88, 92, 122) is arranged with a three-dimensional contact interface (81) designed to interact with a corresponding contact surface (87) containing information related to specific medicaments.
US11744948B2

Provided is an apparatus, system, and method for a nested syringe assembly. The nested syringe assembly includes a first syringe having a cylindrical body defining an inner diameter and a second syringe having a cylindrical body defining an outer diameter. The outer diameter of the second syringe is less than the inner diameter of the first syringe. At least a portion of the cylindrical body of the second syringe is disposed within the cylindrical body of the first syringe.
US11744945B2

A glucose control system employs adaptation of a glucose target (set-point) control variable in controlling delivery of insulin to a subject to maintain euglycemia. The glucose target adapts based on trends in actual glucose level (e.g., measured blood glucose in the subject), and/or computed doses of a counter-regulatory agent such as glucagon. An adaptation region with upper and lower bounds for the glucose target may be imposed. Generally the disclosed techniques can provide for robust and safe glucose level control. Adaptation may be based on computed doses of a counter-regulatory agent whether or not such agent is actually delivered to the subject, and may be used for example to adjust operation in a bihormonal system during periods in which the counter-regulatory agent is not available for delivery.
US11744940B2

A drug delivery device (1) comprising a delivery unit (2) receiving a drug cartridge (3) containing a drug to be administered to a patient in need thereof, the delivery unit comprising a subcutaneous delivery mechanism (7) including a needle (24), a needle support (8) to which the needle is mounted, and a needle actuation mechanism (9) configured to move the needle from a retracted position within a housing (5) of the delivery unit (2), to an extended delivery position where the needle projects through a base wall (14) of the housing. The needle actuation mechanism comprises a rotary actuator (10) configured to engage an engagement lever (11) coupled to the needle support (8) for translating the needle support between retracted and extended delivery positions.
US11744938B2

Titration schemes are carried out by medical infusion devices, such as ambulatory or implantable infusion devices. The titration schemes carried out by infusion systems and devices may take into account patient side effects in controlling the rate at which a medicament is delivered from the devices of systems.
US11744937B2

Provided is a flexible and conformal wearable, self-contained medical device. The medical device comprises an integral housing formed by a flexible upper portion and a flexible lower portion joined along their perimeters. The medical device is also provided in a plurality of shapes and configurations for increasing the flexibility and conformability of the housing. The components contained within the housing, such as a drug reservoir, printed circuit board, and power supply are preferably constructed from flexible materials and are formed, connected and positioned according to the configuration of the housing in a manner for enhancing flexibility of the housing. A thermal bubble micropump is provided for controlling flow of a drug from the flexible reservoir, that utilizes a thermal resistor provided locally to a thermal expansion fluid that causes a surrounding membrane to expand and displace a volume of drug to be provided to the user.
US11744934B2

Described herein are devices and methods for irrigating and suctioning fluids from the lumens or cavities of a mammalian body. The devices include a malleable irrigation tube and a suction tube that is slidably mounted upon the irrigation tube.
US11744921B2

The present invention provides a surgical implant material for assisted repair of muscle mechanics and a method of preparing the same. The surgical implant material for assisted repair of muscle mechanics comprises a collagen compound within a net-like bacterial cellulose base material. A bacterial cellulose base material is placed into solution of collagen, treated via vortex shaking, dried at room temperature; and then immersed in an aqueous solution of an aldehyde compound under vacuum to react for 10 to 30 minutes, thereby producing the surgical implant material for assisted repair of muscle mechanics. The surgical implant material of the present invention can effectively improve the biocompability, and maintain the flexibility, smoothness and fitness of the base material to reduce the damage to surrounding tissues, thereby reducing the bleeding and inflammatory response. Meanwhile, the processing conditions of the preparation method is more reasonable and convenient to control, and more suitable for industrial scale-up.
US11744917B2

A formulation, or tissular adhesive, obtained from a platelet-rich blood composition and/or growth factors, and method for the preparation of this adhesive. The preparation method of the adhesive comprises the steps of raising the temperature of the initial blood composition and subsequently activating the composition. Among other advantages, the tissular adhesive is biocompatible and biodegradable, has desirable biological or medical properties provided by the presence of platelets or growth factors, and also has a high adhesiveness and an accelerated coagulation process.
US11744915B2

Diagnostic devices for quantitative or qualitative analysis of a sample fluid including an analyte include at least two portions made from a hydrophilic material. The planar portions are stacked on each other and each occupy a different and substantially parallel plane to form a three-dimensional structure. At least one of the planar portions includes a hydrophobic region formed by applying a low surface energy material that extends through a thickness of the substrate portion from a first major surface to a second major surface thereof. The hydrophilic regions in the overlying substantially parallel substrate portions can be aligned with each other such that a fluid is passively transported between adjacent hydrophilic regions to provide a sample flow path between adjacent substrate portions.
US11744911B2

An embodiment of the present disclosure may include a base for a scent warmer. The base may include a base member and a stem extending upwardly from the base member. The stem may be configured to carry a heating element thereon. The base may also include an elastomeric sleeve surrounding at least a portion of the stem. The elastomeric sleeve may be configured to apply a retention force between a removable decorative body and the stem. The elastomeric sleeve may include a wall member sized and configured to abut against the stem and a plurality of ribs extending radially outward from the wall member.
US11744908B2

Methods for determining systemic biodistribution characteristics of intravitrially administered medicaments. In some embodiments, radiolabeled agents or medicaments, such as I-124 labeled bevacizumab, ranibizumab and aflibercept, was imaged utilizing PET/CT in a non-human primate model, with radioactivity emission measurements made to determine the intravitreal half-lives of each agent and to determine the differences of radioactivity uptake in non-ocular organs.
US11744902B2

Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
US11744898B2

Provided are multi-arm polymer conjugates of Toll-Like Receptor (“TLR”) agonists such as TLR 7/8 agonists, as well as related compositions, and methods of making and using such conjugates. Exemplary conjugates are encompassed by Formula I: (I) or a pharmaceutically acceptable salt form thereof, where R, taken together with each Q, is a residue of a polyol, polythiol, or polyamine bearing from 3 to about 50 hydroxyl, thiol, or amino groups; each Q is a linker selected from oxygen, sulfur and —NH; each POLY is independently a water-soluble, non-peptidic polymer; each Xr is independently a linkage-containing spacer moiety; q is a positive integer from 3 to about 50; and each TLR 7/8 AG is a Toll-like receptor 7/8 agonist. Also provided is a method of administering to a patient having cancer (a) an IL-2Rβ-activating amount of a long-acting, IL-2Rβ-selective agonist; and (b) a Toll-like receptor agonist such as a conjugate as described above, as well as related compositions, kits and methods. RQ-POLY-Xr-TLR7/8 AG)q  (I)
US11744893B2

The invention relates to COnditional Bispecific Redirected Activation constructs, or COBRAs, that are administered in an active pro-drug format. Upon exposure to tumor proteases, the constructs are cleaved and activated, such that they can bind both tumor target antigens (TTAs) as well as CD3, thus recruiting T cells expressing CD3 to the tumor, resulting in treatment.
US11744890B2

Crude aqueous extracts of Quillaja saponaria Molina containing at least the QS-21 main peak and 2018 component, wherein the ratio of 2018 component/QS-21 main peak is ≤0.075, as measured by UV absorbance at 214 nm, methods for obtaining such extracts and related aspects.
US11744883B2

The present invention provides a combination vaccine comprising one or more antigens of Mycoplasmahyopneumoniae, one or more antigens of Porcine circovirus, and pharmaceutically acceptable excipients and/or carriers, for use in the prevention and/or treatment of porcine enzootic pneumonia and/or Porcine Circovirus-Associated Diseases (PCVAD) by administration of the vaccine into the dermis of livestock, wherein the one or more antigens of porcine circovirus comprises the PCV2 ORF2 protein in an amount from 0.1 μg/dose to 10 μg/dose.
US11744873B2

Disclosed herein are small molecule GIP/GLP-1 dual receptor agonist compositions, pharmaceutical compositions, the use and preparation thereof.
US11744872B2

The invention relates to cyclosporine formulations for use in the prevention or treatment of pulmonary chronic graft rejection. In particular, the invention provides a cyclosporine liquid formulation for use as an aerosol for inhalation in a method of preventing or treating pulmonary chronic graft rejection in single lung transplanted patients. The formulation is preferably administered once or twice daily. The formulation may be aerosolized with a nebulizer that comprises features for monitoring the time, date and duration of inhalation by the patient, in order to monitor patient adherence. The formulation according to the invention may be combined with standard immunosuppressants and corticosteroids.
US11744866B2

Methods of preventing and treating COVID-19 infection by administering probiotics. The probiotics can be administered via the following methods: fecal transplant, suppository, or orally. The probiotic contains one or more of the following microorganisms: Bifidobacterium, Clostridium, Veillonella, Ruminococcus, and Sutterella.
US11744865B2

A composition for inhibiting lipofuscin accumulation or removing lipofuscin is disclosed. A Chryseobacterium sp. strain, a lysate of the Chryseobacterium sp. strain, a culture of the Chryseobacterium sp. strain, or an extract of the lysate or culture is included in the composition. The composition provides an anti-aging effect by inhibiting lipofuscin accumulation or removing lipofuscin. The composition also provides an effect of preventing, ameliorating or treating the diseases caused by the lipofuscin accumulation, such as skin hyperpigmentation, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, myocardial infarction and age-related macular degeneration.
US11744856B1

Pharmaceutical and cosmetic compositions and methods are presented that have a carrier in combination with a media composition that is derived from distinct cell cultures. The distinct cell cultures are obtained from growing different cells that are distinct with respect to at least one of cell type, cell age, cell differentiation stage, and physiological condition. Thus, the composite medium will provide mediator molecules that are ordinarily not founds in their combination and that can be fine tuned to specific purposes.
US11744855B2

Nanodiamonds having a positive ζ-potential of at least 1 mV for use in sequestration of at least one FGF family member in organisms in vivo and in vitro. It has been found that nanodiamonds with a positive ζ-potential show an extremely strong and selective binding to FGF family members, thus leading to their usability in the treatment of diseases related to aberrant FGF-FGFR signalling and/or interaction.
US11744854B2

A composition which, in addition of the synergy of action of each of the composition-forming materials, can significantly enhance the efficaciousness of each material. Specifically, the composition comprises each of extract obtained from gotukora, amla, kotarahinbutsu, diosgenin and yamabushitake, and a divalent/trivalent iron salt as effective ingredients. The efficacy of each of the composition-forming materials is even more enhanced beyond expectation by containing the divalent/trivalent iron salt.
US11744853B2

Provided herein are formulations for topical and/or transdermal administration, and methods of using these formulations for the treatment of proliferative diseases related to cancer such as cancers and related conditions, and solid tumors. Also provided are formulations for topical and/or transdermal administration, and methods of using these formulations for melasma, gout, skin disorders, and other diseases and disorders described herein as well as methods for modulating the pH (e.g. raising) of a tissue or microenvironment proximal to a tumor, modulating pH, or improving the effectiveness of know chemotherapeutic agents, immunotherapy and the like for the prevention, treatment of cancers and related conditions described herein.
US11744837B2

This invention provides new methods for a) identifying Cushing's Syndrome patients at high risk of developing hypokalemia during glucocorticoid receptor modulator (GRM) treatment, and b) for prophylactically treating such patients to prevent, or reduce the severity of, hypokalemia. Patients at such high risk may be identified prior to their developing hypokalemia. Such a patient may be an adult patient with endogenous Cushing's Syndrome having type 2 diabetes mellitus or glucose intolerance to control hyperglycemia secondary to hypercortisolism. Patients may be identified by an above-threshold level of ACTH or cortisol in a patient sample taken post-GRM administration or pre-GRM administration, respectively. Upon identifying such a patient prior to the development of low potassium, the present methods provide for prophylactically treating the patient by administration of one or more hypokalemia treatments concurrently with an increased dose of GRM or with an initial dose of GRM to prevent hypokalemia.
US11744834B2

A rhodium-loaded porphyrin complex, comprising the porphyrin (meso-tri(4-sulfonatophenyl) mono(4-carboxyphenyl)porphine (C1S3TPP)) with coordinated with rhodium, effectively neutralizes the biological activity of naturally-occurring and synthetic opioids.
US11744832B2

The present invention provides heteroaryl substituted pyrrolo[2,3-b]pyridines and heteroaryl substituted pyrrolo[2,3-b]pyrimidines that modulate the activity of Janus kinases and are useful in the treatment of diseases related to activity of Janus kinases including, for example, immune-related diseases, skin disorders, myeloid proliferative disorders, cancer, and other diseases.
US11744826B2

A method of treating retinal degeneration in a subject includes administering to the subject a therapeutically effective amount of a compound of formula (I).
US11744821B2

Controlled release hydrogel formulations of one or more simvastatin metabolites 3′-hydroxy simvastatin (hSV), 6′-exomethylene simvastatin (eSV), 3′,5′-dihydrodiol simvastatin, 3′,5′-dihydrodiol simvastatin (dSV), simvastatin-beta-hydroxy acid (SVA), and methods for the treatment of patients suffering from injured or degenerating substantially avascular cartilaginous tissue.
US11744820B2

The present disclosure provides methods and compositions for the prevention, amelioration, or alleviation of one or more neurological disorders associated with microbially-induced amyloid formation. Methods of inhibiting, ameliorating, reducing the likelihood, delaying the onset of, treating, or preventing an amyloid disorder are disclosed. Methods of identifying compounds capable of inhibiting the formation of microbially-induced amyloid fibrils are disclosed.
US11744811B2

The present invention is directed to methods of stabilizing a pharmaceutical composition comprising epinephrine containing the steps filling a container, capping the container, assembling the container and placing the assembled capped container (assembled device) in a secondary packaging system.
US11744806B2

The present invention relates to frigostable compositions suitable for iontophoretic transdermal delivery of a triptan compound. The inventive compositions include a salt of a triptan compound, preferably sumatriptan succinate, a polyamine, a dicarboxylic acid, and water or an aqueous solvent mixture, with the composition being free of monocarboxylic acids. The invention further relates to the use of the composition as an integral component of an iontophoretic patch, preferably as an anodic reservoir of the patch.
US11744803B2

The invention relates to delivery systems that allow for the pulsatile release of a substance, such as a drug, in response to a change in pH. More specifically, it relates to drug administration to the GI tract, in particular to site-specific intestinal drug delivery via the oral route. Provided is a pH-controlled pulsatile release system (PPRS) comprising a core surrounded by a coating layer, wherein said core comprises an active substance and wherein said coating layer comprises a pH-sensitive coating material wherein a swellable agent is embedded. Said swellable agent is capable of taking up at least 1.1 times, preferably at least 5 times, more preferably at least 10 times its weight in water. Also provided is a pharmaceutical composition comprising a PPRS, in particular a colon-specific PPRS.
US11744801B2

The disclosure features novel methods of producing nucleic acid lipid nanoparticle (LNP) compositions employing a modifying agent after formation of a precursor nucleic acid lipid nanoparticle, the produced compositions thereof, and methods involving the nucleic acid lipid nanoparticles useful in the delivery of therapeutics and/or prophylactics, such as a nucleic acid, to mammalian cells or organs to, for example, to regulate polypeptide, protein, or gene expression.
US11744797B2

The present invention relates to methods and compositions for treating lymphangioleiomyomatosis in a human subject in need of such treatment. The methods comprise administering to the subject via inhalation an aerosol composition comprising rapamycin or a prodrug or derivative (including analog) thereof.
US11744780B2

One or more biting elements of a teething system are cooled to below ambient temperature, while a handle of the teething system is left at ambient temperature. One of the biting elements is selected by the caregiver and is inserted into a receptacle in the handle. As assembled, a cooled teething surface on the biting element is exposed so that a baby may bite it, but at the same time the baby's hands are insulated by the handle from contacting the cooled biting element.
US11744762B2

A gait activity learning assistance system, and an application method thereof, includes a main body, at least one movement detecting module, a control module, at least one driving module and at least one dynamic measurement module. The system is able to guide and induce a user to learn gait autonomously by disposing at least one force-transmission unit on at least one limb position of the user, besides, the system is able to measure a dynamic change of the at least one force-transmission unit by the at least one dynamic measurement module while user receiving a gait assistance, and send them back to the control module immediately for a real-time analysis.
US11744759B2

