US07720335B2
The present invention relates to a hybrid planar lightwave circuit in which a silicon reflective diffraction grating etched with a highly accurate deep reactive ion etching process is mounted in a trench formed in a high optical performance silica on silicon waveguide device.
US07720330B2
Bidirectional wavelength cross connects include a plurality of ports, each configured to receive an input optical signals, each input optical signal having a plurality of spectral bands. At least one of the plurality of ports is disposed to simultaneously transmit an output optical signal having at least one of the spectral bands. A plurality of wavelength routing elements are configured to selectively route input optical signal spectral bands to output optical signals.
US07720329B2
A fiber optic switch utilizing a segmented prism element, comprising a fiber optic switch used in multi-channel optical communications networks and having one or more arrays of micro electromechanical system (MEMS) mirrors, wherein at least a first array of MEMS mirrors is utilized to select & switch wavelengths from a number of input fiber ports (N) to an output fiber port, wherein at least a second array of MEMS mirrors using and sharing the same free space optics as the first MEMS array is utilized to produce yet another fiber optic switch, wherein the second switch is utilized to select individual wavelengths or spectral components from its input fiber ports to send to its output fiber port for optical power or other monitoring purposes, thus, enabling a cost effective, high level of integration N×1 or alternatively a 1×N switch capable of internal feedback monitoring.
US07720326B2
Various embodiments of the present invention are directed to nanowire-based photodetectors that can be used to convert information encoded in a channel of electromagnetic radiation into a photocurrent encoding the same information. In one embodiment of the present invention, a photodetector comprises a waveguide configured to transmit one or more channels of electromagnetic radiation. The photodetector includes a first terminal and a second terminal. The first terminal and the second terminal are positioned on opposite sides of the waveguide. The photodetector also includes a number of nanowires. Each nanowire interconnects the first terminal to the second terminal and a portion of each nanowire is embedded in the waveguide.
US07720325B2
A technique is provided for utilizing an optical fiber in a variety of sensing applications and environments by beneficially routing the optical fiber. A continuous optical fiber is created to provide optical continuity between two ends of the optical fiber. The optical continuity is created with the assistance of an optical turnaround constructed in a simple, dependable form able to control the bend of the optical fiber as it extends through the optical turnaround.
US07720319B2
A method and system for determining the length of collocated waveguides in a high erosion environment, such as a solid rocket motor or a braking system. The system provides for mating optical waveguides having different attenuation coefficients within the combusting, eroding, or otherwise regressing material. Optical energy generated by the environment (e.g., from burning fuel), or which is introduced and scattered into the environment, travels through the waveguides to detector means coupled thereto. The intensities of the arriving optical energy are compared and the length of the collocated waveguides calculated therefrom. By calculating the length of the waveguides over time, a regression rate is determined.
US07720318B1
A computer-implemented method of font identification includes receiving a first document, the first document including the first text set in a proportional font. Test text, corresponding to the first text of the first document, is received. The test text is set in a test font. A first fingerprint is generated, based on relative line widths of the first text of the first document. A second fingerprint is generated based on relative line widths of the test text, as set in the test font. The test font is then accepted as being consistent with a font of the first text, based on a predetermined strength of relationship between the first and second fingerprints.
US07720317B2
Because the back-and-forth movement by hand is slower and more strenuous than the leftward-and-rightward swinging, a handheld image-tracking device, which can be applied to an optical mouse or a handheld scanner, uses a rectangle-shaped sensing array to save area of the sensing array and lower down the production cost for the device by reasonably reducing the back-and-forth sensing area for the sensing array; and, so, an amount and time spent for a data comparison in the device is lessened.
US07720313B2
A system for handling files containing digitized images, such as digitized bank checks. Four digitized image-files are obtained for each check: front and back at the beginning of a process, and front and back at the end of the process. Four digital signatures are generated, one for each image-file. The four image-files are to be consolidated into a single composite file. However, for technical reasons, the content of the image-files must be altered somewhat. Thus, if the image-files are later extracted from the composite file, the extracted files will not correspond to the original image-files, and will produce different digital signatures. The invention allows the original image-files to be accurately extracted from the composite file.
US07720306B2
Systems and methods of this invention display data using pixels with information indicated by color and intensity changes, particularly used for monitoring of physiological variables in real time. For certain methods, physiological data can be acquired by sensors, acquired data can be stored in data frames, data frames can be processed using computer-implemented methods, and processed data frames can be scaled to a display frame for display on a display device. Using such methods, a spot made up of a group of pixels can be updated during a time frame, or cycle using a computer-implemented method, such as addition, subtraction, multiplication, division or a time dependent function. Newly received data can be combined with prior received data to indicate time-dependent changes. In this way, each spot contains a cumulative history of data starting at some initial time. In other embodiments, visual contrast can be enhanced between desired data and other data. In further embodiments, two or more different types of data can be plotted together to indicate relationships between variables. Real time monitoring of signals during therapeutic treatment using light, electricity or other nerve or muscle stimuli can allow a user to monitor physiological responses during stimulation and to make rapid decisions about medical treatment.
US07720304B2
Certain embodiments of the invention may be found in a system and method for implementing graphics and a video scaling algorithm using interpolation based on symmetrical polyphase filtering. A video or graphics scaler may be utilized to scale luma, chroma, and/or alpha information in a video image. The scaler may comprise a first symmetric polyphase sub-filter with zero phase shift that generates an in-phase filtered pixel and a second symmetric polyphase sub-filter that generates an out-of-phase filtered pixel. The video scaler may also comprise an interpolator that may generate a scaled video image pixel based on the generated in-phase and out-of-phase filtered pixels and a scaling factor. The scaling factor may be determined based on an input video size (M) and a desired output video size (N). The interpolation of the generated in-phase and out-of-phase pixels in the video scaler may be implemented by utilizing a Farrow structure.
US07720293B2
An image processing apparatus including: a generating section, operable to analyze compressed image data stored in an external memory and generate an analytic table indicative of a storage manner of the compressed image data; an internal memory, adapted to store the compressed image data therein; a storage section, operable to acquire at least a part of the compressed image data from the external memory and store the compressed image data in the internal memory with reference to the analytic table; a decoding section, operable to read and decode the compressed image data stored in the storage section, and rotate and then output the compressed image data as a rotated image data; and an updater, operable to update the analytic table in accordance with a decoding situation of the decoding section.
US07720287B2
An image processing apparatus includes: an image reading unit that reads image information; a generating unit that generates new additional information to be added to the image information read by the image reading unit; an extracting unit that extracts, in a case where the image information read by the image reading unit includes existing additional information, the existing additional information; and an additional information processing unit that embeds the existing additional information and the new additional information in the image information.
US07720283B2
Exemplary systems and methods segment a foreground from a background image in a video sequence. In one implementation, a system refines a segmentation boundary between the foreground and the background image by attenuating background contrast while preserving contrast of the segmentation boundary itself, providing an accurate background cut of live video in real time. A substitute background may then be merged with the segmented foreground within the live video. The system can apply an adaptive background color mixture model to improve segmentation of foreground from background under various background changes, such as camera movement, illumination change, and movement of small objects in the background.
US07720280B2
A color correction apparatus and method are provided. The color correction apparatus includes: a chromatic region determination module determining a first chromatic region to which an input pixel constituting an input image belongs and a second chromatic region neighboring the first chromatic region on a basis of specified chromatic region division information; a polynomial regression operation module performing polynomial regression on the first chromatic region and the second chromatic region; and a blending module providing corrected pixel information for the input pixel by giving weight values to results of the polynomial regression on the first chromatic region and the second chromatic region. The color correction method includes: determining the first and second chromatic regions; performing polynomial regression on the first and second chromatic regions; and providing corrected pixel information for the input pixel by giving weight values to results of the polynomial regression on the first and second chromatic regions.