A medical chair is provided for conducting and controlling in-depth medical exams from a remote location. Specifically, the medical chair allows for providing remote diagnoses and treatment, including a variety of testing procedures for patients with nonemergent but time sensitive illness or injury. The medical chair can be used in a semi-permanent, permanent, temporary, or mobile environment and includes stabilizing assemblies to adapt to any of these environments.
US11744751B2

A device for caring for a human subject is disclosed. The device includes a frame including a base surfaces and side surfaces, and defining a hollow, and a liquid receptacle disposed beneath the frame. A conduit fluidly connects the hollow to the liquid receptacle. A cover is connected to the frame above the hollow. The cover includes a plurality of nozzles.
US11744748B2

The present disclosure relates to absorbent garments having a dryness layer that can comprise one or more laminates and one or more channels to facilitate liquid acquisition and retention. Laminate(s) can include an absorbent lamina disposed between substrate laminae, each comprising tissue and/or a nonwoven. Some dryness layers can have a folded laminate that defines a longitudinally-extending channel. Some dryness layers can have two or more laminate strips that are laterally spaced apart along a width of the dryness layer such that one or more longitudinally-extending channels are defined therebetween.
US11744745B2

A method for manufacturing an absorbent article that includes: a first sheet body that includes two first sheets and a first elastic string that is stretchable and contractible in a left-right direction; a second sheet body; and a first weld portion. The method includes: (a) placing the first elastic string in a stretched state where the first elastic string is stretched in the left-right direction between the first sheets disposed in a thickness direction intersecting the left-right direction; (b) causing the second sheet body to overlap with the first sheet body in the thickness direction; (c) releasing the stretched state to bring about a released state; and (d) welding one end portion of the first sheet body in the left-right direction and one end portion of the second sheet body in the left-right direction to each other, to form the first weld portion.
US11744742B1

A dressing system for cooling skin or a wound site on a subject comprises a dressing having a reservoir for holding a liquid. The dressing may be configured for placement proximate to a postoperative surgical wound site of the subject or on the facial area of the subject. The dressing system includes a cooling chamber external to the dressing configured to cool the liquid. The dressing system includes a pump configured to circulate the liquid between the cooling chamber and the reservoir. The dressing system may include a suction element for applying suction at, or proximate to, the dressing for removing sweat or wound drainage.
US11744739B1

A control unit for a worker wearing personal protective equipment is presented. The control unit includes a PPE network creator that, when activated, creates a network. The control unit also includes a PPE device identifier configured to detect a first PPE associated with the worker and a second PPE associated with the worker. The first PPE has a first speaker and a first microphone. The second PPE has a second speaker and a second microphone. The control unit also comprises a PPE network joiner that facilitates the first and second PPE joining the network. The control unit also comprises a preferred configuration selector that automatically selects a preferred speaker for the worker and a preferred microphone for the worker. The preferred speaker is the first or second speaker. The preferred microphone is the first or second microphone. The control unit also comprises a network communication component that automatically communicates a first device parameter settings to the first PPE and a second device parameter settings to the second PPE. The first and second device parameter settings are based on the selected preferred speaker and microphone.
US11744728B2

An intrauterine contraceptive system may include a contraceptive intrauterine device, a retrieval thread permanently attached to the intrauterine device and an insertion device for inserting the intrauterine device into a uterus. The system may also include a release thread releasably coupled with the intrauterine device. The intrauterine device may be deployable out of a distal end of the insertion device and may be configured to change from a delivery configuration when housed in the insertion device to a deployed configuration when deployed in a uterus. The retrieval thread and the optional release thread may be at least partially housed within the insertion device during insertion of the intrauterine device into the uterus. The release thread may extend from the intrauterine device through the insertion device to an attachment point at or near a proximal end of the insertion device.
US11744725B2

An ostomy appliance having a signal generator adapted to give a user or a health care professional a warning in time to change the appliance before leakage occurs by predetermining leakage or potential leakage of stomal fluids.
US11744713B2

A dynamic intervertebral spacer includes a ring which is split on an anterior portion. A posterior portion of the ring acts as a torsion spring. After implantation, the ring is able to act as a spring between superior and inferior vertebral bodies, thus allowing dynamic bone growth in fusion procedures.
US11744709B2

A method of joining adjacent bone includes providing a medical device having a first implant portion, a second implant portion attached to the first implant portion, and a driver assembly having an instrument adapted to form an opening in bone. The driver assembly is integrally connected to and removably attached to the second implant portion at a connection, distal from the first implant portion. The driver assembly further has a wire driver extending therefrom, distal from the first implant portion. The method further includes inserting the wire driver into a wire driver tool; placing the first implant portion against a first bone structure; inserting the first implant portion into the first bone structure; removing the second implant portion from the driver assembly; using the driver assembly to form an opening in a second bone structure, adjacent to the first bone structure; and inserting the second implant portion into the opening.
US11744704B2

A method of implanting a balloon expandable prosthetic valve within a native aortic valve includes introducing a delivery system into a femoral artery of a patient, the delivery system comprising an outer sleeve and a shaft extending through a lumen of the outer sleeve. A distal end portion of the shaft is positioned distal to a distal end of a steerable distal end portion of the outer sleeve. A prosthetic valve is crimped over a balloon disposed along the distal end portion of the shaft. The delivery system further comprises a first radiopaque marker inside the balloon and positioned adjacent a proximal end of the prosthetic valve and a second radiopaque marker inside the balloon and positioned adjacent a distal end of the prosthetic valve. The method also includes identifying a location of the prosthetic valve by monitoring the first and second radiopaque markers inside the balloon under fluoroscopy.
US11744701B2

A prosthetic heart valve comprises a radially collapsible and expandable annular frame and a leaflet structure comprising three leaflets. Each leaflet has an upper edge portion, a curved lower edge portion and two side flaps, wherein each side flap is connected to an adjacent side flap of another leaflet to form commissures of the leaflet structure, with each commissure being attached to the frame. An annular inner sleeve comprises three U-shaped portions positioned along the curved lower edge portions of the leaflets. An annular outer sleeve extends around are outer surface of the frame, wherein the outer sleeve is made of pericardium. The frame is made of Nitinol and the prosthetic valve can be radially crimped to a radially collapsed configuration inside a sheath for delivery into a patient's body and self-expand to a radially expanded configuration when released from the sheath inside the patient's body.
US11744694B2

A stent-deployment assembly for use with a guidewire comprises a biliary stent and an elongated stent-conveyance tube comprising a guidewire-retaining segment that includes respective distal and proximal apertures defining a guidewire-path therethrough, and a lengthways laterally-breachable portion. In a stent-advancement configuration, the guidewire passes through the respective apertures so as to interiorly traverse the guidewire-retaining segment, and the stent is arranged to surround a stent-conveyance tube segment that is proximally displaced from the guidewire-retaining segment, for advancement of the stent together with the stent-conveyance tube along the guidewire into a body lumen of a human subject. When the stent is disposed, in the stent-advancement configuration, at a target deployment location within the lumen, a proximal-direction withdrawal of the stent-conveyance tube is effective to cause the guidewire to breach the laterally-breachable portion of the guidewire-retaining segment so as to decouple the guidewire from the tube without longitudinal displacement of the guidewire.
US11744690B2

A toothbrush tip includes a brush head, a plurality of bristle tufts extending from the brush head, a water jet nozzle extending from the brush head, and a cover panel arranged on a rear of the toothbrush tip opposite the bristle tufts.
US11744687B2

An oral irrigator has a first liquid container, a nozzle outlet, a pump driven by a drive to pump liquid from the liquid container to the nozzle outlet so that a liquid jet is emitted via the nozzle outlet, a first switch arranged so that the drive is powered when the first switch is actuated once and the oral irrigator is switched into an ON state, and so that powering of the drive is stopped and the oral irrigator is switched into an OFF state when the first switch is actuated once again, and a second switch arranged so that the drive is powered only while the second switch is continuously actuated by the user and powering is stopped when the second switch is released.
US11744682B2

A system for intraoral scanning comprises a scanner to generate image data of a dental site and a computing device. The computing device receives the image data of the dental site, the image data comprising a representation of the dental site and a representation of a reference object at the dental site. The computing device selects library data for the reference object from library data for a plurality of reference objects in a library. The computing device aligns the library data for the reference object with the image data.
US11744678B2

A series of appliances including a first shell and a second shell can be designed to incrementally implement a treatment plan. The first and second shells can have cavities designed to receive teeth of a jaw. The first shell can be designed to interface with a first surface of a plurality of surfaces of an attachment structure to provide a first engagement force specific to a first stage of the treatment plan. The second shell can be designed to interface with a second surface of the plurality of surfaces of the attachment structure attached to the at least one tooth of the first jaw to provide a second engagement force specific to a second stage of the treatment plan.
US11744677B2

The present disclosure provides method, systems, and devices for adjusting an arch of teeth. An appliance includes a removable shell formed of a first material having a number of cavities formed therein, wherein the number of cavities are shaped to receive teeth of a patient, and an arch element extending from the removable shell in a lingual direction and across at least a portion of the arch width of the removable shell, wherein the arch element is designed to expand an arch of the teeth of the patient, wherein the arch element has a width specific to a stage of a treatment plan.
US11744669B2

The present disclosure relates to the field of endoscopy. Specifically, the present disclosure relates to systems and methods which allow the distal portion of a catheter to be visualized within the body using a colored marker and one or more secondary markers. In particular, the present disclosure relates to systems and methods which indicate when a medical device is properly positioned for deployment within a body lumen.
US11744667B2

Various adaptive surgical visualization systems are disclosed. Surgical visualizations can compensate for obscured, incomplete, damaged, or interfered with portions of captured images by substituting those portions of the images with corresponding portions of other images. The other images could include images that were previously generated by the surgical visualization system or images that were generated using multispectral imaging techniques.
US11744664B2

Disclosed is herein a medical drape, and more particularly, a drape capable of preventing sprays generated from the mouth of a patient during dental treatment from being diffused by a first guard or the like to improve hygiene and fixation.
US11744657B2

An improved device for regenerating an infrared signal transmitted over the air for use in detecting a 3-dimensional position of an object. The regeneration device includes an infrared signal transmitter and detector that receives from the object a responsive infrared signal in response to the infrared signal transmitted by the transmitter. A low pass filter receives the responsive infrared signal from the detector and outputs a low-pass filtered signal. A comparator compares the output of the infrared signal detector and output of the low pass filter and generates an output representing a logic state based on the comparison.
US11744650B2

A method of navigating a cutting instrument, via a computer system, the method comprising: (a) mounting a patient-specific anatomical mapper (PAM) to a human in a single known location and orientation, where the PAM includes a surface precisely and correctly mating with a human surface correctly in only a single location and orientation; (b) mounting a reference inertial measurement unit (IMU) to the human; (c) operatively coupling a guide to the PAM, where the guide includes an instrument inertial measurement unit (IMU) and at least one of a cutting slot and a pin orifice; (d) outputting data from the reference IMU and the instrument IMU indicative of changes in position and orientation of the guide with respect to the human; (e) repositioning the guide with respect to the human to a position and an orientation consistent with a plan for carrying out at least one of a cut and pin placement; and, (f) visually displaying feedback concerning the position and orientation of the guide with respect to the human using data output from the reference IMU and the instrument IMU, which data is processed by a computer program and the computer program directs the visually displayed feedback.
US11744648B2

The present invention relates to a method, such as a surgical method for assisting a surgeon for placing screws in the spine using a robot attached to a passive structure. The present invention also related to a method, such as a surgical method for assisting a surgeon for removing volumes in the body of a patient using a robot attached to a passive structure and to a device to carry out said methods. The present invention further concerns a device suitable to carry out the methods according to the present invention.
US11744638B2

An electrosurgical device for puncturing tissue comprises an electrically conductive elongate member which is capable of force transmission from a distal portion of the electrosurgical device to a proximal portion of the electrosurgical device to thereby provide tactile feedback to a user. The proximal portion comprises a connector system for connecting a source of energy and a source of fluid to an electrosurgical device. The connector system includes a hub which includes an electrically conductive lengthwise member having a lengthwise member distal region and a lengthwise member proximal region. The lengthwise member defines a hub lumen therebetween and is configured to be operatively coupled to an electrosurgical device.
US11744634B2

An electrosurgical device comprising: forceps including: (i) a first working arm having a contact surface and (ii) a second working arm having a contact surface; wherein the forceps has a first electrical configuration where the contact surface of the first working arm and the contact surface of the second working arm are substantially opposite each other so that the contact surfaces of the forceps can be used to grip an item between the working arms and so that the forceps is configured to deliver a first therapy current through the first working arm, the second working arm, or both; and wherein the forceps has second electrical configuration where the contact surface of the first working arm and the contact surface of the second working arm are askew relative to each other and an electrode edge is formed on at least one side of the forceps so that a second therapy current extends from the electrode edge.
US11744631B2

The present disclosure includes an electrosurgical generator that controls treatment energy to be provided in a coagulation mode, where the treatment energy has an adjustable voltage ramp rate which can be set to a ramp rate in a range of voltage ramp rates. The generator receives signals from an instrument over time relating to load impedance. When the load impedance is above a threshold, the generator sets the adjustable voltage ramp rate to a ramp rate in the range of voltage ramp rates, and decreases, at the adjustable voltage ramp rate, a voltage of the treatment energy. When the load impedance is below the threshold, the generator sets the adjustable voltage ramp rate to a ramp rate in the range of voltage ramp rates, and increases, at the adjustable voltage ramp rate, the voltage of the treatment energy.
US11744625B2

A compression device may include, but is not limited to, a threaded body, a sliding element, and a compression element connecting the threaded body and the sliding element. According to one embodiment, upon implantation, the threaded body contacts a first bony fragment and the sliding element contacts to a second bony fragment. In at least one embodiment, upon being engaged, the compression element applies sustained tension to the sliding element and opposing tension to the threaded body, thereby compressing the first bony fragment and the second bony fragment along a plane of contact promoting healing.
US11744624B2

Bone graft comprising cortical bone material having a screw shank with an external thread and a screw head. Screw head has an outer jacket surface which is rotationally symmetrical about a screw head axis and has an external thread. At least two recesses, which are distributed about the screw head axis, extend axially in the direction of the screw head axis and open into an end face of a free end of the screw head, for receiving an insertion tool. The recesses are each formed by side faces, which extend from the outer jacket surface in the direction of the screw head axis and merge into one another in a surface section close to the axis. By this design, introduction of an insertion torque is optimized and new surgical areas of application such as in intramedullary splinting, arthroscopic insertion and deep insertion of the graft into an bearing bone are possible.
US11744623B2

An anchor device for use in sacroiliac joint stabilization comprises a housing having one or more apertures; one or more engagement members at least partially disposed in the housing, where at least one of the one or more engagement members is movable between a retracted position and an extended position such that, when in the extended position, the at least one of the one or more engagement members extends through at least one of the one or more apertures; wherein, when in the extended position, the at least one of the one or more engagement members is configured to move to the extended position within cancellous bone of a sacrum; and wherein the anchor device comprises a continuous channel extending from a first end of the anchor device to a second end of the anchor device, the channel being configured to receive a guidewire.
US11744622B2

This disclosure details a surgical system and method, which is useful for treating an acromioclavicular (AC) joint. In an example, the disclosed system includes a cerclage which is provided relative to a coracoid process and which includes a loop. In that example, a clavicle is held relative to the coracoid process using a clavicle fixation assembly, which includes suture passed through the loop of the cerclage.
US11744616B2

Disclosed herein are systems and methods for manipulating the orientation of a plurality of bone fragments with respect to one another. A bone transport frame including first and second rings, a plurality of elongate struts, and a plurality of ring transport assemblies for orienting a first bone segment with respect to a second bone segment is disclosed. A third ring may be included in the bone transport frame for orienting a third bone segment with respect to the first and second bone segments. Manipulation of an adjustable member of the bone transport frame can transport a ring in either a proximal or distal direction with respect to other rings of the frame. Manipulation of another adjustable member of the bone transport frame can translate a central axis of one of the rings either toward or away from the central axes of the plurality of elongate struts.
US11744603B2

Multi-axis pivot joints and surgical instrument drive shafts formed using additive manufacturing methods.
US11744591B2