US07720273B2
In a computer, fixed pattern information indicating respective shapes of fixed pattern elements included in a fixed pattern and respective position vectors of the fixed pattern elements with respect to a reference position in the fixed pattern is prepared and key pattern elements coincident with any of fixed pattern elements are specified from writing pattern elements. Subsequently, a value is added to a position designated by a reverse vector of position vector of a corresponding fixed pattern element with each of the key pattern elements as a starting point in a setting area which corresponds to a writing pattern, and a position is specified to which a value coincident with the number of fixed pattern elements is given, to detect an existing position of the fixed pattern in the writing pattern. It is thereby possible in the computer to extract a fixed pattern from a writing pattern at high speed.
US07720270B2
Method and apparatus for locally enhancing image data represented as pixels having CT numbers is provided. The image data includes bony structures, and the method comprises segmenting pixels within the image data into areas based on the pixel's CT number. A first area represents a combination of soft tissue and lower density bones and a second area represents higher density bones. A subset of pixels is identified within the first area representative of the lower density bones. An enhancement is applied to the subset of pixels within the first area and to the second area to create an enhanced dataset, and a locally enhanced image is generated based on the image data and the enhanced dataset.
US07720268B2
A method for segmenting a digitized ultrasound image includes providing a digitized in-phase/quadrature ultrasound image comprising a plurality of intensities defined on an N-dimensional grid, decorrelating the ultrasound image wherein spatial correlations are substantially reduced in the intensity data, modeling the decorrelated image intensities with a statistical distribution, propagating, an active contour in the image where the contour segments the image, where the contour is propagated based on the statistical distributions of intensity data inside and outside the active contour.
US07720263B2
There is provided an authentication device capable of improving an authentication accuracy, in which a finger tilt angle α made by a straight line between the positions at the fingertip abutting portion 6 and the image pickup camera 4 and the finger positioned in the imaging space is detected from a distance D2 (FIG. 5) between the finger positioned in the imaging space and the image pickup camera 4 and the distance D1 (FIG. 5) between the positions at the image pickup camera 4 and the fingertip abutting portion 6. The projection distortion of the corresponding comparative images can be removed according to the difference between the finger tilt angle α and the finger tilt angle α of registration information previously stored at the time of registration.
US07720259B2
Capturing the motion of a target. One method includes: coupling a plurality of primary markers to the target; coupling at least one secondary marker to the target; capturing a plurality of primary marker data points, wherein each primary marker data point corresponds to one primary marker of the plurality of primary markers; capturing at least one secondary marker signature, each secondary marker signature corresponding to and uniquely identifying each secondary marker of said at least one secondary marker; and identifying the plurality of primary markers using said at least one secondary marker signature.
US07720256B2
The method of processing objects, in which method a digital image (1) is obtained of the surface of each postal object, which image includes address information (2), and an identifier or time stamp for the postal object is associated with the digital image of the postal object in a video-coding system, is characterized by the fact that said digital image is processed in order to extract a signature that serves as an identifier. The signature comprises a first component representative of a physical characteristic of the digital image and a second component (SC) which is a textual description of the address block. This method can be used to implement immediate video-coding in a postal sorting machine without requiring a delay line.
US07720249B2
A watermark system includes an embedder, detector, and reader. The watermark embedder encodes a watermark signal in a host signal to create a combined signal. The detector looks for the watermark signal in a potentially corrupted version of the combined signal, and computes its orientation. Finally, a reader extracts a message in the watermark signal from the combined signal using the orientation to approximate the original state of the combined signal. While adapted for images, video and audio, the watermark system applies to other electronic and physical media. For example, it can be applied to mark graphical models, blank paper, film and other substrates, texturing objects for ID purposes, etc.
US07720247B2
A loudspeaker mounting assembly for mounting a loudspeaker in an isolated relation to a structure includes an enclosure and a plurality of interface elements composed of a vibration-damping material. The enclosure has an interior for receiving the loudspeaker and includes at least two spaced-apart support members. Each of the at least two support members includes a support member outer surface and an inner surface extending from the support member outer surface into the support member. The inner surface defines a support member bore. Each interface element includes an interface element outer surface. Each interface element is disposed in a corresponding one of the support member bores and at least partially extends out from the respective support member outer surface, where each interface element outer surface contacts the respective inner surface of the support member.
US07720238B2
According to one embodiment, a video/audio output method according to one embodiment includes detecting a playback volume value set in an external speaker controller for controlling an external speaker, calculating a decibel value corresponding to the detected playback volume value, generating an audio signal corresponding to the calculated decibel value, and outputting the generated audio signal to the external speaker controller, and, at the same time, outputting a video based on a video signal corresponding to the audio signal.
US07720223B2
A calculator system for performing duplication of contents does not necessarily perform screening, i.e., electronic watermark detection, rather, contents copy control information can be obtained otherwise. For example, in the event of copying a CD regarding which it is known beforehand that there is no electronic watermark inserted in the contents, the electronic watermark detection processing itself can be skipped as long as the CD can be confirmed to be such, thereby reducing the amount of time necessary for copying. Electronic watermark inspecting processing with heavy computation loads is performed vicariously for judging whether or not duplication of contents is permissible.
US07720220B2
A method, system and program product for executing a cipher message assist instruction in a computer system by specifying, via the cipher message assist instruction, either a capability query installed function or execution of a selected function of one or more optional functions, wherein the selected function is an installed optional function, wherein the capability query determines which optional functions of the one or more optional functions are installed on the computer system.
US07720215B2
While the amplification factor of an external amplifier is increased to raise the minimum volume level, synthesized speech of text data is generated as PCM data. When the PCM data is output for each frame (63 ms), the voltage of a battery power supply is detected and different ATT values (attenuation ratios) are set in accordance with threshold values (Level 1˜4) corresponding to the detected voltage. The lower the power supply voltage, the larger the attenuation ratios. The PCM data is attenuated by such an attenuation ratio to reduce a load to the battery power supply. Even though the battery power supply is exhausted to some extent, no power-down due to an instantaneous increase in power load occurs, with the result that a high-level part of a series of speech data items is output at an adequate volume level that makes a low-level part thereof easy to hear.
US07720210B2
A CTI system comprises a telephone terminal (12-2) having an ID tag (18-2), a server-connected main unit (11, 13) for controlling the telephone terminal, and an information processing terminal (16-1) having an ID reader and a communication unit (CU). By positioning the ID reader of the information processing terminal and the ID tag of the telephone terminal in close proximity to each other, the ID reader reads ID information of the ID tag in a non-contact manner. The information processing terminal sends the ID information read by the ID reader to the main unit by the use of the communication unit. The main unit associates the information processing terminal with the telephone terminal with reference to the ID information. The main unit is responsive to a request of the information processing terminal and carries out call control for the telephone terminal associated with the information processing terminal.
US07720209B2
An application development system includes a referencing component configured to reference an external component in an external development environment and to read type information for the referenced external component. An authoring component is configured to aid a user in authoring an application using the type information read from the referenced external component and using a language extension that allows external objects corresponding to the external component to be created by the external runtime environment and which allows methods to be invoked on the external objects and object declarations.
US07720205B2
A communication terminal unit has a system control section including a communication error detection section that detects a communication error, which occurs at the time of originating a call over an IP network or a public network. A communication error analysis section analyzes the thus-detected communication error, and in accordance with the result of analysis of the communication error, a call origination network determination section automatically determines whether to re-dial a call over the IP network or the public network. As a result, when detecting a communication error at the time of origination of a call over the IP network or the public network, a system control section performs control operation for analyzing the communication error and automatically determining whether to re-dial a call over the IP network or over the public network.
US07720204B2
A method system, interface and server for establishing a communications call by selecting a B party (6) using an interactive device (16) connected to a public network (10,12), sending called address data for the B party (6) and calling address data for an A party (4) to a communications platform (18) of the public network (10,12), and establishing a call between the A and B parties (4,6) over the public network (10,12) using the communications platform (18) and the called and calling address data. The called address data can be accessed from the public network, and may reside on a server of a messaging network, such as the Internet.
US07720194B2
A stand-alone inspection system operating reliably with high throughput. The system employs automated image analysis to distinguish between cleared items and suspicious items. Cleared items pass through the inspection system without stopping, but the system stops suspicious items at a predetermined location so that the alarmed items can be readily identified by an operator. The system also displays information on the items that allows an operator to confirm that the item in the predetermined location is an alarmed item. Rather than resolving the alarmed item with the system stopped, the operator records an indicia of the alarmed item and the alarmed item is removed for further inspection or other processing. The recorded indicia provides a tracking mechanism that ensures alarmed bags are resolved.