A medical device for an anastomosis is provided. The medical device distinguishes an inner tubular layer, an outer tubular layer, and a support element defining a longitudinal axis. It further distinguishes two or more independent C-rings distributed and positioned at an acute orientation angle relative to the longitudinal axis of the support element at one end of the support element. The support element and the two or more C-rings are embedded in between the inner and the outer tubular layers. The types of applications one could envision are e.g. a proximal anastomosis, distal anastomosis, or side-to-side anastomoses, in a customized pre-fabricated graft. Embodiments of the invention could also be incorporated into an anastomotic connector device design. Embodiments of the invention could further be envisioned as vascular grafts applications such as Coronary Artery Bypass Graft (CABG), dialysis access grafts and peripheral vascular applications.
US11744582B2

A surgical stapling device includes a tool assembly including an anvil and a cartridge assembly that are movable in relation to each other between open and clamped positions. The cartridge assembly includes a staple cartridge that can be replaced after each firing of the stapling device to facilitate reuse of the stapling device. The anvil includes a lockout mechanism that prevents operation of the stapling device when the staple cartridge has been previously fired. The lockout mechanism is adapted to move from a locked position to an unlocked position when the staple cartridge is replaced and the tool assembly is moved from the open position to the clamped position.
US11744579B2

A surgical circular stapler has a handle assembly, a shaft, a stapling assembly, and a firing assembly. The shaft extends distally from the handle assembly. The stapling assembly is secured to a distal end of the shaft. Longitudinal translation of the firing assembly causes the stapling assembly to drive a plurality of staples in a circular array to secure two lumens of tissue together. The stapling assembly may further drive a blade to sever any excess tissue interior of the circular array of staples. The stapler further includes a lockout assembly configured to control firing of the stapling assembly. The lockout assembly may include one or more switches, the actuation of which is configured to prevent or permit firing of the stapling assembly. The lockout assembly may additionally or alternatively include one or more mechanical lockout features configured to control firing of the stapling assembly.
US11744575B2

Devices, systems and methods for passing a suture. In general, described herein are suturing devices, such as suture passers, as well as methods of suturing tissue. These suture passing devices may include dual deployment suture passers in which a first distal jaw member is moveable at an angle with respect to the longitudinal axis of the elongate body of the device and the second distal jaw member is retractable proximally to the distal end region of the elongate body and/or the first jaw member.
US11744574B2

Systems, devices, and methods for cutting a filament or suture having an extrudable inner core member are provided. In one exemplary embodiment, a device includes a compression element to compress an inner core away from a knot disposed at a distal end of the suture, and a cutting element disposed within a portion of the compression element to cut the inner core after it has been compressed. As a result, an amount of extrudable inner core that extends distally beyond the knot is minimized without negatively impacting the integrity of the knot. In other embodiments, the compression and cutting elements are separately provided as two different devices. The actions of compressing and cutting can be performed using a variety of techniques, including those known to those skilled in the art. Methods for clamping the inner core and then cutting a portion of the inner core are also provided.
US11744560B2

A sampling capsule is provided. The sampling capsule includes an enclosure, a sampling assembly, a sample drawing assembly and a control module. The sampling assembly includes a sample chamber arranged in the enclosure, an outer sampling port on the enclosure, a sampling tube connecting the outer sampling port and the sample chamber, and a sampling switch for opening or closing the connecting tube. The sample drawing assembly includes a sample drawing port on the enclosure and connected to the sample chamber, and a silicone plug fitted in the sample discharging port. The control module includes a microprocessor communicating with the sampling switch.
US11744552B2

An ultrasound diagnostic apparatus according to an embodiment includes processing circuitry configured to execute transmit aperture synthesis to conduct coherent summation on multiple received signals that are at different transmit apertures and in an identical scan line, evaluate a degree of consistency between phases of the received signals to calculate an evaluation value at each observation point, and correct a received signal having undergone the transmit aperture synthesis based on the evaluation value.
US11744550B2

An ultrasound probe according to an embodiment includes a base material, a first organic layer, and a second organic layer. The base material contain polyolefin. The first organic layer is formed on the outer surface of the base material and contains epoxy resin and silicate oligomer. The second organic layer is formed on the outer surface of the first organic layer and has hydrophilicity.
US11744542B2

A method for evaluating a movement state of a heart is provided and includes: obtaining a plurality of consecutive heart ultrasound images corresponding to a heart and accordingly estimating a plurality of left ventricular volumes corresponding to the heart ultrasound images; finding a plurality of specific extremums in the left ventricular volumes and accordingly estimating a plurality of time differences among the specific extremums; estimating a statistical characteristic value of the time differences based on the time differences; and determining that an abnormal movement state of the heart occurs in response to determining that at least one of the time differences deviates from the statistical characteristic value up to a predetermined threshold.
US11744540B2

A method for measuring parameters in an ultrasonic image, includes: obtaining a pelvic ultrasound image, wherein the pelvic ultrasound image is acquired by receiving ultrasound echoes from a pelvic floor tissue with an ultrasound probe and contains an area representing the pelvic floor tissue; displaying the pelvic ultrasound image; determining a position of an inferoposterior margin of symphysis pubis in the pelvic ultrasound image; determining a horizontal axis according to the determined position of the inferoposterior margin of symphysis pubis; determining a position of a bladder neck in the pelvic ultrasound image; and calculating a distance from the determined position of the bladder neck to the determined horizontal axis to obtain a value of a bladder neck-symphyseal distance.
US11744538B2

A system and method for determining stenosis severity in a subject's vasculature using multi-energy computer tomography (MECT) imaging is provided. In some aspects, the method includes acquiring MECT data using a CT system, performing a material decomposition process on acquired MECT data to generate one or more material density maps, and selecting, using the one or more material density maps, one or more regions of interest (ROIs) encompassing at least one vessel cross-section. The method also includes measuring an iodine content in the one or more ROIs, and determining a stenosis severity based on the measured iodine content. The method further includes generating a report indicating the stenosis severity associated with the subject's vasculature.
US11744537B2

A compression plate of a mammography apparatus has an upper surface which is irradiated with radiation, a lower surface which is opposite to the upper surface and comes into contact with the breast, and a surface which is parallel to the upper surface between the upper surface and the lower surface. In the compression plate, a compression plate scale for identifying an in-plane position of each surface is given to any one of the surfaces. A first display control unit of a console performs control to display a radiographic image captured by the mammography apparatus on a display unit. A second display control unit of the console performs control to display an image scale which indicates a position on the radiographic image corresponding to the in-plane position of the compression plate on the radiographic image displayed on the display unit.
US11744529B2

The present invention relates to a collision detection and prevention system for medical X-ray equipment, in particular a supplementary system that augments an existing safety system, which is useful when the X-ray equipment includes an auxiliary apparatus, such as a radiation shield, which may interfere with the existing collision detection and prevention system.
US11744524B2

This disclosure provides a monitoring apparatus and a statistical display method for physiological parameter(s) thereof. The method may include receiving statistical setting information including a time range, a time interval, a classification rule, and a target parameter, and the classification rule may define one or more types of the target parameter; obtaining N group of target parameter result corresponding to N time interval from a result of historical physiological parameter, where the N time interval is included in the time range, and the N group of target parameter result may be a physiological parameter result corresponding to the target parameter in the result of historical physiological parameter; counting the number of each type of the target parameter in the N group of target parameter result according to the classification rule, and obtaining N group of statistical result corresponding to the N time interval for each target parameter.
US11744523B2

A system or method for validating an unvalidated cardiovascular parameter monitor can include receiving a plurality of reference cardiovascular parameter datasets, each reference cardiovascular parameter dataset associated with a patient of a plurality of patients; receiving a plurality of test cardiovascular parameter measurements, each test cardiovascular parameter measurement includes a cardiovascular parameter measured for a patient of the plurality of patients; and validating the cardiovascular parameter monitor based on an analysis of the plurality of reference cardiovascular measurements and the plurality of test cardiovascular parameter measurement.
US11744521B2

A wearable therapeutic device to facilitate care of a subject is provided. The wearable therapeutic device can include a garment having a sensing electrode. The garment includes at least one of an inductive element and a capacitive element, and a controller identifies an inductance of the inductive element or a capacitance of the capacitive element, and determines a confidence level of information received from the sensing electrode based on the inductance or the capacitance. The wearable therapeutic device also includes an alarm module coupled with the controller and configured to provide a notification to a subject based on the confidence level.
US11744520B2

The disclosure provides a heart rate monitor (HRM) circuit. The HRM circuit includes an analog front end (AFE). The AFE receives a Photoplethysmographic (PPG) signal, and generates a fine PPG signal. A motion cancellation circuit is coupled to the AFE, and receives the fine PPG signal and an accelerometer signal. The motion cancellation circuit subtracts the accelerometer signal from the fine PPG signal to generate a coarse heart rate. A peak detector is coupled to the motion cancellation circuit and the AFE, and generates an instantaneous heart rate. A filter is coupled to the peak detector, and generates an estimated heart rate from the instantaneous heart rate, the estimated heart rate is provided as a feedback to the peak detector.
US11744506B2

The various examples of the present disclosure are directed towards systems and methods for diagnosing brain health. An exemplary system includes a microscope, a processor, and a memory. The microscope outputs image data of a cornea of a patient. The memory has a plurality of stored code sections, which, when executed by the processor, include instructions for analyzing cornea image data to determine brain health. The instructions begin with receiving cornea image data from the microscope. The instructions then provide for determining at least one marker from the received cornea image data. The instructions then provide for outputting a brain health diagnosis based on the at least one marker.
US11744501B2

A multi-sensor patch for simultaneous abdominal monitoring of maternal and fetal physiological data includes a multi-layer flexible substrate. The multi-layer flexible substrate includes a center region and a plurality of electrode regions. An electrode of the plurality of electrodes is located in each of the electrode regions. At least one auxiliary sensor which may be an optical sensor. A module unit is connected to the conductive layer at the center region. The module unit is configured to receive biopotential physiological data from the plurality of electrodes and photosignal data from the optical sensor. The module unit calculates at least fetal heart rate (fHR), maternal heart rate (mHR), and uterine activity (UA) from the biopotential physiological data and fHR, mHR, and SpO2 from the photosignal data.
US11744497B2

An arousal level prediction apparatus and method are disclosed. The arousal level prediction apparatus obtains first biological information indicating current biological information of the user, obtains first environment information indicating a current environment around the user, and obtains living information of the user indicating an activity history of the user. The arousal level predication apparatus includes a process that calculates a first arousal level indicating a current arousal level of the user based on the first biological information, predicts a second arousal level, which is an arousal level of the user at a certain period of time later, based on the first arousal level, the first environment information and the living information, and outputs the second arousal level.
US11744484B2

According to one embodiment, a behavior estimating method for estimating behavior of a person being measured equipped with an activity meter including an acceleration sensor, includes presetting a first angle between a gravitation direction and a direction of action of a standard person being measured, calculating different acceleration waveforms from the activity meter, extracting a second angle between the gravitation direction and the direction of action of the person from the acceleration waveforms, performing a coordinate transformation process among the acceleration waveforms based upon the present first angle and the extracted second angle, and performing behavior estimation of the person using a result of the coordinate transformation.
US11744477B2

A non-invasive method of estimating intra-cranial pressure (ICP). The method including the steps of: a. non-invasively measuring pressure pulses in an upper body artery; b. determining central aortic pressure (CAP) pulses that correspond to these measured pressure pulses; c. identifying features of the ICP wave which denote cardiac ejection and wave reflection from the cranium, including Ejection Duration (ED) and Augmentation Index of Pressure (PAIx); d. non-invasively measuring flow pulses in a central artery which supplies blood to the brain within the cranium; e. identifying features of the measured cerebral flow waves which denote cardiac ejection and wave reflection from the cranium as Flow Augmentation Index (FAIx); f. calculating an ICP flow augmentation index from the measured central flow pulses; g. comparing the calculated ICP pressure augmentation index (PAIx) and flow augmentation index (FAIx) to measure (gender-specific) pressure and flow augmentation data indicative of a measured ICP to thereby estimate actual ICP; and h. noting any disparity between ED measured for pressure waves and ED measured for flow.
US11744472B2

The present approach relates to determining a reference value based on image data that includes a non-occluded vascular region (such as the ascending aorta in a cardiovascular context). This reference value is compared on a pixel-by pixel basis with the CT values observed in the other vasculature regions. With this in mind, and in a cardiovascular context, the determined FFR value for each pixel is the ratio of CT value in the vascular region of interest to the reference CT value.
US11744467B2

A device, system and method for measuring free gas in a cavity of a subject. The device, system and method include a light source for emitting light with a wavelength associated with an absorption band of the free gas, an optical fibre connected to the light source and adapted to be inserted using an introducing member for internal illumination, and a detector adapted to be positioned on a skin surface for detecting light transmitted through the tissue. The device, system and method further includes a control unit for evaluating the detected transmitted light for determining the free gas, or a distribution of the free gas, or concentration of the free gas.
US11744456B2

A dynamic visual acuity measuring device includes a projector projecting an index image pattern, a reflecting mirror reflecting light from the projector, a screen receiving light from the reflecting mirror and displaying the index image pattern, a movable casing holding and maintaining relative positions of the projector, the reflecting mirror, and the screen, a fixed casing supporting the movable casing, and a rotating shaft linking the movable casing rotatably to the fixed casing. In this device, the index image pattern displayed on the screen is moved in one direction by the reflecting mirror being displaced and a direction of movement of the index image pattern is changed in a coordinate system fixed to the fixed casing by the rotating shaft being rotated.
US11744454B2

A speculum, comprising a handle portion including a proximal end, a distal end and at least one sidewall connecting the proximal end and the distal end and having a cavity in the sidewall thereof, a lower blade connected to the handle portion, an upper blade movably connected to the lower blade, the upper and lower blades being configured to move relative to one another between a closed state and an open state, and a lighting assembly comprising at least one light source and at least one energy storage device, said lighting assembly being at least partially disposed in the cavity in the sidewall of the handle portion.
US11744452B1

An intra-oral scanning and image data module comprises a housing having a distal and proximal end, a first aperture proximate to the distal end, and a second aperture proximate to the proximal end. The housing contains a first mirror angled at 45° relative to the first aperture and a second mirror angled at 45° relative to the second aperture. The first and second mirrors are angled relative to each other such that light entering the first aperture is redirected to exit the second aperture. A securement mechanism is connected to the housing, located proximate to the second aperture, and adapted to facilitate a connection of the scanning and image data module to a smart device. A light source is located proximate the distal end. Preferably, the light source is powered by the smart device and is connected to the housing. The module may further comprise an optical lens cartridge disposed within the housing and containing one or more lenses adapted to modify the optical properties of the light entering the first aperture.
US11744444B2

A surgery manipulator arm according to an embodiment may include an arm body and a translation mechanism provided to a distal end portion of the arm body. The translation mechanism includes: a proximal side unit connected to the distal end portion of the arm body; a distal side unit including a tool holding part to which a surgical tool is attached; a connection unit connecting the proximal and distal side units; and an electrical wiring circuit electrically connecting the proximal and distal side units. The connection unit includes first and second pulleys; and a belt member wound around the first and second pulleys. The proximal and distal side units are attached to first and second attachment positions of the belt member such that the distal side unit moves in a direction opposite to a direction in which the proximal side unit moves in association with movements of the belt member.
US11744440B2

An information processing apparatus, an information processing method, and an endoscope system capable of providing an optimal video image to an operator in accordance with surgical scenes are provided. A processing mode determination unit determines, in accordance with surgical scenes, a processing mode for an in-vivo image captured by an imaging apparatus including an imaging element arranged so as to enable pixel shift processing, and an image combining unit processes an image output from the imaging apparatus, in accordance with the processing mode. The present technology is applicable to, for example, an endoscope system for imaging a living body with an endoscope.
US11744438B2

An image processing device for an endoscope outputs a video signal to an image display part that displays an observation image based on the video signal. The image display part is configured such that a first side of a display screen that displays the observation image is shorter than a second side intersecting with the first side, and is configured to be set in both a first setting state in which the first side is along a vertical direction and a second setting state in which the second side is along the vertical direction. The image processing device includes: a setting state recognition part configured to recognize the setting state; and a video signal generation part configured to generate the video signal such that the subject image in the observation image has an orientation corresponding to the setting state of the image display part.
US11744435B2