US07720186B2
Data is communicated through two separate circuits or circuit groups, each having clock and mode inputs, by sequentially reversing the role of the clock and mode inputs. The data communication circuits have data inputs, data outputs, a clock input for timing or synchronizing the data input and/or output communication, and a mode input for controlling the data input and/or output communication. A clock/mode signal connects to the clock input of one circuit and to the mode input of the other circuit. A mode/clock signal connects to the mode input of the one circuit and to the clock input of the other circuit. The role of the mode and clock signals on the mode/clock and clock/mode signals, or their reversal, selects one or the other of the data communication circuits.
US07720185B2
The disclosure is directed to a receiver. The receiver includes an interference canceller configured to filter digital samples produced from a modulated signal transmitted over a wireless channel, and a digital variable gain amplifier (DVGA) configured to amplify the filtered digital samples.
US07720180B2
The objective of this invention is to perform high-precision tracking error detection and tracking control using digital circuitry at relatively low speed and with a small circuit scale. Tracking servo circuit is formed as a single-chip circuit. Low-pass filters (LPF) and gain control amplifiers (GCA) of the input portion are analog circuits, while the circuits after analog-digital (A/D) converters, that is, offset cancellation circuits, equalizers (EQ), first and second phase difference detectors, adder, low-pass filter (LPF), gain control amplifier (GCA), and servo DSP are all digital circuits.
US07720171B2
At least one training signal burst is applied to an electronic circuit including an amplifier to train a predistortion circuit associated with the amplifier.
US07720165B2
A demapper, applied to a quadrature amplitude modulation trellis coded modulation (QAM-TCM) decoder, for generating more significant bits of a QAM signal according to the QAM signal and at least a less significant bit of the QAM signal is disclosed. The demapper includes a shifter for shifting the QAM signal to generate a shifted signal; a threshold value comparing and mapping unit for outputting at least a more-significant-bit buffered value; a sign bit decider for determining a sign value corresponding to the shifted signal; a multiplexer for generating a first more-significant-bit estimation and a second more-significant-bit estimation; and an operating unit for determining a third more-significant-bit estimation and a fourth more-significant-bit estimation.
US07720164B2
Transmission scheme for the uplink of FDMA systems that improves performance in an interference-dominated system by using a pilot scheme that provides enough information so that channel estimates can be obtained for a particular user, but which at the same time makes it possible to use pilot patterns that are different in different cells so that co-channel interference is mitigated. A codeword is used to position a set of pilot symbols within a set of subcarriers wherein each subcarrier has a first pilot time slot and a second pilot time slot associated with one or more data time slots. The set of subcarriers are identified on which to transmit the composite signal and the first pilot time slots and the second pilot time slots are filled with the pilot symbols in accordance with the codeword. The composite signal is then formatted as a combination of modulated data and pilot signals.
US07720158B2
A memory managing method for video data decoding process is provided. The memory managing method includes the following steps. A first frame having a first definition is stored, wherein the first frame is a first type or a second type. A second frame having the first definition is stored, wherein the second frame is the first type or the second type. A first frame having a second definition is stored in the memory space where the first frame having the first definition was originally stored, and the remaining memory space left after the original first frame having the first definition had been stored is released, wherein the memory space for storing the first frame having the first definition is greater than the memory space for storing the first frame having the second definition. A third frame having the second definition is stored, wherein the third frame is a third type.
US07720156B2
A residue image down- and/or up-sampling method and apparatus and an image encoding and/or decoding method and apparatus using the residue image down- and/or up-sampling method and apparatus are provided. The residue image downsampling method includes: generating a residue corresponding to the difference between an original image and a predicted image, for each image component of the original image formed with at least two or more image components; and downsampling the residue for each image component at a predetermined ratio. The residue image upsampling method includes: upsampling data downsampled from residue data of an original image; and restoring the original image by adding the predicted image to the upsampled residue of each component. According to the methods and apparatuses, a residue image is obtained by performing spatiotemporal prediction encoding first, and by sampling this residue image, loss of information occurring in the sampling process can be reduced. Since sampling is performed with a residue image obtained through a spatiotemporal prediction process, even when an original image that is not color transformed is directly encoded, sampling can be performed effectively. Also, the methods and apparatuses have an advantage that in addition to colors, sampling of any components can be performed effectively.
US07720155B2
A system and method for estimating a motion vector for transcoding digital video is presented. The method includes selecting a direction of an adjustment vector for estimation of a motion vector within a search region, and selecting the adjustment vector having a minimum SAD (sum absolute distance) within the search region.
US07720153B2
In the motion compensation prediction unit 2 of the video encoding apparatus 1, complexity information which indicates a degree of complexity of movement from the reference frame for each of the plurality of blocks in which a coding target image is divided. The predicted image is generated by using a prediction reference image to which filtering pixels are provided in accordance with the complexity information on the basis of a predetermined rule which increases the number of the filtering pixels which have pixel values produced by applying low-pass filter with strong high-frequency cutoff characteristics among a plurality of low-pass filters with different high-frequency cutoff characteristics to neighborhood integer pixels.
US07720152B2
A video decoder, encoder, and corresponding methods for processing video signal data for an image block with two reference picture indices to predict the image block are disclosed that utilize implicit weighting of reference pictures to enhance video compression, where a decoder includes an implicit reference picture weighting factor unit for determining a weighting factor corresponding each reference picture index; and encoder includes an implicit reference picture weighting factor assignor for assigning a weighting factor corresponding to each reference picture index; and a method for decoding includes receiving the reference picture indices with the data that corresponds to the image block, determining an implicit weighting factor responsive to the relative positioning of the image block and the reference pictures indicated by each reference picture index, retrieving a reference picture for each index, motion compensating the retrieved reference pictures, and multiplying the motion compensated reference pictures by the corresponding weight.
US07720140B2
A signal processing method, receiver and equalizing method are provided. The receiver comprises an estimator estimating a channel coefficient matrix from a received signal, a first calculation unit determining a channel correlation matrix based on the channel coefficient matrix a converter converting the channel correlation matrix into a circulant matrix. A second calculation unit determines equalization filter coefficients by applying a first transform to the real parts of a first subset of the terms in the first column of the circulant matrix and by applying a second transform to the imaginary parts of a second subset of the terms in the first column of the circulant matrix. An equalizer equalizes the received signal by using the determined equalization filter coefficients.
US07720139B2
One embodiment of an equalizer circuit has an FIR filter 116 in the asynchronously oversampled domain with a filter coefficient adaptation module that adapts the filter coefficients to the transfer function of a data read channel. Applications include tape drives, drives for optical and magnetic discs as well as receivers. The filter adaptation is performed on the basis of an error signal delivered by a slicer 128 which operates on synchronous samples after timing recovery and sample reconstruction.
US07720138B2
A communication system is provided which is capable of easily setting a transmission speed between a signal transmitter and a signal receiver to carry out information communication. A transmitting device transmits one frame of measuring data which contains a start bit to be added to a head of the data and a stop bit to be added to an end of the data and which is used for a signal receiver to measure a transmission speed. A framing error detector in a receiving device receives the measuring data for detection, at every measuring point, of a framing error which occurs when a transmission speed of the signal transmitter does not coincide with a transmission speed of the signal receiver and normal detection of a stop bit is impossible and generates information about detection of a framing error. A transmission speed measurer measures a transmission speed of the transmitting device based on information about detection of a framing error and measuring point interval time.
US07720131B2
A method and apparatus are provided for decoding a wireless signal from a set of samples with an embedded training sequence. The method includes the steps of determining a first frequency offset from the samples where the first frequency offset is assumed to be less than a Nyquist frequency of the training sequence and calculating a first carrier to interference ratio based upon the first frequency offset. The method further includes the steps of determining a second frequency offset from the samples by subtracting an absolute value of the first frequency offset from an integer multiple of the Nyquist frequency and giving the second frequency offset a sign opposite that of the first frequency offset, calculating a second carrier to interference ratio based upon the second frequency offset and selecting one of the first and second frequency offsets based upon a relative values of the calculated carrier to interference ratios.
US07720127B2
An opto-semiconductor device. An opto-semiconductor element includes a semiconductor substrate, a multilayered semiconductor layer formed on a first surface of the semiconductor substrate and having a resonator, a first electrode with multiple conductive layers formed on the multilayered semiconductor layer, and a second electrode formed on a second surface of the semiconductor substrate. A support substrate has a first surface formed with a fixing portion having a conductive layer for fixing the first electrode connected thereto through a bonding material. Bonding material and conductive layers forming the first electrode react to form a reaction layer. The difference in thermal expansion coefficient between semiconductor substrate and support substrate is not more than ±50%. A second barrier metal layer not reactive with bonding material is formed inside the first electrode uppermost conductive layer, while uppermost layer reacts with the bonding material to form the reaction layer.
US07720123B2
A buried type semiconductor laser 1 is made of a p-type InP substrate 2 and includes a ridge section 6 made up of a p type InP first clad layer 3, AlGaInAs distorted quantum well active layer 4 and n type InP second clad layer 5 laminated one atop another. On both sides of the ridge section 6, an buried current block layer 10 made up of a p-type InP first buried layer 7, n-type InP second buried layer 8 and semi-insulating Fe-doped InP third buried layer 9 laminated one atop another is formed. A top face of the third buried layer 9 is covered with an n-type InP semiconductor layer 11. The above structure can suppress the occurrence of a leakage current path on the top face of the third buried layer 9 and improve reliability of the buried type semiconductor laser.
US07720115B2
An rf pulse compressor has a single high Q cavity resonator fed by a four port hybrid coupler which is connected to the resonator at coupling ports located at the intersection of two of the resonator's orthogonal axes with the resonator cavity walls. The hybrid coupler divides pulse power from an rf pulse power source and excites two space and phase orthogonal modes in the single cavity, the stored energy of which aids in producing compressed pulses at the output of the hybrid. On-axis perturbations in the cavity walls can be used to lock the orthogonal orientation of the modes excited in the cavity.
US07720112B2
The routing of data streams is discussed, and particularly routing one or more incoming streams to one or more output destination ports. The ability to merge incoming streams is discussed so that several low bit rate input packet streams can be merged into a higher bit rate output stream. An assignment data structure identifies for each input stream the or each destination to which it is to be routed, and a packet allocation data structure holds information about the packets and information about the destination of the packets to allow a memory holding the packets to be controlled accordingly.
US07720109B2
An apparatus for and method of estimating a one-way delay time between two hosts and an apparatus and method of clock synchronization using the same. The two hosts are connected to a network and communicate a predetermined packet; k-th, (k+1)-th, and (k+2)-th transmission times are measured at the first host, and k-th, and (k+1)-th transmission times are measured at the second host; a time difference of the m-th transmission time is measured at the first and second host, where m is k or k+1, and by using the measured transmission times, an m-th one-way delay time is calculated. If the time difference is identical to the calculated one-way delay time, a value equal to or less than the calculated one-way delay time is determined as the estimated one-way delay time. Accordingly, the estimation error of a one-way delay time is reduced for both symmetrically and asymmetrically connected hosts.
US07720108B2
An apparatus for transmitting synchronization headers into multiple high-speed serial data communications streams comprising an input channel receiving B symbols, a first output channel outputting A symbols, a second output channel outputting B symbols, a header sequence generator generating H symbols, one multiplexer per output channel, a temporary storage unit storing H×B input symbols, and a control unit coordinating the operation of the apparatus operating according to an input clock signal.
US07720104B2
A method and an apparatus to improve sensitivity of decoding time of a global positioning system (GPS) receiver at low signal to noise ratio is disclosed. In one embodiment, a method includes detecting a signal comprised of a data bits, arranging the data bits according to a specified property of an incremental mathematical table (e.g., may be an incremental bit-counter table), storing the data bits when arranging the data bits according to the specified property of the incremental mathematical table as a time counter table, algorithmically determining a value of an unknown data bit of the time counter table according to the specified property of the incremental mathematical table observed in the time counter table to generate a time counter value, and applying the time counter value to decode the signal.
US07720091B2
Methods and apparatuses to provide services to people who wish to make connections for real time communication, such as live telephone conversation, chat, video conferencing, etc. In one embodiment, a method includes: receiving in a system a call back time window for a request from a first entity to establish a media connection for real time communication with a second entity, the call back time window being specified by the first entity to indicate a period of time including a current time during which the first entity is available for real time communication with the second entity; and attempting to establish the media connection between the first entity and the second entity according to the call back time window.
US07720089B2
A compact serial communication device is disclosed that is formed from simplified circuits on a master side and a slave side and does not need a synchronous signal and a switching unit for switching transmission and reception operations, and is able to reduce load of the slave side. The master transmission/reception circuit outputs a serial data signal DATA to a transmission path with the serial data signal DATA being generated by superposing a low level superposition pulse on a clock signal, when the clock signal is at the high level, according to an output data signal to be output to the slave transmission/reception circuits; the slave transmission/reception circuits superposes a high level superposition pulse on the serial data signal DATA input from the transmission path according to an output data signal to be output to the master transmission/reception circuit when the clock signal is at the low level.
US07720087B2
A method and system for managing channels in a voice response system is provided. The method comprises periodically monitoring utilization of a system resource and determining a number, N, of voice channels required to be quiesced based on the utilization level of the system resource. This number is compared with the number of channels currently quiescing, Q, and the number of quiescing channels is adjusted accordingly. A quiescing channel is disabled when it becomes inactive.
US07720080B2
A relay unit capable of inquiring of a DNS comprises: an inquiry section which transfers an acquisition request of a transmission destination terminal address, sent from a transmission source terminal, to the DNS, and acquires the transmission destination terminal address and a transmission destination label corresponding to the transmission destination terminal address and transmission destination terminal; a label creation section which creates a unique relay label; a label storage section which correlates the created relay label to the acquired transmission destination terminal address and transmission destination label, and stores thus obtained label; a label transmission section which transmits the relay label and a private address of the relay unit to the transmission source terminal; and a determination section which, if a packet containing the relay label is received from the transmission source terminal, determines that the transmission destination terminal address and transmission destination label corresponding to the relay label are an address and a label related to a transmission destination or a relay destination of the packet.
US07720076B2
Method and apparatus providing connection-oriented services for packet switched data communications networks. Directory services include distributed discovery of MAC addresses and protocol alias addresses. Topology services include a link state topology exchange among switches, which provides each switch with a complete topology graph of the network. This enables an access switch receiving a data packet to determine a complete path from a source end system to a destination end system. Another service includes resolution of broadcast frames to unicast frames, in order to reduce the amount of broadcast traffic. Policy restrictions may be applied prior to connection setup. Path determination services enable multiple paths from a source to a destination. Connection management includes source routed mapping of connections on the desired path. A distributed call rerouting service is provided wherein if a link on an active path fails, each switch receives a topology change notification and unmaps any connection involving the failed link. A broadcast/unknown service provides restricted flooding of nonresolvable packets. Furthermore, connection-oriented switching is provided based on the source and destination MAC addresses as a connection identifier. Still further, resolution of networks outside the switch domain is enabled by access switches listening for network and server route advertisements and maintaining best routes to said networks and servers. The best route metrics may be combined with best path metrics to determine a path from a first access switch to an egress switch connected to the external network.
US07720075B2
According to some embodiments, a Gigabit Ethernet link is maintained with a link partner using less than four channels. Embodiments may also establish the Gigabit Ethernet link using four channels, determine that the link is idle, and terminate communication with the link partner over at least one of the four channels.
US07720073B2
Disclosed are systems and/or apparatuses of transmitting digital objects to a destination. In particular, disclosed are systems and/or apparatuses of facilitating bidding for the business of forwarding digital objects in a data transmission network.