Disclosed herein is a dishwasher. The dishwasher includes a main body, a tub provided inside the main body, a basket provided inside the tub to store items, an injection assembly configured to spray water to wash the item in the basket, and a duct including a first body configured to supply water to the injection assembly and provided to extend along a first direction, and a second body to which water flows and provided to extend from the first body to along second direction. The duct is formed by coupling of a first housing provided to form at least a portion of the first body and the second body, and a second housing provided to form another portion of the first body and the second body.
US11744432B1

A manual dusting tool incorporating a handle connected to an elongated bendable paddle member adapted for insertion into a textile sock structure for use in dusting hard-to-access surfaces. The bendable paddle member may be deformably bent in either one or two directions to adopt a curved or serpentine shape as may be desired for cleaning.
US11744431B2

A surface cleaning apparatus is provided with a base assembly, an upright assembly, and a fluid recovery system. The base assembly includes a base housing, a brush chamber, at least one brushroll in the brush chamber; and a removable brush housing. A portion of the brush chamber is removable with the brush housing.
US11744430B2

A cleaning device includes a main body, a driving assembly, and a cleaning assembly. The driving assembly includes a driving device, at least one transmission member and a movable bracket. The driving device is arranged on the main body, and has a driving shaft extending toward the bottom of the main body. The movable bracket can be movably connected to the bottom of the main body, and is spaced from the driving shaft. The movement direction of the movable bracket is substantially perpendicular to the extension direction of the driving shaft. The at least one transmission member is connected between the movable bracket and the driving shaft. The driving shaft of the driving device drives the movable bracket to reciprocate back and forth through the at least one transmission member. The cleaning assembly is detachably connected to the movable bracket.
US11744424B2

There is provided a robot including a first light source, a second light source, an image sensor and a processor. The processor is used to calculate an image quality of an image frame captured by the image sensor when the second light source is being turned on. The processor then determines whether to switch the second light source back to the first light source according to the image quality to accordingly identify the material of an operation surface.
US11744419B2

A cleaner reduces noise. The cleaner includes a motor assembly including a motor and a fan rotatable about a rotation axis with a rotational force generated by the motor, a cover surrounding the motor assembly, a guide that guides air from the fan at least partially to an outer surface of the cover, and a rib assembly that guides the air guided by the guide at least partially in a circumferential direction about the rotation axis along the outer surface of the cover.
US11744411B2

A hand sanitizing station includes a conduit in fluid communication with a source of sanitizer, the conduit having a fluid outlet. In addition, the hand sanitizing station includes a valve coupled to the conduit and configured to control the volume of sanitizer that exits the fluid outlet, the valve having a control arm. Further, the hand sanitizing station includes a pedal, and a cable connected between the pedal and the control arm of the valve and configured to move the control arm when the pedal is depressed and open the valve a predetermined amount. Movement of the pedal from a first position to a second position causes sanitizer to flow by gravity from the conduit and out of the fluid outlet, and movement of the pedal from the second position back to the first position closes the valve.
US11744404B2

A grinder includes a body having a first end, a second end defining an opening, and an interior surface defining an inner chamber extending from the opening at least partially towards the first end. The grinder also includes a chain positioned within the inner chamber. The chain includes a plurality of balls. The grinder further includes a motor coupled to the chain. The motor is configured to cause rotational or reciprocal motion of the chain within the inner chamber.
US11744401B2

The disclosure discloses an integrated automatic sea cucumber cooking and soaking system, which belongs to the technical field of sea cucumber processing. The system includes a cabinet body for holding sea cucumbers; the cabinet body is communicated with an external circulating cooling and filtering system and a cold and hot pipe system; the external circulating cooling and filtering system is used for providing cooled filtered circulating water for the cabinet body; the cold and hot pipe system can be used for increasing or decreasing temperature of circulating water in the cabinet body; a top of the cabinet body is provided with a weighing device; the weighing device is connected, through a tension column, to a weighing bracket arranged in the cabinet body; a plurality of groups of supporting holders are arranged on the weighing bracket along a vertical direction; a slotted hole drawer for holding sea cucumbers is arranged on each group of the supporting holder in a supported manner; and the circulating water in the cabinet body is subjected to internal circulation through an internal circulating pipeline arranged outside. According to the disclosure, sea cucumber cooking and soaking processes can be integrated; the cooking and soaking efficiency can be improved; and waste of water is reduced.
US11744400B2

Radiant furniture made of a concrete mix includes one or more heating elements or hot water supplied hydronic tubing that provide comfortable radiant heat. Tabletops can be heated to a temperature that is comfortable for people seated at the table. Benches and seats can be heated to provide comfortable heated seating. Combinations can also be used together, such as a heated tabletop with heated seats. A controller senses the temperature of the furniture and the ambient temperature, then applies power to one or more heating elements in the furniture according to programmed temperature thresholds to provide comfortable radiant heat from the furniture. The controller includes a calibration mode that allows calibrating the controller to a particular heated surface. The controller further comprises a knob that determines an operating mode for the controller and allows adjusting a temperature threshold for the heated surface up or down.
US11744394B2

Provided are an uncovering assembly of a household appliance, and a household appliance. A positioning portion cooperates with a positioning structure on a shell of the household appliance in the uncovering assembly, a cover is prevented from being loosened relative to the shell, in this way visual fool proofing may be achieved. A lock catch switches from an unfastening position to a fastening position after the positioning portion cooperates with the positioning structure. The lock catch, after entering the fastening position, is in mutual restriction with a fastening structure in a vertical direction.
US11744393B2

A wirelessly controllable, motorized and battery powered drapery apparatus is presented having a rotatable drive element having a guide structure in its surface. The rotatable drive is inserted through the open interior of a plurality of tabs in the shade material. A grommet driver is positioned over the rotatable drive element and connected to one of the plurality of tabs. The grommet driver has at least one tooth that is in communication with the guide structure in the rotatable drive element. As the rotatable drive element is rotated, the grommet drive is driven along the length of the rotatable drive element thereby moving the shade material between an open position and a closed position.
US11744390B2

An over-the-door hanging apparatus which includes a mirror apparatus having a rear surface, at least one mounting element located on the rear surface of the mirror apparatus, and at least one over-the-door hanger. The over-the-door hanger may include an elongate member, a bracket for engaging a top edge of a door, a first hook punched into the elongate member and being aligned with a first aperture formed through the elongate member, and a second hook punched into the elongate member and being aligned with a second aperture formed through the elongate member. The mirror apparatus may be slidably mounted to the at least one over-the-door hanger through slidable mating between the at least one mounting element on the rear surface of the mirror apparatus and one of the first and second hooks of the at least one over-the-door hanger.
US11744386B2

The present invention relates to a novel crib bumper device which creates a safe and soft environment for an infant sleeping in a crib. The device is configured to fit snugly between the vertical slats of a crib. Specifically, the device comprises a foam component of adjustable length, with a flat back surface and an inside portion comprising elongated, mushroom-shaped columns sized to fit between the vertical slats of a crib. The flat outside surface is then secured around the perimeter of a crib via a hook and loop fastener strap.
US11744379B1

A convertible bed frame assembly is configured to support a mattress. The bed frame assembly incorporates first and second side-by-side rectangular bed platforms. Each bed platform has a horizontal support surface, opposing lateral ends, and opposing interior and exterior longitudinal sides. A removable center extension is configured to reside between the interior longitudinal sides of the side-by-side bed platforms and coplanar with respective horizontal support surfaces. When installed, the center extension functions to separate the side-by-side bed platforms thereby increasing the width of the bed frame assembly. When removed, the side-by-side bed platforms combine together to reduce the width of the bed frame assembly.
US11744377B2

A submergible stool includes a body having a top, a bottom spaced from the top, and a sidewall extending between the top and the bottom and defining an enclosed interior cavity extending between the top, the bottom, and the sidewall. A first aperture is formed in the sidewall proximate the bottom and extends from the enclosed interior cavity to an exterior of the stool. A second aperture is formed in the sidewall proximate the top and extends from the enclosed interior cavity to an exterior of the stool. The apertures are positioned such that when the stool is placed in a body of water, water will flow into the interior cavity through the first aperture, air will be forced out of the second aperture, and the stool will sink to a bottom of the body of water in an upright position.
US11744358B2

The present invention relates to an adjustment profile (11) comprising an elongated means, substantially square of its cross section which means is provided with evenly spaced fastening openings (13) on at least one of its surfaces for receiving fastening means. In the cross section of this adjustment profile, one of its four sides is open for the whole length dimension of the adjustment profile comprising two opposite edge profiles (12) shaped substantially symmetrical to form a linear guide. Between the two opposite edge profiles (12) forming this linear guide is here arranged a moving carriage (16), whereby the motion of the carriage is supported by at least two bearing units (18) supported on opposite edge profiles.
US11744352B1

A holder for a tool of the type having a belt clip includes a rigid base having a front side, a rear side, a top edge, a bottom edge, and two side edges. At least one rigid belt loop is fixed with the rear side of the rigid base and is open therethrough between side edges thereof for receiving a belt of a person. A rigid front panel is held away from the front side of the rigid base by at least two vertical standoffs. The rigid front panel includes a cut-out portion adapted to receive the belt clip of the tool therein. In use, with the rigid base fixed with the person's belt, the belt clip of the tool is positioned within the cut-out portion of the rigid front panel and then lowered until the belt clip is retained between the rigid front panel and the rigid base.
US11744351B2

A system for transferring an object from one user to another user that is useful to prevent unintentional dropping of the object is disclosed. A cam is rotatably connected to a structure that is configured to be attached to a first user. A central housing with two ports is configured to allow for the attachment of a tool by lanyard or other means. When the first cam is locked into the one of the housing ports, it cannot be released from the housing unless a second cam is inserted into the second housing port and captured. Once the second cam is captured the first cam is released, thus safely passing the tool from the first user to the second user while minimizing the chance of dropping the tool.
US11744349B2

A tactical strap includes an elongated body, a plurality of tabs, and a pouch. The elongated body has a first end, an opposing second end, a front surface, and a rear surface. The plurality of tabs are spaced along at least a portion of the front surface of the elongated body. The pouch is attached to the front surface of the elongated body proximate the first end. The pouch defines a cavity that is selectively accessible.
US11744345B2

A hair comb with improvements in the design of the individual comb tines that result in a more thorough alignment of the individual hair strands when the comb is used on the hair. A comb that uses the individual tines to align the individual hair strands in a primary and a secondary manner. A hair comb with tines that have more than one alignment function. A hair comb with appropriately spaced tines that can aid in the removal of unwanted debris in the hair.
US11744340B2

The invention relates to a rear protection mechanism with a magnetic opening system, intended for objects used to hold elements, such as, for example, briefcases, backpacks or suitcases, said mechanism acting as an anti-theft system for rear, side and/or lower pockets on said objects. The rear mechanism with a magnetic opening system (positioned against the user's body) consists of flaps with non-visible magnets located inside said flaps, which, upon coming into contact with other magnets located on the rear surface of the object, generate an attraction that secures the flaps, such as to prevent third parties from gaining access to pockets on the outside of the briefcase, backpack or suitcase. The invention also relates to a system of self-adjusting straps that allow the weight or load contained in the element-holding object.
US11744330B2

A composite cleat includes a first component and a second component. The first component is made of a first material and is formed a first connecting portion extended along a longitudinal axis and a ground contact surface disposed at one end thereof. The second component is made of a second material different from the first material and is formed a second connecting portion fixedly connected with the first connecting portion and a threaded stud disposed at one end thereof.
US11744328B1

The present application relates to a tightness adjusting device for shoelaces, which includes a connection mechanism and a traction mechanism. The traction mechanism includes a traction assembly, the traction assembly includes a ring member hinged with the connection mechanism, the traction mechanism further includes an elastic adjusting assembly; the elastic adjusting assembly includes a connection block, a clamping block, an elastic member and a linkage member, a connection portion is connected to each end of the connection blocks, the connection portion is detachably connected to the ring member, the connection block divides the ring member into two shoelace holes, the clamping block is hinged with the connection block, the elastic member is configured to force the two clamping blocks away from each other, and to mount the shoelaces in the shoelace holes with the ring member, the clamping block is connected to the connection portion by the linkage member.
US11744325B2

An article of footwear includes an upper formed of a base layer, a reinforcement layer, and an auxetic structure coupled to the reinforcement layer. The base layer includes an elastic material and is elastically deformable between a resting configuration and a stretched configuration. The base layer is configured to be stretched to a predetermined amount. The inelastic reinforcement layer is coupled to the base layer. The reinforcement layer is configured to delimit the stretch amount of the base layer when the base layer is in the stretched configuration.
US11744322B2

The invention relates to a sole (1) of a shoe, particularly of an athletic shoe, wherein the sole (1) has an extension in a longitudinal direction (L) and an extension in a vertical direction (V) perpendicular thereto, wherein a number of recesses (2) is introduced into the sole (1), wherein the recesses (2) extend in a transverse direction (Q) perpendicular to the longitudinal direction (L) and perpendicular to the vertical direction (V) and permeate the sole (1) at least in part. In order to influence the spring behaviour of the sole in a desired, specified manner, according to the invention, there is a first group of recesses (2′) which, without external forces on the sole (1), are larger in the vertical direction (V) than in the longitudinal direction (L), and that there is a second group of recesses (2″) which, without external forces on the sole (1), are smaller in the vertical direction (V) than in the longitudinal direction (L), wherein at least in sections, at least one row (3, 4) of recesses (2′, 2″) is arranged adjacent to each other in the longitudinal direction (L), wherein a recess (2″) of the second group is arranged between two recesses (2′) of the first group.
US11744313B2

A protective helmet including a visor attached to the external sides of the helmet shell. The shell includes substantially flat mount surfaces on each side which correspond with substantially flat portions on the respective ends of the visor. A fastener hole on the shell aligns with an access hole on the visor so that the two elements can be releasably fastened. The access hole provides space for a fastener to protrude out from the surface of the shell, allowing the visor to sit flush against the shell when fastened together. The helmet may include chin straps which are attached to the inner surface of the shell. The helmet may also include a catch strip on the front of the visor which protrudes from the visor such that it can prevent a cloth helmet cover (sometimes used in games such as Roller Derby) from easily sliding off the helmet.
US11744299B2

A safety-monitoring garment system is used to thoroughly monitor the health and performance of a user. The system includes a garment, at least one health-monitoring sensor, at least one performance-tracking sensor, a microcontroller, a user controller, and a portable power source. The garment is preferably a jacket for the user. The at least one health-monitoring sensor continuously monitors the vitals of the user, and the at least one performance-tracking sensor monitors the performance status of the user. The microcontroller stores, analyzes, and delivers the data from the at least one health-monitoring sensor and the at least one performance-tracking sensor to an external computing device. The user controller manages the at least one health-monitoring sensor and the at least one performance-tracking sensor. The portable power source provides the necessary power for the at least one health-monitoring sensor, the at least one performance-tracking sensor, the microcontroller, and the user controller.
US11744289B2

An atomization assembly, including a ceramic core and a stainless-steel tank. The ceramic core includes three or more heating elements connected in parallel. The ceramic core is disposed in the stainless-steel tank.
US11744286B2

An electronic cigarette (e-cigarette) capable of holding, heating, and quantitatively supplying a gelled electronic liquid (e-liquid) is provided. The e-cigarette includes an upper housing, a lower housing, a gel container, a press and reset mechanism, and an aerosol channel. The gelled e-liquid is supplied quantitatively to a heating chamber by manually pressing the press and reset mechanism. The user can adjust the time interval between pressing and releasing the press and reset mechanism according to the needs of the user for each inhalation by adjusting the length of the gelled e-liquid stick supplied to the heating chamber. Besides, a holder is provided therein with heating plates at different positions, and the holder also serves as a heating element. The design avoids the need to provide the heating element and the heating chamber separately, which reduces the volume of the smoking device.
US11744281B2

A device for burning smoking material and inhaling the resulting smoke is disclosed. The device can include an truncated conical member formed from a material having an internal elongated cavity extending from an open end to a closed end. The elongated cavity can be configured to receive a smoking material. The smoking accessory can include a filter disposed within the truncated conical member and defining the closed end. The filter can have a recess formed in a surface of the body along a curved face extending from the first end to the second end, the recess extending radially into the body. The smoking accessory can include a capsule containing a flavoring agent disposed within the recess.
US11744276B2