US07720070B1
An information element including a hybrid acknowledgement map format and a method for using the hybrid acknowledgement format and information element are disclosed. The hybrid acknowledgement map comprises a type flag and a content block, and the value of the type flag indicates the format of the content block. This enables the hybrid acknowledgement map to represent data using multiple formats. The information element including a hybrid acknowledgement map includes a hybrid acknowledgement map and a hybrid quantity field indicating the number of hybrid acknowledgement maps in the information element. A field or multiple fields in the information element header indicate whether or not the information element includes a hybrid acknowledgement map. Information elements using hybrid acknowledgement maps contain more acknowledgment information which reduces transmission of information elements.
US07720069B2
A method for preventing Ethernet from being attacked is provided. The method comprises the steps as follows: after detecting a new connection between a port and a terminal device and receiving a data packet from the terminal device, an Ethernet communication device establishing and storing a fixed map between the port and a hardware address of the terminal device, then forwarding the data packet according to the fixed map; after detecting a disconnection between the port and the terminal device, the Ethernet communication device deleting the fixed map.
US07720068B2
Disclosed is a UGMII system to interface multirate devices including 10 gigabit per second data exchange rates. Mode selection is enabled to provide for automatic detection and adaptation to any transmit rate including 10M, 100M, 1G, and 10G. Mode selection comprises the negotiation between the UGMII extension sublayers located at the MAC and PHY to select between one of several operational modes including: XGMII communication, GMII encapsulation, Clause 22 MDIO register management and Clause 45 MDIO register management. Selection of UGMII and XGMII operating modes are negotiated between the MAC and PHY using ordered sets to announce and acknowledgement a mode change. In one embodiment 802.3 Clause 46 defined ordered sets are utilized.
US07720062B2
A digital broadcast transmitting/receiving system and a method for processing data are disclosed. The method for processing data may enhance the receiving performance of the receiving system by performing additional coding and multiplexing processes on the traffic information data and transmitting the processed data. Thus, robustness is provided to the traffic information data, thereby enabling the data to respond strongly against the channel environment which is always under constant and vast change.
US07720057B2
A data relay apparatus is connected to a network having a DHCP server and an authentication server. The data relay apparatus stores a MAC address of a communication device permitted to connect to it. When a communication device attempts to connect to the data relay apparatus, it is determined whether a MAC address of the communication device is stored in the data relay apparatus. If the MAC address is stored, the communication device is not authenticated by the authentication server, instead, dummy data indicating that authentication is successful is transmitted to the communication device. If the communication device requests that the DHCP server assign it an IP address, the DHCP server assigns an IP address to the communication device. Different security levels are set for a communication device that has failed to authenticate to the authentication server and for a communication device that successfully authenticates to the authentication server.
US07720054B2
A first router is configured for monitoring prescribed attributes of an active path connected to the first router, and supplying an update message to a second router, according to a prescribed routing protocol such as Enhanced Interior Gateway Routing Protocol (EIGRP), that specifies a detected change by the first router in at least one of the prescribed attributes of the connected active path. Hence, the second router, in response to receiving the update message, can update an internal topology table based on the detected change in the active path connected to the first router, and selectively adjust an internal routing table based on the detected change relative to queuing policies for prescribed data flows.
US07720053B2
A system and method for providing IP services. A packet is received at a line interface/network module and forwarded to a virtual routing engine The virtual routing engine determines if the packet requires processing by a virtual services engine. If the packet requires processing by the virtual services engine, the packet is routed to the virtual services engine for processing.
US07720045B2
A system and method that allows a user to concurrently connect to multiple wireless networks with a single network interface card is presented. The networks may be infrastructure (“IS”) networks and ad hoc (“AH”) networks. A driver is inserted into a device's networking stack and exposes a plurality of virtual wireless network adapters, one for each network. The adapters are enabled and disabled in accordance with which network is presently activated. Packets for a network are queued when the network is not enabled. The wireless driver controls the switching of the network card. In one embodiment where multiple wireless cards are switching in and out of AH networks, the method converges the switching times for the cards in an AH network to ensure concurrent connectivity in the AH network for at least a brief time period every switching cycle of the wireless cards.
US07720043B2
A group of data frames from a plurality of communication channels is received. At least one idle frame including a sequence number of a last frame in the group of data frames is then received. A delay period of time is allowed to elapse after receiving the idle frame before sending a negative acknowledgement message, if at least one data frame is missing.
US07720037B2
A first device may communicate by joining a wireless mesh network that includes at least one wireless device configured to operate a wireless routing protocol, discovering a group of other wireless devices configured to participate in the wireless mesh network, and accessing an interest metric for a second wireless device in the group of other wireless devices. The interest metric is based in part on a network topology from the wireless mesh network. The interest metric is related to an interest threshold and it is determined whether relating the interest metric to the interest threshold supports enabling messaging communications. If so, messaging communications may be enabled.
US07720033B2
According to one embodiment, a wireless communication apparatus includes a reserved period ensuring unit which ensures a reserved period to be occupied for communication in a communicable period time-shared in a group by adjustment in a periodic beacon period, a wireless communication unit which performs wireless communication using the reserved period, a group generating unit which generates a new group in which a periodic beacon period is formed not to temporally overlap the beacon period and causes the apparatus to belong to the new group, when the reserved period ensuring unit fails to ensure the reserved period, and a controlling unit which controls the reserved period ensuring unit to ensure the reserved period not to temporally overlap the beacon period of the original group in the communicable period of the new group to which the apparatus is caused to belong by the group generating unit.
US07720030B2
Techniques for explicit feedback delay measurement are described. An apparatus may comprise a processor to generate a steering matrix for transmit spatial processing over a channel, determine a delay time associated with explicit feedback information for the channel, and determine whether to modify the steering matrix with the explicit feedback information based on the delay time. Other embodiments are described and claimed.
US07720013B1
A method and system for analyzing continuous bit segments taken from a general data channel and classifying the sampled data by type, such as: voice, audio or data. B contiguous bits are converted to plus and minus deltas. The B-replaced values are then padded with B contiguous zeroes and the Fourier Transform of the padded sequence is computed. A power spectral density is derived from the Fourier Transform. In addition to the Fourier Transform, compression and entropy algorithms are performed on strings of bits within the message. The first B terms of the power spectral density and the results of the compression and entropy algorithms are used to differentiate and classify the data types, based on the premise that the combination of power spectral density, compression and entropy results yields parameters indicative of distinct types of data messages.
US07720001B2
A method and system for discovering interconnections between a plurality of network devices arranged in a stacked configuration is provided. A probe packet, including a tag indicating a transmit port from which the probe packet was transmitted and a receive port at which the probe packet was received, is sent from one network device to a next network device. A routing packet is sent from each of the network devices, including information regarding the configuration of the stack of network devices. A master network device is elected. The master network device sends a topology packet, which includes final configuration information, to the other network devices.
US07719995B2
A technique to replicate unicast flows is described. A plurality of unicast control flows are received at a network element from a plurality of clients. One of the unicast control flows is forwarded to a server. A unicast content flow is received from the server at the network element in response to forwarding the one of the unicast control flows. The unicast content flow is replicated at the network element as a plurality of replicated unicast content flows for transmission to the plurality of clients.
US07719992B1
A method for cable diagnostics in a network includes performing a test to determine initial state information for each of a plurality of lines coupled to a switch and storing the initial state information in a database. When a change in the state of a line is detected, the test is re-run to determine new state information of the line. The new state information is stored in the database and a message that identifies the change in state and a likely cause of the state change is issued to a network operator. It is emphasized that this abstract is provided to comply with the rules requiring an abstract that will allow a searcher or other reader to quickly ascertain the subject matter of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims.
US07719990B2
First to N-th circuit interface units 1041 to 104N corresponding to first to N-th circuits 1031 to 103N include an input traffic counter unit 1141, etc. and an output traffic counter unit 1151, etc. for counting the traffic of input and output. A traffic counter monitor block 123 in a control unit 105 specifies an input traffic counter unit 114 and an output traffic counter unit 115 of two circuits 103 through a switch unit 102 in a specific packet flow, and periodically obtains the count values, based on which the utilization rate, the discard rate, etc. of the corresponding circuit 103 are obtained to monitor the traffic. This makes it possible to monitor packet signal traffic when a plurality of circuits are to be switched without capturing each packet signal.