A method of making a nicotine containing sheet is provided, including steps of combining a source of nicotine salt having a cellulose content of less than about 5% by weight on a dry weight basis with a separate source of fibrous material having a nicotine salt content of less than about 5% by weight on a dry weight basis to form a mixture; and drying the mixture to form a sheet.
US11744269B2

The present invention relates to an environment-friendly, safe and non toxic vegetable and fruit wash composition and its use. The vegetable and fruit wash composition of the present invention ensures removal of dirt, microorganisms, pesticides and/or insecticides from the surfaces of fruits and vegetables. The present composition is also effective in preventing early fruit ripening, crown-rot disease and fruit blackening thus contributes towards extending the life of the fruits/vegetables.
US11744267B2

Rapidly dissolving flavoring composition concentrates are provided. The flavoring composition concentrates have a flavor, a solvent system, a flavor carrier system, and a densifier. The densifier is an acid modifier present in an amount such that it optimizes the rate of dispersion of the concentrate in water.
US11744259B2

The present invention relates to a method of producing a fermented milk product comprising adding lactic acid bacteria to milk, wherein the bacteria comprise Lactobacillus casei and at least one further strain of lactic acid bacteria of a species other than Lactobacillus casei, wherein the further strain has a deficiency in lactose metabolism but is capable of metabolizing one or several carbohydrates other than lactose present in the milk.
US11744257B1

Various implementations of a freeze-drying method are described where the material is cooled by reducing the pressure in a chamber to evaporate and/or sublimate water in the material. In one implementation, the material is dried in the chamber by sublimating ice in the material to water vapor. In another implementation, the freeze-drying method includes actively cooling the chamber. In another implementation, at least a portion of the water vapor is deposited on an actively cooled interior surface of the chamber. In another implementation, the freeze-drying method includes cooling the material to −25° F. or below. In another implementation, the material is cooled at approximately ambient pressure to 30° F. or below and then cooled by reducing the pressure in the chamber.
US11744252B2

A comestible processing machine including a loader plate comprising a plurality of spaced apart openings passing through the loader plate, a first flattener and a second flattener pivotably attached to the loader plate at each of the openings, a sensor configured to detect a comestible disposed within one or more of the plurality of openings, and an actuator coupled to the loader plate and configured to assist in removal of the comestible from the one or more of the plurality of openings.
US11744249B2

Liquid antimicrobial disinfectant compositions for treatment of coronaviruses and specifically the Covid-19 virus (SARS-CoV-2) on skin and surfaces such as PPE (personal protective equipment) are disclosed that are highly efficacious and exhibit total eradication below detectable limits at 30 minutes (>6 log kill) against coronavirus (resulting in complete inactivation), while remaining non-toxic, safe and non-irritating (including at a cellular level and with extended contact) to skin and endogenous tissue. Such disinfectant compositions are additionally highly effective against other pathogens, have extended antimicrobial and antiviral activity for more than 24 hours, have a bio-compatible pH, are suitable for personal, clinical and surgical use and are safe to skin, mucous membranes and wounds, remain stable without precipitation, discoloration or loss of antimicrobial efficacy for at least 12 months, and are beneficial for a range of applications and uses in improving and supporting human and animal health.
US11744244B2

Methods and compositions for improving the compatibility of aqueous herbicide solutions containing at least one of a water soluble salt of an aryloxyalkanoic acid, a water soluble salt of a pyridyloxyalkanoic acid, and a water soluble salt of glyphosate, and optionally ≤16% of one or more fertilizers, such as ammonium sulfate, by adding certain polymeric crystallization inhibitors are provided.
US11744239B2

A configurable nozzle includes a nozzle body having a reception chamber configured to receive an application mixture. The nozzle body includes a nozzle orifice. At least one orifice assembly is coupled with the nozzle body, the at least one orifice assembly includes an orifice plate movably coupled with the nozzle body. The orifice plate extends along at least a portion of the nozzle orifice, and movement of the orifice plate changes one or more of the size or shape of the nozzle orifice. An orifice actuator is coupled with the orifice plate, and the orifice actuator is configured to move the orifice plate.
US11744233B2

A cover assembly for covering a container of pollen substitute comprises a lid member for engaging the container of pollen substitute. The lid member has an opening for bees to access the container contents and a removable cap element covers the lid member opening to divert water from entering the lid member opening while leaving a gap for bees to enter between the cap element and the lid member. A combination nectar feeder and pollen feeder is also provided. The cover assembly may be configured with ornamental shapes to approximate the design of a flower.
US11744230B2

A dog leash attachment system for selectively and releasably attaching a dog leash to a dog collar or harness, wherein the dog leash and the dog collar or dog harness each comprises a portion of a fastener device further comprising at least one magnetic attachment component and at least one mechanical attachment component. One portion of the fastener device is attached in fixed relation to the dog leash at a position proximal to the distal end of the dog leash. Another magnet is disclosed for use in maintaining a portion of the fastener device proximally to the collar or harness when the leash is not in use.
US11744224B2

The present invention provides a novel and improved animal sprayer for use in cooling livestock and other animals in different hot or dry environments, and methods of using the same. Embodiments of the novel animal sprayers may include a valve which does not require constant electric current to remain open during a spraying session, extending system battery life. The valves may also be self-cleaning, less likely to leak, and easily adjusted to control flow rate, reducing both water use and labor costs in monitoring and repairing the animal sprayer.
US11744221B2

A grape plant designated as ‘Compassion’ or a progeny thereof are provided herein. Also provided are pollen, tissues or cells of the plant. The plants or plant parts may be used for breeding or creating transgenic plants. Products made using the grapes of the plant are also provided.
US11744205B1

A novel maize variety designated X95R075 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X95R075 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X95R075 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X95R075, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X95R075 are provided. Methods for producing maize varieties derived from maize variety X95R075 and methods of using maize variety X95R075 are disclosed.
US11744204B1

A novel maize variety designated 1PKRW62 and seed, plants and plant parts thereof are provided. Methods for producing a maize plant comprise crossing maize variety 1PKRW62 with another maize plant are provided. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into 1PKRW62 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby are provided. Hybrid maize seed, plants or plant parts are produced by crossing the variety 1PKRW62 or a locus conversion of 1PKRW62 with another maize variety.
US11744203B1

A novel maize variety designated 1PKSU69 and seed, plants and plant parts thereof are provided. Methods for producing a maize plant comprise crossing maize variety 1PKSU69 with another maize plant are provided. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into 1PKSU69 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby are provided. Hybrid maize seed, plants or plant parts are produced by crossing the variety 1PKSU69 or a locus conversion of 1PKSU69 with another maize variety.
US11744192B2

A supporting device on a supporting pole, in particular for at least one wire for containing row, which includes wire-holding element formed by shaped thread-like body comprising resting portion adapted to be removably rested, in use, on first portion of outer surface of supporting pole and supporting means for containment wire extending from opposite sides with respect to resting portion, and pulling and anchoring element formed by shaped thread-like body including engagement portion adapted to interact, in use, with second portion of outer surface of supporting pole opposite to first portion and elastically deformable anchoring means which extend substantially perpendicularly and from opposite sides with respect to engagement portion and adapted to cooperate with second portion of outer surface of supporting pole.
US11744191B2

A device for the tensioning of wires supporting the vegetation of plants that includes at least one wire tensioning member, one support member adapted to support the tensioning member in rotation, and a blocking means to block the rotation of said tensioning member. The tensioning member includes a metal fork bent and the support member has at least one through-hole penetrated by the tensioning member so that said tensioning member rotates with respect to the support member. The means for blocking the rotation of the tensioning member include at least one recess or groove that reversibly engages with the tensioning member.
US11744185B2

An apparatus and method for separating plant flowers from stalks by means of a lateral rotating tube having a plurality of flexible, elongated members affixed to and extending radially outward from the tube. The apparatus may include a platform and a frame supporting the tube above the platform to accommodate plants held between the platform and the tube so that when the tube is rotating, the elongated members affixed thereto brush against the plants and cause the flowers to brush off at and separate from the stalks. The frame further supports a housing to form a contained space, with a hood to direct the flow of flowers after separation from the stalks. The back wall is positioned a distance away from the platform to allow separated flower and stalk to be eliminated from the apparatus.
US11744180B2

A control system for a harvester that harvests crop stalks each having a bottom portion and a top portion. The harvester includes a topper that cuts the stalks between the top and bottom portions and a base cutter that cuts the stalks near a ground surface. The control system includes a sensor that senses a first height between the top of the bottom portion and the ground surface, and senses a second height between the bottom of the bottom portion and the ground surface. The controller receives signals representing the sensed first and second heights from the sensor, determines average first and second heights for the stalks over a set time, sends a first signal to the topper to cause movement of the topper to the average first height, and sends a second signal to the base cutter to cause movement of the base cutter to the average second height.
US11744179B2

An accumulator contents detection system for a harvester includes an accumulator, a plurality of metering rollers, and at least one sensor. The accumulator accumulates crop material. The plurality of metering rollers receives crop material from the accumulator. The plurality of metering rollers includes a drive metering roller. The at least one sensor detects a load transmitted to the drive metering roller.
US11744171B2

A ready-to-use sprayer comprises a container defining an interior compartment for containing a liquid product and having a pin receiver located near the rear portion and an opening located near the front portion, a housing having a main chamber and a grip portion, a nozzle in selective fluid communication with the outlet of the fluid chamber, a pivot switch on the exterior of the housing for selecting a fluid flow condition for the main chamber, and the housing being coupled to the container at the container opening and the pin receiver.
US11751493B2

Apparatus, methods, and systems are disclosed for robust scalable topological quantum computing. Quantum dots are fabricated as van der Waals heterostructures, supporting localized topological phases and non-Abelian anyons (quasiparticles). Large bandgaps provide noise immunity. Three-dot structures include an intermediate quantum dot between two computational quantum dots. With the intermediate quantum dot in an OFF state, quasiparticles at the computational quantum dots can be isolated, with long lifetimes. Alternatively, the intermediate quantum dot can be controlled to decrease the quasiparticle tunneling barrier, enabling fast computing operations. A computationally universal suite of operations includes quasiparticle initialization, braiding, fusion, and readout of fused quasiparticle states, with, optionally, transport or tunable interactions—all topologically protected. Robust qubits can be operated without error correction. Quasilinear arrays of quantum dots or qubits can be scaled arbitrarily, up to resource limits, and large-scale topological quantum computers can be realized. Extensive two-dimensional arrays can also be used.
US11751490B2

A qubit coupling device includes: a dielectric substrate including a trench; a first superconductor layer on a surface of the dielectric substrate where an edge of the first superconductor layer extends along a first direction and at least a portion of the superconductor layer is in contact with the surface of the dielectric substrate, and where the superconductor layer is formed from a superconductor material exhibiting superconductor properties at or below a corresponding critical temperature; a length of the trench within the dielectric substrate is adjacent to and extends along an edge of the first superconductor layer in the first direction, and where the electric permittivity of the trench is less than the electric permittivity of the dielectric substrate.
US11751478B2

A method of manufacturing a power generation element includes a first step of disposing a support unit that supports a vibration unit in one end portion of the vibration unit in one direction, and disposing a weight unit in the other end portion of the vibration unit in the one direction in a substrate including the vibration unit capable of vibrating, a second step of disposing a piezoelectric unit that generates power due to vibration in a portion of the vibration unit on an opposite side from the support unit side in a thickness direction of the substrate after the support unit and the weight unit are disposed in the vibration unit, and a third step of extracting a power generation element from the substrate by cutting an outer edge of the vibration unit in the thickness direction of the substrate after the piezoelectric unit is disposed in the vibration unit.
US11751476B2

The present invention relates to an electron buffering material and an organic electroluminescent device comprising the same in an electron buffer layer. It is possible to provide an organic electroluminescent device having excellent luminous efficiency and lifespan characteristics by using the electron buffering material according to the present invention.
US11751471B2

Methods, systems, and apparatus for monitoring and controlling electronic devices using wired and wireless protocols are disclosed. The systems and apparatus may monitor their environment for signals from electronic devices. The systems and apparatus may take and disambiguate the signals that are received from the devices in their environment to identify the devices and associate control signals with the devices. The systems and apparatus may use communication means to send control signals to the identified electronic devices. Multiple apparatuses or systems may be connected together into networks, including mesh networks, to make for a more robust architecture.
US11751469B2

An organic light-emitting diode (OLED) display panel, a manufacturing method thereof, and an OLED display device are provided. At least one of a substrate or a backplate in the OLED display panel has a reduced thickness, thereby increasing light transmittance of an electronic element area. Furthermore, an area where a camera lens is disposed can display normally and an under-display camera can be realized without defining a hole. Therefore, a screen-to-body ratio is increased, and a technical problem is solved: in conventional OLED display panels, the hole needs to be defined on the area where the camera lens is disposed, leading to a display effect being affected.
US11751466B2

Embodiments of the disclosed subject matter provide an apparatus having a device with a micronozzle array disposed on a micro-fabricated fluidic die. The device may include a first gas distribution plate and a second opposing plate, where the micro-fabricated fluidic die is disposed between the first gas distribution plate and the second opposing plate, wherein the first gas distribution plate is irreversibly joined to the micronozzle array with a seal that is gas-tight, and where the first gas distribution plate includes a plurality of sealed flow paths. A manifold may be reversibly joined to the first gas distribution plate, where the micro-fabricated fluidic die and the first gas distribution plate and the second opposing plate are disposed between the manifold. A thermally conductive plate may have at least one window that provides a clearance fit for the device across a range of motion relative to the thermally conductive plate.
US11751464B2

Provided is a display substrate. The display substrate includes: a base substrate, a plurality of sub-pixels, a plurality of data lines, a plurality of data transmission lines, a plurality of electrostatic discharge circuits, a panel crack detection trace, and a plurality of electrostatic discharge dummy circuits. At least one of the electrostatic discharge dummy circuits may be connected to the panel crack detection trace. A display device is also provided.
US11751452B2

According to one embodiment, a display device includes a first substrate, a second substrate opposing the first substrate, a wiring substrate connected to the first substrate, a cover member located on an opposite side to the first substrate so as to interpose the second substrate therebetween and a conductive layer maintained at a predetermined potential, and the first substrate includes an extension portion extending further from the second substrate, the wiring substrate is connected to the extension portion, the cover member includes a first surface opposing the extension portion, and the conductive layer overlaps the extension portion in plan view.
US11751451B2

According to one embodiment, a display device includes a pixel area including pixels each including at least one thin film transistor includes a semiconductor layer and a gate electrode, a first terminal area including a first wiring line disposed thereon connected to the at least one thin film transistor, a first protective film provided on the semiconductor layer, the gate electrode and the first wiring line, a first insulating film provided on the first protective film, a second protective film provided on the first insulating film, a second insulating film provided on the second protective film, a first opening formed in the first terminal area, and partially exposing the first wiring line, and a second opening formed to correspond to the first opening.
US11751442B2

A display panel and a display device are provided. The display panel has a display area. The display panel includes: a base substrate; a driving circuit and at least one signal line on the base substrate; and at least one insulating layer between the driving circuit and the at least one signal line. The driving circuit is disposed in a periphery of the display area; and an orthogonal projection of at least one of the signal lines on the base substrate has an overlapping area with an orthogonal projection of the driving circuit on the base substrate.
US11751440B2

A display panel and a method of manufacturing a display panel are disclosed. The display panel is provided with a first electrode disposed on the same layer as a source electrode. A plurality of signal lines are disposed on the same layer as a plurality of light shielding patterns, so that a light shielding layer and a gate line layer can be used for wiring layouts, and a spacing between two electrodes of a parasitic capacitance formed between metal wirings and metal film layers is increased. In this manner, a parasitic capacitance of a subpixel driving circuit can be reduced, so that response times of the display panel can also be reduced.
US11751433B2

A transistor display panel according to an exemplary embodiment includes: a substrate; a first transistor disposed on the substrate; and a pixel electrode connected to the first transistor, wherein the first transistor includes a lower electrode disposed on the substrate, a first semiconductor overlapping the lower electrode, a first insulating layer covering the first semiconductor, a first gate electrode disposed on the first insulating layer and overlapping the first semiconductor, and a first source connecting member and a first drain connecting member disposed on the same layer as the first gate electrode and connected to the first semiconductor, wherein the first gate electrode is formed as a triple layer, the first source connecting member and first drain connecting member are formed as a double layer, and the first source connecting member is connected to the lower electrode.
US11751418B2

A display panel may include a first display substrate, a second display substrate disposed over the first display substrate, and a sealing member bonding the first display substrate and the second display substrate. The sealing member may include a frit sealing member including an outer region and an inner region, with the inner region disposed next to an inner side of the outer region and having a first crystallization temperature lower than a second crystallization temperature of the outer region, and an organic sealing member disposed next to an inner side of the frit sealing member.
US11751414B2

An display device may include a substrate including an active area and an inactive area surrounding the active area, a plurality of thin film transistors disposed in the active area, each of the thin film transistor including a semiconductor layer and a first electrode, a light emitting elements disposed in the active area, each of the light emitting element including an anode electrode and an organic light emitting layer, a connection area and a peripheral area disposed in the inactive area, and a first reflective electrode disposed in the connection area.
US11751399B2

A semiconductor memory device according to an embodiment includes a first stacked body, a second stacked body, an intermediate conductive layer, an intermediate insulating layer, a semiconductor pillar, a charge storage film, and an insulating film. The semiconductor pillar includes a first part, a second part, and a third part. The charge storage film includes a first charge storage portion and a second charge storage portion. The charge storage film includes at least one first element selected from the group consisting of nitrogen, hafnium, and aluminum. The insulating film provides in at least a portion between the intermediate conductive layer and the first part. The insulating film not includes the first element, or the insulating film has a concentration of the first element lower than a concentration of the first element of the charge storage film.
US11751398B2

A memory structure including a substrate, a gate structure, a charge storage layer, and a first control gate is provided. The substrate has a fin portion. A portion of the gate structure is disposed on the fin portion. The gate structure and the fin portion are electrically insulated from each other. The charge storage layer is coupled the gate structure. The charge storage layer and the gate structure are electrically insulated from each other. The first control gate is coupled to the charge storage layer. The first control gate and the charge storage layer are electrically insulated from each other.
US11751389B2

A three-dimensional (3D) memory device and a manufacturing method thereof are provided. The 3D memory device includes a substrate, insulation layers, gate material layers, and a vertical structure. The insulation layers and the gate material layers are disposed on the substrate and alternately stacked in a vertical direction. The vertical structure penetrates the gate material layers in the vertical direction. The vertical structure includes a semiconductor layer and a trapping layer. The semiconductor layer is elongated in the vertical direction. The trapping layer surrounds the semiconductor layer in a horizontal direction. The trapping layer includes trapping sections aligned in the vertical direction and separated from one another. The electrical performance of the 3D memory device may be improved by the trapping sections separated from one another.
US11751380B2

A semiconductor memory structure includes a semiconductor substrate, a bit line disposed on the semiconductor substrate, and a capacitor contact disposed on the side of the bit line. The capacitor contact includes a semiconductor plug disposed on the semiconductor substrate, a metal plug disposed on the semiconductor plug, a metal silicide liner extending along the sidewalls and bottom of the metal plug, and a nitride layer disposed on the metal silicide liner. The top surface of the metal silicide liner is lower than the top surface of the metal plug. The nitride layer surrounds the top portion of the metal plug.
US11751376B2

There are provided a semiconductor memory device and a manufacturing method thereof. The semiconductor memory device includes: a first etch stop layer; a source layer on the first etch stop layer; a second etch stop layer on the source layer; a stack structure on the second etch stop layer; and a channel structure penetrating the first and second etch stop layers, the source layer, and the stack structure, the channel structure being electrically connected to the source layer. A material of each of the first and second etch stop layers has an etch selectivity with respect to a material of the source layer.
US11751371B2

A component mounting device includes a control device configured to execute a recognition data creation process and a pickup process. In the recognition data creation process, the control device creates the recognition data by obtaining the angle information of the component, causing the imaging device to operate so as to image the component, and rotating the captured image so obtained to the reference angle based on the angle information. In the pickup process, the control device causes the head to operate so as to pick up the component after the supply state of the component is determined based on the captured image obtained by causing the imaging device to operate so as to image the component, the recognition data created in the recognition data creation process, and the angle information.
US11751369B2

Provided is a method for removing an electronic component from a printed wiring board. The method comprises applying an embrittlement agent to a lead of an electronic component that is soldered to the printed wiring board. The electronic component is removed from the printed wiring board by breaking the embrittled lead.
US11751357B2

An apparatus including a heat sink having two or more sections of parallel fins that define colinear channels is disclosed herein. The colinear channels are configured to direct flow of air or coolant across the heat sink and have wider channel widths closer to an inlet for the air or coolant and narrower widths closer to an outlet for the air or coolant.
US11751355B2

Provided herein is a system and method for heat exchange of a vehicle. The system comprises an enclosure disposed on the vehicle. The enclosure comprises a vent at a base of the enclosure. The enclosure houses one or more sensors. The enclosure comprises a fan disposed at a base of the enclosure. The heat exchange system comprises an deflector disposed on the vehicle outside the enclosure and configured to direct an airflow into the vent of the enclosure. The heat exchange system comprises a motor configured to: generate electricity from the airflow and selectively supply electricity to operate the fan. The heat exchange system comprises a controller configured to adjust the deflector and regulate an amount of electricity supplied from the motor to the fan.
US11751347B2

According to an embodiment, an electronic apparatus includes a printed circuit board including a plurality of devices that include a nonvolatile memory package and a controller package configured to control the nonvolatile memory package, and a housing accommodating the printed circuit board. The housing includes an opening on a surface constituting the housing. An encryption device among the plurality of devices is present in a first region. The first region is a region on the printed circuit board that is not irradiated with light emitted from a light source placed at the opening. The encryption device is a device used for an encryption process of data to be stored into the nonvolatile memory package.
US11751346B2

The present application discloses a rotating device and a display device, which relate to a field of electronic technologies. The rotating device includes: a first member including an anti-rotation groove and at least one first connecting portion; and a second member including an anti-rotation protrusion and at least one second connecting portion. The first connecting portion and the second connecting portion are rotationally connected, and the anti-rotation protrusion enters the anti-rotation groove to prevent the first connecting portion from rotating along a first direction with respect to the second connecting portion.
US11751343B2

A modularly expandable electronic control unit comprises: an electronic circuit board on which a conductor track is disposed on a side in a region of lateral edges and enclosing an inner region and separating it from an outer region of the side, a housing having two halves for receiving the electronic circuit board. With the housing assembled, at least one housing half has an encircling electrically conductive shielding wall which rests on and establishes electrical contact with the conductor track and/or has at least one receptacle accessible from outside the assembled housing. The receptacle is disposed so the electronic module placed in the receptacle may be electrically connected to a module connection port disposed in the outer region of the electronic circuit board. The electronic circuit board has electrical connections between the module connection port and one or more electronic assemblies disposed on the inner region.
US11751342B2

A display device includes a display panel and a transparency control panel. The display panel includes a first bonding area. The transparency control panel is disposed below the display panel and includes a second bonding area. The first bonding area is not shielded by the transparency control panel, and the second bonding area is not shielded by the display panel.
US11751341B2

An electronic apparatus includes a bottom cover, a main board provided with a stud, a screw, a washer, and a sponge. The screw has a head portion having a diameter larger than that of an attachment hole, a male screw portion configured to be screwed into a first female screw portion, and a columnar portion having a diameter smaller than a root diameter of the male screw portion. The washer has a flange portion having a diameter larger than that of the attachment hole, a cylindrical portion having a diameter smaller than that of the attachment hole, and a second female screw portion which the male screw portion is screwable into and passable through. The head portion abuts on the bottom cover to fix the bottom cover by the male screw portion. The flange portion is between the stud and the bottom cover.
US11751336B2

An apparatus is disclosed for transferring a pattern of a composition containing particles of an electrically conductive material and a thermally activated adhesive from a surface of a flexible web to a surface of a substrate. The apparatus comprises: respective drive mechanisms for advancing the web and the substrate to a nip through which the web and the substrate pass at the same time and where a pressure roller acts to press the surfaces of the web and the substrate against one another, a heating station for heating at least one of the web and the substrate prior to, or during, passage through the nip, to a temperature at which the adhesive in the composition is activated, a cooling station for cooling the web after passage through the nip, and a separating device for peeling the web away from the substrate after passage through the cooling station, to leave the pattern of composition adhered to the surface of the substrate.
US11751335B2

A printed circuit board includes: a first substrate including a first cavity and first circuit units; and a second substrate disposed in the first cavity of the first substrate with an electronic component disposed therein, and including second circuit units having a higher density than the first circuit units, wherein the second substrate includes a first region and a second region, the first region of the second substrate includes an outermost circuit layer among the second circuit units, and circuit layers in the first region of the second substrate have a higher density than circuit layers in the second region of the second substrate.
US11751333B2

An interconnection for flex circuit boards used, for instance, in a quantum computing system are provided. In one example, the interconnection can include a first flex circuit board having a first side and a second side opposite the first side. The interconnection can include a second flex circuit board having a third side and a fourth side opposite the third side. The first flex circuit board and the second flex circuit board are physically coupled together in an overlap joint in which a portion of the second side for the first flex circuit board overlaps a portion of the third side of the flex circuit board. The interconnection can include a signal pad structure positioned in the overlap joint that electrically couples a first via in the first flex circuit board and a second via in the second flex circuit board.
US11751328B1

Provided are flexible interconnect circuit assemblies and methods of fabricating thereof. In some examples, a flexible interconnect circuit comprises multiple circuit portions, which are monolithically integrated. During the fabrication, some of these circuit portions are folded relative to other portions, forming a stack in each fold. For example, the initial orientation of these portions can be selected such that smaller sheets can be used for circuit fabrication. The portions are then unfolded into the final design configuration. In some examples, the assembly also comprises a bonding film and a temporary support film attached to the bonding film such that the two circuit portions at least partially overlap with the bonding film and are positioned between the bonding film and temporary support film. In some examples, at least some circuit portions extend past the boundary of the bonding film and are coupled to connectors.
US11751327B2

The invention relates to an electrically conductive film (10) having an electrically nonconductive substrate layer (12), and an electrically conductive metal layer (14) that has a structure produced by material removal and that on a first side is joined, at least in sections, to the substrate layer (12).
US11751312B2

A load control system for controlling a plurality of lighting loads located in a space may be configured to track the location of one or more tracked devices. The load control system may comprise a system controller, lighting control devices, e.g., for controlling a plurality of lighting loads, and tracked devices. The tracked devices may each transmit beacon messages. The lighting control devices may receive the beacon message. The lighting control devices may measure a communication quality metric of each of the beacon messages, and process the measured communication quality metrics received over a period of time to determine a processed communication quality metric for the tracked device. The lighting control devices may transmit tracking data to the system controller. The system controller may determine a location of the tracked device. For example, the system controller may determine the location of the tracked device via trilateration.
US11751308B2

The invention relates to an isolated driver (100) for lighting means (109), comprising: a primary circuit (100a), a secondary circuit (100b), an isolation barrier (106) separating the primary circuit (100a) and the secondary circuit (100b), wherein a ground potential of the primary circuit (100a) and a ground potential of the secondary circuit (100b) are connected via a capacitor (107), and a control circuit (111) on the secondary side (100b), monitoring a current to/from the capacitor (107) to the ground potential of the secondary circuit (100b) and issuing a mains (101) failure signal in case the current does not meet predefined conditions, preferably in case no such current is detected.
US11751307B2

A device comprises a voltage regulator, circuits, a voltage-to-current converter, a control bus, a resistor and a resistor network. Each of the circuits has at least one LED connector and one LED driver. Each of the circuits has a measuring circuit for detecting voltage differences between the potentials of LED terminals and a reference potential. Further, each of the circuits includes a local controller. The local controller withdraws a current from the control bus in dependence on the detected voltage differences. Bias current sources inject bias currents into the control bus in form of a sum current of the injected bias currents. The resistor performs a current-to-voltage conversion of the sum current to a control voltage. The voltage-to-current converter converts the control voltage into a current. The resistor network converts the current into a voltage value. An output voltage of the voltage regulator depends on the voltage value.
US11751302B2

A linear light-emitting diode (LED) lighting apparatus may include an array of light emitting diodes (LEDs) that may include a first plurality of LEDs that produces a first light having a first color temperature. The first plurality of LEDs aligns within a first linear shape. The second plurality of LEDs may produce a second light having a second color temperature different from the first color temperature. The second plurality of LEDs aligns within a second linear shape. The lighting apparatus may also include a driver circuit that outputs a plurality of currents and a switch assembly that may couple to the driver circuit. The switch assembly may include a first switch that may cause the driver circuit to output one of the plurality of currents and a second switch that may cause the one of the plurality of currents to couple to the first plurality of LEDs, the second plurality of LEDs, or both.
US11751292B2

An electromagnetically heated cooking utensil, and a heating control circuit and method therefor. The heating control circuit includes a first resonance device; a second resonance device; a first power switch; a second power switch; a first synchronization device that detects voltages of both ends of the first resonance device to output a first synchronization signal; a second synchronization device that detects voltages of both ends of the second resonance device to output a second synchronization signal; and a control device that selects, according to the heating mode of the electromagnetically heated cooking utensil, the first synchronization signal to generate a driving signal for driving the first power switch, a second synchronization signal to generate a driving signal for driving the second power switch.
US11751291B2

An induction heating apparatus is provided. The induction heating apparatus includes a heating coil, an inverter, a current sensor configured to measure a driving current supplied from the inverter to the heating coil, and a controller configured to provide a drive signal to the inverter to allow the driving current to follow a target current based on a user input. The controller reduces a driving duty of the drive signal based on the driving current exceeding a predetermined reference current, and the controller provides a drive signal to the inverter to allow the driving current to follow a current less than the target current, based on the driving current being less than or equal to the predetermined reference current after reducing the driving duty of the drive signal.
US11751289B2

A heater includes a sintered assembly and a functional element disposed on one of opposing surfaces of the sintered assembly. The heater is manufactured by a method that includes hot pressing a ceramic powder and a plurality of first slugs and forming the sintered assembly including a ceramic substrate and the plurality of first slugs embedded therein, forming the functional element on the one opposing surface of the sintered assembly such that the functional element is connected to the plurality of first slugs, and forming a monolithic substrate in which the functional element and the plurality of first slugs are embedded.
US11751288B2

A heat-emitting transparent plate includes a heat-emitting region that is transparent to visible light and is a region that emits heat by absorbing infrared rays. The heat-emitting region includes a meta-surface, and the meta-surface includes a plurality of meta-patterns to absorb infrared rays. A method of manufacturing a heat-emitting transparent plate includes forming a material layer on a transparent substrate and forming a plurality of patterns on the transparent substrate by patterning the material layer. The plurality of patterns include a material that is transparent to visible light and that emits heat by absorbing infrared rays, and a pitch of the plurality of patterns is less than a wavelength of the infrared rays. A heat-emitting device includes the heat-emitting transparent plate and a light source.
US11751281B2

Provided are a method for supporting service continuity when a disaster situation ends, and a device supporting same. A user equipment (UE) receives, from a disaster roaming PLMN, a configuration update command message including information indicating that a disaster condition of a home PLMN (HPLMN) has ended. The UE waits until a service that is being received from the disaster roaming PLMN ends, and performs, after the service that is being received from the disaster roaming PLMN ends, a procedure of deregistration from the disaster roaming PLMN on the basis of information indicating that the disaster condition of the HPLMN has ended.
US11751280B2

According to one configuration, multiple users in a tiered hierarchy share use of a wireless spectrum. For example, a spectrum access system receives a notification indicating that a first-priority tier 1 user in the hierarchy temporarily needs access to a first wireless spectrum assigned to a second-priority tier 2 user in the hierarchy. In response to the notification, the spectrum access system temporarily allocates the second-priority tier 2 user use of a second wireless spectrum. The spectrum access system protects use of the second wireless spectrum by the second-priority tier 2 user from a third-priority tier 3 user in the hierarchy. In certain instances, the one or more spectrum access systems receive the same notification of use of the first wireless spectrum by the first-priority tier 1 user. The multiple spectrum access systems not serving the second-priority tier 2 user protect the Tier 2 User from any Tier 3 Users in the hierarchy.
US11751272B2