US07719982B2
In some embodiments a switching device is disclosed that includes one or more ingress queues to queue data received from external sources while waiting to forward the data to one or more egress queues. The egress queues queue the data while waiting to transmit the data to external sources. The switching device also includes a switch fabric to provide connectivity between the one or more ingress queues and the one or more egress queues. The switching device further includes an ingress flow-control manager to monitor flow-control state of the one or more ingress queues, and to detect and recover from loss of ON flow-control messages. Other embodiments are otherwise disclosed herein.
US07719976B2
Methods, apparatus, and computer program products for variable dynamic throttling of network traffic for intrusion prevention are disclosed that include initializing, as throttling parameters, a predefined time interval, a packet count, a packet count threshold, a throttle rate, a keepers count, and a discards count; starting a timer, the timer remaining on no longer than the predefined time interval; maintaining, while the timer is on, statistics including the packet count, the keepers count, and the discards count; for each data communications packet received by the network host, determining, in dependence upon the statistics and the throttle rate, whether to discard the packet and determining whether the packet count exceeds the packet count threshold; and if the packet count exceeds the packet count threshold: resetting the statistics, incrementing the throttle rate, and restarting the timer.
US07719972B2
Embodiments of methods and apparatus for providing an admission control system in a wireless mesh network are generally described herein. Other embodiments may be described and claimed.
US07719948B2
The lens unit for the optical pick-up apparatus has: the objective lens by which the projecting light from the light source is condensed on the information recording surface of the optical information recording medium; the phase control element which is arranged on the light source side to the objective lens, and which controls the phase of the projecting light from the light source; and the supporting member holding the objective lens and the phase control element; and the phase control element is held under the condition that its optical axis is inclined by a predetermined angle to the optical axis of the objective lens, and the intersection at which the optical axis of the phase control element crosses the optical surface having the phase structure is arranged on the optical path passing through the central point which passes the optical axis of the objective lens.
US07719947B2
A reading device for holographic storage includes a light source, a light-directing component, an optical sensor and a prism. The light-directing component is disposed on the transmission path of the light beam provided by the light source and directs the light beam to get incidence at a holographic storage medium in a reading angle to generate a data beam. The optical sensor is suitable for reading the data beam and reproducing stored data. The prism is disposed between the light source and the holographic storage medium and rotatable about a rotation axis perpendicular to the transmission path of the light beam for fine-adjusting the reading angle. The prism and the light beam satisfy the following formula: √{square root over (n2−sin2I1)}×sin A−cos A sin I1<1 I1 is the angle of incidence of the light beam, A is the vertex angle between the light incident surface and the light emerging surface and n is the refractive index of the prism.
US07719943B2
An information recording device and method capable of forming a recording mark by suppressing thermal interference. The device applies a laser beam to a recording medium and forms a recording mark in accordance with a recording signal. The device includes a light source for emitting the laser beam, signal generation elements for generating a recording pulse signal according to the recording signal, and drive elements for driving the light source according to the recording pulse signal. The recording pulse signal has a mark period for forming the recording mark and a space period. The recording pulse signal makes the level in the entire space period equal to or shorter than a predetermined length and a part of the space period longer than the predetermined length to be off level. While the recording pulse signal is off level, the recording medium is cooled down, thereby suppressing the affect of thermal interference.
US07719934B2
A method of recording control information in a recording medium, such as an optical disc, including at least one recording layer is provided Velocity information and per recording velocity write strategy (write strategy parameters) is included in control information, such that standardized control information can be uniformly applied to cope with the playback of a recorded optical disc. The method includes steps of recording, per applicable recording velocity, the control information within a management area of the at least one recording layer of the optical disc; and recording at least one write strategy information per the applicable recording velocity within the control information.
US07719928B2
Apparatuses, circuits, and methods for receiving at least one radio signal in a radio controlled timing apparatus using a single timing source. The present invention advantageously eliminates the need to provide an additional timing source to receive at least one radio signal, and therefore reduces the material cost and eliminates many engineering challenges.
US07719925B2
A hydrophone assembly includes at least four hydrophone units for converting an acoustic signal to an electrical signal, the hydrophone units being in a parallel, cylindrically symmetric spaced spatial relationship with each other, and at least one spacer element to maintain the hydrophone units fixed in the spatial relationship to each other, wherein the hydrophone units and spacer element are embedded in an encapsulant to form an elongated, flexible body.
US07719881B2
The invention relates to a reconfigurable digital logic unit comprising at least one logic gate with a cell presenting a magnetic layer system, the resistance of which may be altered by means of magnetic field pulses. Said logic gate comprises at least one first leg with at least one data cell and a second leg, wired parallel to the above, with at least one reference cell and a means for determination of the resistances of the first and second legs, representing a measure of the logical state of the logic gate, whereby the first leg comprises at least two parallel data cells (2).
US07719876B2
Circuitry and methods for restoring data in memory are disclosed. The memory may include at least one layer of a non-volatile two-terminal cross-point array that includes a plurality of two-terminal memory elements that store data as a plurality of conductivity profiles and retain stored data in the absence of power. Over a period of time, logic values indicative of the stored data may drift such that if the logic values are not restored, the stored data may become corrupted. At least a portion of each memory may have data rewritten or restored by circuitry electrically coupled with the memory. Other circuitry may be used to determine a schedule for performing restore operations to the memory and the restore operations may be triggered by an internal or an external signal or event. The circuitry may be positioned in a logic layer and the memory may be fabricated over the logic layer.
US07719864B2
A direct current to pulse amplitude modulated (“PAM”) current converter, denominated a “PAMCC”, is connected to an individual source of direct current. The PAMCC receives direct current and provides pulse amplitude modulated current at its output. The pulses are produced at a high frequency relative to the signal modulated on a sequence of pulses. The signal modulated onto a sequence of pulses may represent portions of a lower frequency sine wave or other lower frequency waveform, including DC.
US07719858B1
A polygon connected three-phase autotransformer using nine windings per phase provides a reduced power rating fifteen-phase power source suitable for 30-pulse AC to DC power converters. The windings are selected and connected in a manner that accommodates zero-sequence currents, such as the third harmonic, and minimizes total kVA rating. When the autotransformer is used to power a 15-phase AC to DC converter its kVA rating is typically less than 51% of the DC load kW. AC line current distortion is negligible and can satisfy the most exacting practical harmonic specifications. Additional isolated windings can provide means for the invention to operate as an efficient double-wound transformer.
US07719848B2
Base radios and communication apparatus (100) that include: a chassis (110); at least one power supply module (120) having a height that is substantially the height of a three rack unit chassis and having a width that is substantially one sixth the usable width of a nineteen inch rack; at least one fan kit module (130) having a first fan kit module dimension that is substantially the height of the power supply module and a second fan kit module dimension that is substantially five sixths the usable width of a nineteen inch rack; and at least one other module (140, 150) having a first module dimension that is substantially the second fan kit module dimension and having a corresponding second module dimension.
US07719838B2
The power inverter includes: a case made of a metal; a first power module provided in the case and including a DC terminal and an AC terminal; a second power module provided in the case and including a DC terminal and an AC terminal; and a cooling formation body for decreasing heat generated from the first and second power modules. The first and second power modules are disposed in a manner such that the DC terminals face each other.
US07719835B1
A wiring and power distribution device for a cabinet housing electronic equipment. The distribution device includes a plurality of compartments. Each compartment adapted to contain an electronic component, such as an uninterruptible power supply, a power-conditioning device, or a power distribution center containing circuit breakers. The distribution device also includes a cooling compartment, including a fan or passive convective chimney arranged to cool the interior of the cabinet with ambient air. The distribution device provides a single input point for power and signal wiring, and at least one output point for connection to the electronic devices contained within the cabinet.
US07719834B2
Two or more media drives that cannot be detached by the user are pre-installed in an enclosure. An expansion slot member having the smaller number of expansion drive slots than the number of media drives that can be pre-installed are provided. The media drives that are installed via the expansion drive slots are installed so as to be detached by the user.
US07719826B1
Integrated access cover arrangements for use in a portable computing devices, where the portable computing devices include a processor and are configured to house a user accessible component are presented including: a base configured to be coupled to the portable computing device; an integrated access cover housing a keyboard, the integrated access cover being slidingly connected with the base and configured to be disposed in at least a closed position and an open position with respect to the base, the user accessible component being hidden from a user when the integrated access cover is disposed in the closed position, the user accessible component being accessible by the user when the integrated access cover is disposed in the open position. In some embodiments, arrangements further include: a drive mechanism for translating the integrated access cover. Advantages include the ability to utilize lower profile configurations while maintaining functionality.
US07719823B2
A method for isolating phases in an electrical equipment enclosure having multi-phase bus bars and a mounting base for mounting electrical equipment. The insulation system includes a plurality of components including a plurality of side isolation barriers with each barrier defining at least one slot proximate one edge of the barrier and having at least one tab along another edge of the barrier. A side barrier adapter is configured to engage the isolation barrier and to engage the mounting base. An inner isolation barrier is configured to isolate at least two of the vertical bus bars and couple to the mounting base. A vertical bus rear wall defining a plurality of slots proximate at least two edges of the cover is fastened to the inner isolation barrier. A plurality of corner connectors is configured to engage one of the cover slots and the side isolation barrier slots.
US07719821B2
The present invention provides an electric double layer capacitor. An electric double layer capacitor element sandwiches a separator between a cathode and an anode, arranged inside a container comprising a concave shaped containing portion and lid. A first conductive layer on the inner bottom face of a containing portion is covered by an insulating layer, and opening portions formed on the insulating layer penetrate to the first conductive layer. A second conductive layer is formed on the insulating layer and inside the opening portions, and is connected to a cathode through a conductive adhesive. The first conductive layer penetrates through the side wall of the containing portion, and is connected to a connecting terminal. An anode is connected to a third conductive layer through a conductive adhesive, and a collector is connected to a connecting terminal by extending between the containing portion and the lid.
US07719809B2
A method and apparatus for distributing electrical power is provided. In one embodiment, the apparatus includes: a semiconductor switch adapted to receive input power from a DC power source, adapted to distribute power to a DC/DC module, and adapted to receive a control signal, a charge storage device in operative communication with the semiconductor switch and a return path associated with the DC power source, and a reverse current monitoring logic in operative communication with the semiconductor switch. In this embodiment, the reverse current monitoring logic is adapted to detect reverse current flowing in the semiconductor switch and, in response to detecting the reverse current, is adapted to open the semiconductor switch. Several embodiments of a method of distributing electrical power to a DC load are also provided.
US07719805B2
An ESD protection circuit connected between an input pad and an internal circuit is disclosed. The ESD protection circuit includes a main ESD protection device, a first resistor and a secondary device. The main ESD protection device is connected to the input pad for clamping a voltage of the input pad. The first resistor has a first end connected to the input pad and a second end connected to the internal circuit. The secondary device is connected to the second end of the first resistor and the main ESD protection device for clamping a voltage of the internal circuit. During an ESD event, the secondary device is turned on first to receive an ESD current and accordingly provides a trigger current to turn on the main ESD protection device.
US07719802B2
A magnetic sensor having adjustable electrical dimensions, such as electrical read width and electrical stripe height, is disclosed. The magnetic sensor includes a sensor stack with one or more bias electrodes positioned with respect to the sensor stack. The electrical width or electrical stripe height of the sensor stack is a function of a voltage applied to the bias electrodes. The electric field produced by the bias electrodes alters the electrical profile of the magnetoresistive device.
US07719795B2
A head for use in an information storage device includes a novel ABS, and a transducer with a heating element. The ABS includes a transducer pad that includes a surface in a first plane. The ABS also includes a pressure-relief trough that is recessed from the first plane by at least 0.1 microns and has an upstream breadth of no more than one fourth of the total length of the slider. The pressure-relief trough is disposed immediately upstream of the transducer pad and continuously spans the total width of the transducer pad. The ABS also includes a flow-diversion dam that has a dam surface that lies in the first plane. The dam surface continuously spans the total width of the transducer pad. The dam surface is disposed immediately upstream of the pressure-relief trough and generally downstream of a sub-ambient pressure cavity.
US07719794B2
According to an embodiment, a slider of a head comprises a negative-pressure cavity formed in a facing surface, a leading step portion situated on an inflow side of the negative-pressure cavity, a pair of side portions opposed to each other, a trailing step portion situated on an outflow side of the negative-pressure cavity, a leading pad provided on an end portion of the leading step portion on the negative-pressure cavity side, and a plurality of recesses formed on the inflow side of the leading pad and individually opening in the inflow-side end face. The leading step portion includes a main step portion which is situated beside the inflow side of the leading pad and extends in a second direction, and at least one extended step portion extending transversely to the second direction from the main step portion toward the inflow side and situated between the recesses.
US07719783B2
Embodiments of the invention suppress collision between a head element section and a magnetic disk. In manufacturing a hard disk drive (HDD) according to an embodiment of the present invention, recession R is preliminarily measured for each head slider. Recession R means the amount of recession of the head element section relative to the slider. Write current and heater current values respectively for the write device and the TFC heater are registered based on the measured recession. Since these values are set according to the recession of the head element section, it is possible to prevent each head element section from colliding with the magnetic disk while reducing the clearance between each head element section and the magnetic disk.
US07719781B2
A media includes a plurality of tracks, a preamble portion including a set of signals, a first servo burst having a first plurality of signals written substantially in phase with the preamble portion, and a second servo burst written out of phase with the preamble and the first servo portion. The media may be housed within a disk drive that includes a transducing head to read information from the media, and a read channel to read information from the disk including the information associated with the first servo burst and the second servo burst.
US07719778B2
An optical axis tilting device of a laser optical system, includes a lens barrel inside of which provided with a laser optical system; a tilt frame supported at the lens barrel; a tilt sensor which is provided at the tilt frame and is configured to detect a preset reference position of the tilt frame; a fixed frame fixed to the lens barrel and provided with a tilting mechanism which tilts the tilt frame relative to a horizontal plane; a leveling mechanism which supports the lens barrel tiltably, and tilts the lens barrel so as to detect the reference position by the tilt sensor and then levels the tilt frame; a feed screw which is rotatably driven by a driving motor; a feed piece which is reciprocated by the feed screw and engages with the tilt frame and tilts the tilt frame relative to the reference position; a piece position detection device configured to detect a position of the feed piece; and a computing device configured to calculate a tilting angle based on the position of the feed piece detected by the piece position detection device.
US07719777B2
A transparent multi-layer lens construction to be worn as a sunglass lens, or a fashion lens, that reflects light in a diffuse manner. The multi-layer lens construction is, in part, a combination of surface form and surface texture combined with a reflective medium and an anti-reflective coating. The present invention offers vast improvements over previously disclosed lens constructions in that it provides for both improved reflectivity and improved optical quality.
US07719776B2
A lens barrel includes a communicating passage that communicates between a space inside the lens barrel and outside of the lens barrel. The communicating passage includes a through hole, a circumferential groove, and a vertical groove. Light from outside the lens barrel is prevented from entering an effective optical range of a lens through the communicating passage. A partition is arranged between the effective optical range and a non-light-transmitting range. A surface of a portion outside the effective optical range is formed of a light-absorbing material, so that light is prevented from directly entering the lens through the communicating passage.
US07719774B2
In a zoom lens system, at a time of zooming from a wide angle end to a telephoto end, when focused on an object at a longest distance, at the telephoto end, a first lens unit moves to be positioned more toward an object side, than at a wide angle end, at the telephoto end, a second lens unit moves to be positioned more toward an image side, than at the wide angle end, at the telephoto end, an aperture stop and a third lens unit moves to be positioned more toward the object side, than at the wide angle end, and a combined system of the first lens unit and the second lens unit at the wide angle end has a negative refracting power, and at the time of zooming from the wide angle end to the telephoto end, the second lens unit is positioned more toward the object side than a position of the second lens unit at the wide angle end, and the first lens unit moves to be positioned more toward the object side, than at the wide angle end, at the intermediate zoom state, and in the intermediate zoom state, the aperture stop, the third lens unit, and an object point of the third lens unit move to be positioned more toward the object side, than at the wide angle end, and the zoom lens system satisfies predetermined conditional expressions.