The disclosure relates to a communication method and system for converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT). The disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology, such as a smart home, a smart building, a smart city, a smart car, a connected car, health care, digital education, a smart retail, security and safety services.
US11751263B2

An information handling system includes a first wireless data communication interface configured to establish wireless data communication links on a first frequency band, a second wireless data communication interface configured to establish wireless data communication links on a second frequency band, and a processor. The processor establishes a first data communication link on the first wireless data communication interface with an access point external to the information handling system, determines a first link characteristic for the first data communication link, establishes a second data communication link on the second wireless data communication interface with the access point, determines a second link characteristic for the second data communication link, selects one of the first and second data communication links based on the first and second link characteristics, and maintains the selected one of the first or second data communication links based upon the selection. The first and second link characteristics are of a common type of characteristic.
US11751261B2

A method of wireless communications forms a group with multiple UEs within a vicinity of a UE. The method establishes a tunnel between the UE and each of the UEs. The method also aggregates network resources obtained from a network interface of the UE and network resources shared by the UEs via each tunnel. The method provides the aggregated network resources to an application of the UE.
US11751255B2

Provided are a data transmission method, apparatus and computer readable storage medium. The method includes: sending, by a terminal, a random access preamble to a base station, and receiving, by the terminal, a random access response sent by the base station; and sending, by the terminal, a first request message carrying uplink data to the base station; wherein the sending, by the terminal, the random access preamble to the base station comprises: in response to determining that the terminal satisfies a first preset condition, sending, by the terminal, the random access preamble for requesting an uplink data transmission resource to the base station; and wherein the method further comprising one of: failing to receive, by the terminal, a second response message returned by the base station; receiving, by the terminal, the second response message carrying an uplink data failure indication or an uplink data retransmission indication returned by the base station; or in response to determining that the terminal fails to receive the random access response returned by the base station, determining, by the terminal, a random access failure and reinitiating, by the terminal, random access.
US11751249B2

Methods, systems, and devices for wireless communication are described. For a user equipment with a number of M greater than or equal to two antennas, a signal is transmitted from at least a first antenna and a second antenna at a first time with an initial relative phase state including a first relative phase rotation between the signals transmitted by the first and second antennas. In response to a determination that a response signal was not received at the user equipment, the signal is retransmitted from at least the first antenna and the second antenna with a subsequent relative phase state among the transmitting antennas, including a second different relative phase rotation, at a second time. The second time may be the next subsequent retransmission of the signal or may be a retransmission following one or more retransmissions using the first relative phase rotation.
US11751248B2

The present disclosure relates to random access methods, apparatus, and devices. One example method includes adjusting a sweeping parameter of a receive beam when at least one target receive beam is determined based on prior information, and sweeping the receive beam based on the adjusted sweeping parameter. The prior information includes at least one of cell historical information or cell handover information. The sweeping parameter includes at least one of a sweeping frequency, a sweeping sequence, a beam direction, or a beam width. The receive beam includes the at least one target receive beam. The receive beam is used to receive a random access preamble sent by a terminal. After a base station receives, on the receive beam, the random access preamble sent by the terminal, the terminal randomly accesses the base station for data communication.
US11751247B2

A wireless station that belongs to a communication cell includes a receiver which, in operation, receives a trigger frame transmitted from an access point that belongs to an interference cell and a controller which, in operation, determines, based on at least one parameter included in the trigger frame and reception power value of the trigger frame received at the wireless station, whether the wireless station is allowed to transmit to other wireless station that belongs to the communication cell, wherein the at least one parameter includes a value set based on transmit power value of the trigger frame transmitted from the access point.
US11751246B2

A method for transmitting a physical layer protocol data unit (PPDU) in a transmission opportunity (TXOP) and a device using the same are provided. The device transmits a request to send (RTS) frame to a plurality of receiving stations. The RTS frame includes a bandwidth field and a plurality of allocation fields. The bandwidth field indicates a first bandwidth in which the RTS frame is transmitted. Each allocation field indicates a bandwidth in which a clear to send (CTS) frame is to be sent by a corresponding receiving station. The device determines a transmission bandwidth of a PPDU to be sent by comparing the first bandwidth with a second bandwidth which is a total bandwidth indicated by the plurality of allocation fields.
US11751225B2

Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a base station may determine a result associated with an initial set of transmissions of a periodic transmission cycle, and switch a search space configuration set to be used for one or more slots of the periodic transmission cycle based at least in part on the result, the search space configuration set being switched to a candidate search space configuration set. In some aspects, a user equipment may determine that a search space configuration set to be used for a slot of a periodic transmission cycle is to be switched based at least in part on a result associated with an initial set of transmissions of the periodic transmission cycle; and switch the search space configuration, the search space configuration set being switched to a candidate search space configuration set. Numerous other aspects are provided.
US11751211B2

The present application provides a method for processing a physical resource, a user equipment, and a base station. The method for processing a physical resource includes the following steps: determining scheduled physical resource blocks (PRB) based on indication information of carrier sensing result of at least one received frequency sub-band and indication information of physical resource blocks; and receiving data on the scheduled PRBs.
US11751195B2

In embodiments of systems and methods for managing control signaling for multicast communications, a base station may transmit to a wireless device an indication of whether to monitor a group common physical downlink control channel (GC PDCCH), a wireless device-specific PDCCH for multicast configuration information, or both. The base station may determine a schedule for transmitting multicast communications to the wireless device based on a capability reported by the wireless device, and may transmit to the wireless device an indication of whether a transport block for GC multicast communications including services for multicast communications will be scheduled by the GC PDCCH, the wireless device-specific PDCCH, or both. The base station may transmit, and the wireless device may receive, the multicast communications according to the multicast configuration information and the schedule.
US11751193B2

Methods, systems, and devices for wireless communication are described. In one example, a method for wireless communication at a user equipment (UE) includes identifying that the UE is in carrier aggregation communication with a first cell having a first sub-carrier spacing and a second cell having a second, different sub-carrier spacing. The method may further include monitoring one or more UE-specific search spaces of the first cell for first control information scheduling a first data communication on the first cell and one or more UE-specific search spaces of the first cell or the second cell for second control information scheduling a second data communication on the first cell, and resolving a scheduling order of the first control information scheduling the first data communication and the second control information scheduling the second data communication based at least in part on the monitoring and on a scheduling condition.
US11751191B2

Various embodiments relate to a method performed by a station to identify the maximum allowed transmit power spectral density (PSD) of a basic service set (BSS), including: receiving, by the station, a first field from an access point (AP) of the BSS, wherein the first field indicates that the BSS bandwidth is set to M times a unit channel bandwidth; receiving, by the station, a set of second fields from the AP, wherein the set of second fields includes K fields corresponding to K channels and wherein each of the K second fields indicates the maximum allowed transmit PSD for the K channels and the bandwidth of the channel is the unit channel bandwidth; and identifying, by the station, the maximum allowed transmit PSD of the M channels of the BSS bandwidth from the first M consecutive second fields.
US11751179B2

Various designs for optimization of carrier aggregation (CA) capability signaling are discussed. A user equipment (UE) configured for CA determines to signal supported CA combinations that include a band, the band being one of a first band and a second band. The first band is a superset of the second band. The UE signals the supported CA combinations that include the band to the network. A base station receives a signal indicating the CA combinations supported by the UE that include the band. The base station determines CA combinations that include the first band and CA combinations that include the second band based on the CA combinations received from the UE.
US11751172B2

In a method of sidelink resource control, a first core network configured based on a first radio access technology receives a sidelink control request from a first user equipment that accesses the first core network using the first radio access technology, the sidelink control request requesting sidelink control information for a second radio access technology that is not supported by the first core network. The sidelink control information for the second radio access technology is obtained directly from a second core network outside the first core network, the second core network being configured based on the second radio access technology, and the sidelink control information for the second radio access technology being provisioned by the second core network. The obtained sidelink control information for the second radio access technology is provided, via the first radio access technology and in response to the sidelink control request, to the first user equipment.
US11751161B2

The present application discloses a terminal device locating method, a terminal device, a system, an emergency locating server, an electronic device and a storage medium, and relates to locating and information flow technologies. A specific implementation solution is: acquiring dialing information of a call of a terminal device, sending information related to a location of the terminal device through a non-network channel to an emergency locating server if the call is determined to be an emergency call according to the dialing information, where the information related to the location of the terminal device is used to locate the terminal device and obtain locating information of the terminal device.
US11751160B2

A method includes after receiving a first non-access stratum (NAS) security mode command (SMC) message sent by an initial access and mobility management function (AMF), a user equipment (UE) stores a first NAS security context; the UE receives a second NAS SMC message sent by a second AMF, where the message carries indication information used to indicate the UE to use the first NAS security context; and the UE uses the first NAS security context as a current NAS security context based on the indication information. According to the method for mobility registration provided in this application, when receiving the second NAS SMC message sent by the second AMF, the UE uses the first NAS security context as the current NAS security context, and then processes the second NAS SMC message, so that the NAS security contexts on the UE and the second AMF are consistent.
US11751156B2

In one embodiment, a method comprises: receiving, by a constrained wireless network device comprising a local clock, a plurality of messages from respective neighboring wireless network devices advertising as available parent devices in a directed acyclic graph of a time-synchronized network that is synchronized to a master clock device; determining, by the constrained wireless network device, a corresponding timing error of the local clock relative to each message output by the corresponding available parent device; and executing, by the constrained wireless network device, a distributed time synchronization of the local clock with the master clock device based on correlating the respective timing errors relative to the local clock.
US11751147B2

Certain aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment may identify that a band is associated with a first numerology and a second numerology for synchronization, and/or perform a synchronization scan to identify a synchronization signal block using stored data, wherein the stored data includes data regarding a plurality of frequency locations of the band, and wherein the synchronization scan is performed with regard to a first set of frequency locations, of the plurality of frequency locations, associated with the first numerology, and wherein the synchronization scan is performed with regard to a second set of frequency locations, of the plurality of frequency locations, associated with the second numerology, wherein the second set of frequency locations includes a proper subset of frequency locations of the plurality of frequency locations. Numerous other aspects are provided.
US11751144B2

Disclosed are methods, systems, and computer-readable medium to perform operations for selecting a device to prioritize for a high power link. The operations include detecting, in proximity of a mobile device, a first and second available devices. The operations also include establishing a respective connection with each of the first and second available device using a first radio access technology (RAT). Further, the operations include determining, using the respective connections, one or more metrics associated with first available device and the second available device, where the one or metrics comprise a respective angle of arrival at the mobile device corresponding to the first available device and the second available device. Further, the operations include determining, based at least on the one or more metrics, to establish a high power link with the first available device using a second RAT, where the second RAT utilizes more power than the first RAT.
US11751143B2

Disclosed is a wireless communication device that can suppress an increase in power consumption of a terminal while preventing the degradation of SINR measurement precision resulting from TPC errors in a base station. A terminal controls the transmission power of a second signal by adding an offset to the transmission power of a first signal; an offset-setting unit sets an offset correction value in response to a transmission time gap between a third signal transmitted the previous time and the second signal transmitted this time; and a transmission power control unit controls the transmission power of the second signal using the correction value.
US11751140B2

A channel monitoring method includes: configuring a specified occurrence of a power-saving signal and a specified effective time range of the specified occurrence for a terminal, the specified occurrence representing a specified effective range of the power-saving signal for subsequent discontinuous reception (DRX); generating first notification information, the first notification information comprising the specified occurrence and the specified effective time range; and sending the first notification information to the terminal, so that the terminal acquires the specified occurrence and the specified effective time range from the first notification information, and performs channel monitoring according to the specified occurrence and the specified effective time range.
US11751138B2

Electronic shelf label system that has: at least one battery-operated shelf label client that has an energy-saving sleep mode without radio communication standby according to a radio standard and an active mode with radio communication standby according to the radio standard and that has a radio wake-up receiver designed so as, on receiving a wake-up signal, to leave the sleep mode and prompt the active mode to be adopted, and an access point that is designed for radio communication with the at least one shelf label client according to the radio standard and that has a radio wake-up transmitter for transmitting the wake-up signal, wherein the radio wakeup transmitter is designed to be controllable in terms of the time at which the wake-up signal is transmitted by the access point, and the access point defines the time as the initiation of a radio connection setup to the at least one shelf label client according to the radio standard, in particular with a lead time for changing from the sleep mode to the active mode.
US11751131B2

A transportation vehicle, a network node, an apparatus, a computer program, and a method for selecting a mobile communications system for a mobile communications service. The method includes obtaining for each of multiple mobile communications services information on a required quality of service (rQoS) of the mobile communications services, determining for each of multiple mobile communications systems information on a predicted quality of service, and selecting from the multiple mobile communications systems a mobile communications system for each of multiple mobile communications services based on the information on the rQoS and the pQoS of the mobile communications system.
US11751126B2

Methods, systems, and devices for wireless communications are described. A user equipment (UE) may identify that the UE is to scan one or more frequency bands during a cell acquisition procedure. The UE may receive one or more over-the-air signals, each of the one or more over-the-air signals having a respective bandwidth that includes a corresponding plurality of channels from a frequency band of the one or more frequency bands. The UE may process individual ones of the one or more over-the-air signals. The UE may evaluate, in corresponding batches for each of the individual ones of the one or more over-the-air signals, each of the corresponding pluralities of channels for cell acquisition. The UE may acquire a cell via batch-wise evaluation of the corresponding pluralities of channels.
US11751124B2

Disclosed herein is a method and system for detecting, monitoring and/or controlling one or more of mobile services for a mobile communication device (also referred to herein as a Controllable Mobile Device or CMD), and in particular, when the device is being used and the vehicle, operated by the user of the device, is moving. The present method and system determines whether the vehicle is being operated by a user that may also have access to a mobile communication device which, if used concurrently while the vehicle is in operation, may lead to unsafe operation of the vehicle. If the mobile services control system determines that a vehicle operator has potentially unsafe access to a mobile communication device, the mobile services control system may restrict operator access to one or more services that would otherwise be available to the operator via the mobile communication device.
US11751123B2

Technologies disclosed herein are directed to context-based mobile device management. According to one embodiment, an application executing in a mobile device detects an event to trigger context-based management of the mobile device. A usage context associated with the mobile device is determined. One or more policies to enforce on the mobile device are identified as a function of the usage context. The application enforces the one or more policies on the mobile device.
US11751122B2

An interface device may provide a first wireless network and a second wireless network in a user's premise. The interface device may encourage some user devices to connect to the second wireless network without controlling the user devices. For example, the interface device may receive a request from a device to access its first wireless network. The interface device may then determine whether the device is a premise device by, for example, searching a database of device registration information. The interface device may determine that the device is a premise device and deny the request to access the first wireless network. The device may then be available to access the second wireless network.
US11751120B2

The present disclosure is related to systems, methods, and processor readable media for distributing digital data over networks. Certain embodiments relate to systems, methods, and devices used within such networks where at least a substantial portion of the interconnected devices are capable of interacting with one or more neighbouring devices, and then to form such a time synchronous network using local network information.
US11751119B2

Methods and systems for routing data through IAB nodes 201, 202 in 5G communication networks. Embodiments herein allow routing data between a UE 206 and an IAB donor 200 though IAB nodes 201, 202 using adaptation layers of the IAB donor 200 and the IAB nodes 201, 202. The adaptation layers of the IAB donor 200 and the IAB nodes 201, 202 are configured by defining adaptation layer header and functionality. Mapping is performed between bearers/RLC channels of the UE 206 and the IAB node 202 and between bearers/RLC channels of the IAB nodes 201, 202 and the IAB donor 200. The means to perform the mapping is specified by the adaptation layers of either the IAB donor 200 or the IAB nodes 201, 202. The data is routed through the bearers/RLC channels. The embodiments include managing RLC layer functionality using either hop-by-hop ARQ or end-to-end ARQ.
US11751114B2

Apparatuses, systems, and methods for a wireless device avoiding reselection or handover to cells of different operators. The wireless device may attach to a first base station of a first network operator. The wireless device may determine that a neighboring base station is associated with a second network operator. Based on determining the neighboring base station is associated with the second network operator, the wireless device may exclude the third base station from handover or reselection.
US11751109B2

Methods, systems, and devices for wireless communications are described. A user equipment (UE) may receive a set of system information blocks (SIBs) common to a set of cells of a non-terrestrial network (NTN), the set of SIBs indicating one or more parameters common to the set of cells for communications with the set of cells. The UE may receive a first SIB associated with a first cell of the set of cells of the NTN, where the first SIB includes cell-specific information indicating a first set of cell-specific parameters for communications with the first cell. The UE may then communicate with the first cell using the first set of cell-specific parameters associated with the cell-specific information of the first cell and at least a first sub-set of parameters of the one or more parameters that are common to the set of cells.
US11751108B2

Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may determine that a reduced signaling handover condition has occurred. The UE may execute a reduced signaling handover from a source base station to a target base station based at least in part on determining that the reduced signaling handover condition has occurred. Numerous other aspects are described.
US11751095B2

The present disclosure generally relates to a methods, apparatus, and computer readable medium for implementing the methods for transmitting multi-bit SR (SRs) from a user equipment (UE). The UE receive from a base station a radio resource control (RRC) message from the base station. The RRC message may indicate that uplink component carriers (CCs) of the UE are to be assigned to a plurality of uplink CC groups. Upon receipt of the RRC, the UE may assign the uplink CCs to the plurality of uplink CC groups. A multi-bit SR may be generated for each group of the plurality of uplink CC groups. The UE may transmit the multi-bit SR generated for each group of the plurality of uplink CC groups to the base station. multi-bit SR transmission across different CCs may reduce latency in uplink grant and improve data transmission time.
US11751093B2

Systems and methods provide flow control for uplink traffic in an integrated access and backhaul network. A first relay node determines that its uplink buffer has reached an occupancy level higher than a pre-determined level. In response, the first relay node transmits, to a second relay node associated with the first relay node, a message indicating a buffer occupancy status of the uplink buffer of the first relay node.
US11751092B2

Various communication systems may benefit from differentiated quality of service management. For example, specific applications run on a user equipment in a 5G radio access network may benefit from the flexible differentiated quality of service management. A method includes determining a service flow setup, and mapping traffic through the service flow by a common convergence sublayer entity to at least one radio convergence sublayer entity. The method also includes controlling the traffic through the service flow.
US11751089B2

Provided is a wireless relay system including multiple terminal station apparatuses and a base station apparatus. The base station apparatus includes: a base station reception unit that respectively receives pieces of upstream data traffic from the multiple terminal station apparatuses; an encoding unit that, if pieces of upstream data traffic that require mutual forwarding in opposite directions are present in the respective pieces of upstream data traffic, performs network encoding on the respective pieces of upstream data traffic such that the pieces of upstream data traffic are pieces of data traffic of mutually identical content; and a base station transmission unit that simultaneously transmits encoded data traffic as downstream data traffic to the multiple terminal station apparatuses. The terminal station apparatuses each include: a terminal station transmission unit that transmits the upstream data traffic to the base station apparatus; a terminal station reception unit that receives the encoded data traffic; and a decoding unit that decodes the encoded data traffic using the upstream data traffic.
US11751082B2

Disclosed are techniques for wireless communication. In an aspect, a UE transmits, at a first time during a measurement window for positioning purposes, a first uplink reference signal in accordance with a first timing adjustment parameter, wherein the first time is offset from a downlink frame time of a base station by an amount of the first timing adjustment parameter, determines whether to use a second timing adjustment parameter, transmits, in response to the determination to use the second timing adjustment parameter, at a second time during the measurement window, a second uplink reference signal in accordance with a second timing adjustment parameter, wherein the second time is offset from the downlink frame time of the base station by an amount of the second timing adjustment parameter, and transmits a report indicating that the second timing adjustment parameter has been applied to at least the second uplink reference signal.
US11751073B2

Methods, systems, and devices for wireless communications are described. In some systems, wireless devices operating in an unlicensed radio frequency spectrum band may perform directional listen-before-talk (LBT) procedures to gain access to a channel. In a beam-shrinking scheme for directional LBT, a wireless device may start an LBT procedure using a first beam (e.g., a wide beam). If the clear channel assessment (CCA) fails for the first beam (e.g., due to directional interference), the device may switch the LBT procedure to a second beam (e.g., a narrower beam). Depending on the direction of the interference source, the second beam may result in a successful LBT procedure. In a beam sweeping scheme for directional LBT, a wireless device may perform concurrent LBT over multiple narrow beams. If any beam of the set of beams detects frequent or continuous interference, the device may drop that beam from the concurrent LBT procedure.
US11751070B2

Disclosed in some examples are methods, systems, devices, and machine-readable mediums that detect evil twin and other anomalous access points in an IT infrastructure by detecting access points that are not in their expected locations based upon an analysis of access point reports from one or more computing devices.
US11751061B2

Devices, systems and methods are provided to implement key generation for secure pairing between first and second devices using embedded out-of-band (OOB) key generation and without requiring the devices to have input/output (IO) capability to enter authentication information. Bluetooth Smart or Low Energy (BLE) OOB pairing option can be used for pairing medical devices with added security of OOB key generation. The OOB key generation comprises providing first and second devices with the same predefined credential and secure hashing algorithm, and making input of the hashing algorithm of the first and second devices the same. The first device transmits unique data to second device (e.g., via BLE advertising) to share and compute a similar input. The first and second devices use the credential and shared data with the hashing function to generate a key that is the same at each of first and second devices.
US11751055B2

Integrity protection is used to assist in ensuring the secure transmission of wireless data within a cellular network. Instead of performing integrity protection on each packet data unit (PDU) transmitted/received within a PDU session, integrity protection is performed on a portion of PDUs transmitted within a cellular network. For instance, partial integrity protection may be performed on at least one predetermined PDU (e.g., the first, second, fourth, . . . ) that is transmitted via a Physical Downlink Shared Channel (PDSCH)/Physical Uplink Shared Channel (PUSCH) during a communication session. By performing partial integrity protection, user data may be transmitted more quickly throughout the cellular network, compared to performing full integrity protection, while still providing integrity protection.
US11751048B2

The present disclosure provides a communication apparatus comprising a cryptographic circuitry which, in operation, uses a shared cryptographic secret Key and a cryptographic salt to generate a cryptographically encoded Message Integrity Code (MIC) that is computed over the address field of a Wake Up Radio (WUR) frame; and a transmission signal generator which, in operation, generates a secure WUR signal by replacing the address field of the WUR frame with the MIC; and a transmitter which, in operation, transmits the secure WUR signal.
US11751047B2

A method and apparatus for a first IAB node for securely communicating with at least one second IAB node is provided. A secure connection with a node of a network is established. A message is received, from the node, indicating a secure messaging protocol to use to communicate with the at least one second IAB node, the message including one of at least one nonce or a key. A control message to be sent to the at least one second IAB node is transformed into a secure control message using the secure messaging protocol. The secure control message is transmitted to the at least one second IAB node.
US11751043B2

A pre-5th-Generation (5G) or 5G communication system for supporting higher data rates Beyond 4th-Generation (4G) communication system such as Long Term Evolution (LTE), in which a method performed by a user equipment (UE) includes transmitting, to a first base station (BS), a packet data network (PDN) connection request message, receiving, from the first BS, information on a first single-network slice selection assistance information (S-NSSAI) selected by a combination of a packet data network gateway control plane entity (PGW-C) and a session management function (SMF) from among the UE's at least one subscribed S-NSSAI, transmitting, to a second BS, a registration request message including a requested NSSAI in which the first S-NSSAI is included, and receiving, from the second BS, a registration accept message including an allowed NSSAI in which a second S-NSSAI mapped to the first S-NSSAI is included.
US11751035B2

One or more presence sensors of a vehicle are used to detect the presence of one or more people outside the vehicle. When the presence of the one or more people outside the vehicle is detected, one or more external microphones of the vehicle are used to capture any speech by people. A speech recognizer of the vehicle is used to determine whether the captured speech includes a verbal request for emergency services. And, upon determining that the captured speech includes the verbal request for emergency services, a network access device of the vehicle is used to automatically request emergency services.
US11751032B2

A snake cam is provided with a camera mounted to a housing via a shaft. The shaft may be flexible or rigid. The housing includes components needed for operation of the camera but that need not be in close physical proximity to the camera, thus allowing the camera itself to have a relatively small size, which facilitates placement thereof in small places. The housing may include a wireless communication module, through which a mobile device may be connected to the snake cam. The mobile device may then be used to access or control one or more features of the snake cam.
US11751030B2

To improve the accuracy of a trigger-based commissioning in a high dense network without leveraging an optical link, a separate beacon tag (400) is employed to assist the commissioning procedure between a node (200) and a commissioning device (300). A trigger event is detected at the node (200) side when its local identification number is equal to the identification number comprised in a second type of beacon received from the beacon tag (400), and the proximity of the beacon tag (400) is determined to be below a local threshold. Upon the detection of such a trigger event, the node (200) updates its first type of beacons to notify the commissioning device 300 about the trigger event. And then, the commissioning device (300) confirms the trigger event and sends a request for commissioning to the node (200).
US11751029B2

A transportation vehicle, an apparatus, a method, and a computer program for a transportation vehicle in a mobile communication system a system. A method for a first transportation vehicle in a mobile communication system for setting up data communication with a second transportation vehicle includes receiving a message from the second transportation vehicle on a first radio frequency, the message having information related to an antenna of the second transportation vehicle; configuring an antenna of the first transportation vehicle based on the information related to the antenna of the second transportation vehicle; and transmitting a data packet to the second transportation vehicle on a second radio frequency using the antenna of the first transportation vehicle.
US11751027B2

A system for accident detection or detecting an unsafe driving condition in a vehicle including a device that measures and transmits at least one output signal; at least one remote device configured to receive, record, and/or display the at least one output signal from the device; a computing device configured to receive the at least one output signal from the device and display the at least one output signal in real-time; and a graphical user interface on the computing device that allows an emergency response professional to view and customize options for monitoring the at least one output signal, wherein the device, the at least one remote device, and the computing device are communicatively connected to each other via a communications network.
US11751026B2

One embodiment of the present invention relates to a method for a terminal transmitting a message in a wireless communication system, comprising the steps of: generating a message; and transmitting, from a resource sectioned on a time axis, control information for the message and the message when the size of the message is larger than a predetermine value, and transmitting, from a resource sectioned on a frequency axis, the control information for the message and the message when the size of the message is smaller than the predetermined value.
US11751025B2

A communication device for multi-radio access technology (RAT) communications includes one or more processors and a plurality of transceivers. Each transceiver is configured to operate in at least one RAT of a plurality of RATs. The processors are configured to establish connection with a second communication device using a first transceiver of the plurality of transceivers and a first RAT of the plurality of RATs. A first data stream associated with a communication link connected to the second communication device and a third communication device is receive via a convergence function at the second communication device. The communication link uses a second RAT of the plurality of RATs. A code sequence is applied to a second data stream to generate an encoded second data stream, which is transmitted to the third communication device via a second communication link established based on information received via the first data stream.
US11751021B2

A method and an apparatus for performing direct communication with at least one other user equipment are provided. A method performed by a UE includes transmitting, to at least one other UE included in a group call with the UE, a first message requesting permission for transmission; starting a timer upon transmitting the first message; restarting the timer in response to the timer expiring before a second message in response to the first message has been received; stopping the timer in response to receiving the second message before the timer expires; retransmitting the first message each time the timer expires before receiving the second message until a total number of transmissions of the first message reaches a predetermined number of times; transmitting, to the at least one other UE, a third message indicating that the permission for transmission is granted to the UE after the first message is transmitted the predetermined number of times and the timer expires before receiving the second message; and transmitting media data to the at least one other UE after transmitting the third message.
US11751018B1

A connection between a user equipment (UE) and an IP Multimedia Subsystem (IMS) can become disrupted due to network-side issues with the IMS, an access network, or a core network. The UE can initiate a watchdog timer to determine when a previously-established IMS connection may be unusable due to such a network-side issue. If the watchdog timer expires, for example because the IMS does not reply to a message sent by the UE before the watchdog timer expires, the UE can toggle an airplane mode on and off. Toggling airplane mode on and off can deactivate and then re-activate a transmission interface of the UE, and cause the UE to establish a new usable connection with the IMS that may not be affected by the network-side issue that disrupted the previously-established IMS connection.
US11751003B1

Embodiments relate to personalization of a head-related transfer function (HRTF) for a given user. A sound source is spatialized for an initial position using an initial version of a HRTF to obtain an initial spatialized sound source. Upon presentation of the initial spatialized sound source, at least one property of the HRTF is adjusted in an iterative manner based on at least one perceptive response from the user to generate a version of the HRTF customized for the user. Each perceptive response from the user indicates a respective offset between a perceived position and a target position of the sound source. The customized version of the HRTF is applied to one or more audio channels to form spatialized audio content for the perceived position. The spatialized audio content is presented to the user, wherein the offset between the perceived position and the target position is reduced.
US11750996B2

Improved methods and/or apparatus for decoding an encoded audio signal in soundfield format for L loudspeakers. The method and/or apparatus can render an Ambisonics format audio signal to 2D loudspeaker setup(s) based on a rendering matrix. The rendering matrix has elements based on loudspeaker positions and wherein the rendering matrix is determined based on weighting at least an element of a first matrix with a weighting factor g = 1 L . The first matrix is determined based on positions of the L loudspeakers and at least a virtual position of at least a virtual loudspeaker that is added to the positions of the L loudspeakers.
US11750993B2

A method and device for processing information are provided. The method for processing information includes: determining a current output voltage of a power supply in a terminal device; determining a target parameter of an audio processing circuit in the terminal device according to the current output voltage; and configuring the audio processing circuit for processing an audio signal according to the target parameter. With the embodiments of the present disclosure, an impact of a change of the output voltage of the power supply on output volume of a loudspeaker can be reduced, thereby improving user experience.
US11750991B2

An information providing method receives, from a terminal apparatus, terminal position information representative of a position of the terminal apparatus; identifies, from among a plurality of pieces of distribution information stored in a reference table in which correspondences between the plurality pieces of distribution information and a plurality of pieces of sound output position information are registered, a piece of distribution information corresponding to a piece of sound output position information identified based on the position of the terminal apparatus represented by the received terminal position information; and transmitting the identified piece of distribution information to the terminal apparatus. Each of the plurality of pieces of distribution information relates to a position at which a corresponding one of sound output devices outputs sound, and each of the plurality of pieces of sound output position information is representative of a position at which the corresponding sound output device outputs the sound.
US11750987B2

Disclosed is a method, performed in an accessory device, for controlling a hearing device, the accessory device comprising an interface, a memory, a display, and a processor. The method comprises determining an environment parameter. The method comprises determining a processing context parameter based on the environment parameter. The method may comprise displaying on the display a first user interface object representative of the processing context parameter.
US11750979B2

A display apparatus includes a display panel including configured to display an image and a sound generating device on a rear surface of the display panel, the sound generating device being configured to vibrate the display panel to generate sound. The sound generating device includes a first structure and a second structure over or under the first structure, the second structure including a first part having a piezoelectric characteristic and a second part between adjacent first parts to have flexibility.
US11750975B2

A signal processing device includes: an obtainer that obtains sound data; a pitch controller that controls pitch of the sound data obtained to increase the pitch by a factor of n (a real number greater than 1); an extractor that extracts frequency components of at least 20 kHz which are included in the sound data whose pitch is controlled; an adder that adds the frequency components extracted to the sound data obtained; and an outputter that outputs sound data to which the frequency components extracted are added.
US11750967B2

A microphone includes a base, at least one sound receiving element, and a flexible circuit board. The base has a plurality of supporting portions, a plurality of damping portions, and a bearing portion. The plurality of supporting portions are spaced apart from each other. Each of the plurality of damping portions is disposed on an inner surface of the corresponding supporting portion. The bearing portion is connected to the plurality of damping portions and is suspended between the plurality of supporting portions. The at least one sound receiving element is disposed on the base. The flexible circuit board is disposed on the base and has a first transmission segment. The first transmission segment is electrically coupled to the at least one sound receiving element, and the first transmission segment has a plurality of bending sections.
Patent Agency Ranking