US07719773B2
A zoom lens unit includes, in order from an object side to an image side: a first lens group having a positive refracting power; a second lens group having a negative refracting power; a third lens group having a positive refracting power; a fourth lens group having a negative refracting power; a fifth lens group having a positive refracting power; and a sixth lens group having a negative refracting power, an aperture stop is disposed between the second lens group and the third lens group, and when changing magnification from a wide-angle end to a telephoto end, at least the second lens group, the third lens group and the fifth lens group are moved, and the first lens group includes a reflecting optical element which bends a light path in the first lens group to obtain a predetermined light path length.
US07719764B1
A device for stereo projection of pictures represented by a picture signal which alternates periodically between pictures intended for right eye and pictures intended for left eye. A page selector which is adapted to transmit picture signals for first and, thereupon, each odd number picture to one projector and second and, thereupon, each even number picture to another projector.
US07719759B2
Provided is a compact and bright imaging optical system having a high resolution. The imaging optical system includes three reflectors composed of a first reflector (1), a second reflector (2), and a third reflector (3) that are arranged in this order on an optical path of incident ray so as not to block the incident light. In the imaging optical system, in which light beams reflected by the three reflectors form an image plane (4), a convex mirror is used for any one of the first reflector (1) and the third reflector (3) and a concave mirror is used for the other thereof, and vertexes of a triangular dipyramid (6) are defined in terms of a central chief ray (5) by an appropriate point on the central chief ray (5) that is incident to the first reflection surface, a reflection point of each central chief ray on the first to third reflection surfaces, and an image forming point of the central chief ray. A plane containing three reflection points of the central chief ray on the first to third reflection surfaces coincides with a bonding plane between two triangular pyramids forming the triangular dipyramid (6).
US07719753B2
An optical lithography system comprises a light source, a spatial light modulator, imaging optics and means for continuously moving a photosensitive substrate relative to the spatial light modulator. The spatial light modulator comprises at least one array of individually switchable elements. The spatial light modulator is continuously illuminated and an image of the spatial light modulator is continuously projected on the substrate; consequently, the image is constantly moving across the surface of the substrate. While the image is moving across the surface, elements of the spatial light modulator are switched such that a pixel on the surface of the substrate receives, in serial, doses of energy from multiple elements of the spatial light modulator, thus forming a latent image on the substrate surface. The imaging optics is configured to project a blurred image of the spatial light modulator on the substrate, enabling sub-pixel resolution feature edge placement.
US07719750B2
The present invention relates to improved electro-optic rearview mirror elements and assemblies incorporating the same.
US07719745B2
A display device includes the following elements. A display has a display area and includes an electro-optic layer and a light-reflecting layer reflecting light emitted from the electro-optic layer to the viewing side of the display device, the light-reflecting layer being arranged in the display area. A plate-shaped exterior has a frame area including a portion located outside the periphery of the display. An antireflective plate continuously covers both of the display area and the frame area. The antireflective plate prevents external light, which enters the viewing side of the display device and is reflected by the light-reflecting layer or the frame area, from emerging on the viewing side.
US07719740B2
Provided are a system and method for reducing failures due to hinge memory. The method, in one embodiment, includes providing a torsional element having an amount of hinge memory, wherein the hinge memory is at least partially created using an average operational temperature. The method, in this embodiment, further includes subjecting the torsional element having the hinge memory to a temperature equal to or greater than the average operational temperature while the torsional element is in a parked state for an amount of time to reduce the amount of the hinge memory.
US07719737B2
An optical scanning device includes a laser-beam-phase-modulatable liquid crystal device. The liquid crystal device has stripe-like electrode patterns arranged in one direction, with a provision of a part for changing an effective value of a driving voltage separately for each of stripe-like electrode patterns.
US07719735B2
A hologram recorder (A) records holograms in a selected unit recording area (B1) of a hologram recording medium (B) by interference between a recording beam (Lr) which is applied vertically to the unit recording area (B1) and a reference beam (Lr) which is applied obliquely to the unit recording area (B1). The hologram recorder (A) includes a reference beam oblique applier (23A, 23B) for application of the reference beam (Lr) obliquely to the unit recording area (B1) by reflection, and a reference beam swing mechanism (30) for supporting the reference beam oblique applier (23A, 23B) and for swinging the reference beam oblique applier (23A, 23B) about a predetermined rotation axis which is perpendicular to an entering direction of the recording beam (Lw) that makes an entry into the unit recording area.
US07719721B2
Setting of growing directions of dots in a dither matrix is facilitated. During defining of the growing directions of the dots corresponding to cells in the dither matrix, a target cell in the dither matrix is defined. When the growing directions of the dots in cells located within a range of one cell from the target cell are not set, the target cell is set as a reference point. When the growing direction of the dot in the cell located at the immediate left or the immediate right of the target cell is set, the growing direction of the dot in the target cell is set based on setting states of the growing directions of the dots in the cells located at the immediate left and the immediate right of the target cell and the reference point.
US07719712B2
A driver for driving simultaneously a variable number of firing resistors for a printhead includes a drive circuit for supplying a drive signal for firing the variable number of firing resistors, and a circuit for adjusting a voltage or current magnitude of the drive signal in dependence on the variable number of firing resistors to be fired simultaneously.
US07719711B2
There is provided a decoding apparatus and a decoding method which are for using compressed data efficiently by making the resolutions of the individual components differ from one another. A decoding apparatus decodes compressed data that represents an image signal composed of a plurality of components as a compressed code by making the resolutions of the individual components differ from one another. The decoding apparatus basically comprises input sections 5-Y, 5-I, 5-Q which decode compressed data and take in the individual components independently, a reduction circuit 5-Y-1 which reduces and changes a size corresponding to the processing unit and resolution of any one of the components, and a conversion section 5-6 which converts into a decoded image signal in a specific format by using reduced components and uncompressed components.
US07719708B2
An effective method for securing the release of the transmission, rendering, and outputting of an imaging/print job at an imaging device, for imaging/print jobs that originate in traditional print/spooling subsystems include the following steps. A print job header is associated with an imaging/print job to form a headed imaging/print job. A secured release input (that may be input at a secured release input apparatus of the client host device) is associated with the print job header by including a secured release indicative command/code in the print job header. The headed imaging/print job is divided into data packets. Initial data packet(s) are transmitted to the imaging device. It is determined whether the secured release indicative command/code is present in the initial data packet(s). Acceptance of subsequent data packets of the headed imaging/print job are prevented if the secured release indicative command/code is present in the initial data packet(s). When a secured release input is received on a secured release input apparatus of the imaging device, subsequent data packets of the headed imaging/print job are accepted.
US07719702B2
The CPU of a personal computer displays a list of one-click icons, each representing one or a plurality of printing functions, in the icon display area, and selects one one-click icon from the list of the one-click icons displayed in the icon display area, to automatically set a plurality of printing functions corresponding to the selected one-click icons.
US07719701B2
The CPU of a personal computer displays a list of one-click icons, each representing one or a plurality of printing functions, in the icon display area, and selects one one-click icon from the list of the one-click icons displayed in the icon display area, to automatically set a plurality of printing functions corresponding to the selected one-click icons.
US07719699B2
When different types of image storage apparatus such as an image sensing apparatus and an external image processing apparatus such as a printer are connected, in order to eliminate an operation error by an operator, cumbersome operation, and so forth by enabling to automatically perform optimum direct signal processing, whether control relation between the image storage apparatus and the external image processing apparatus is a first type in which a memory in the image storage apparatus is accessed directly from the external image processing apparatus, or a second type in which processing in the external image processing apparatus can be controlled by a controller of the image storage apparatus is determined in initial communication when the image storage apparatus is connected to the external image processing apparatus, and a processing procedure for processing an image in the image storage apparatus by the external image processing apparatus is changed based on the result of the determination.
US07719696B1
This invention provides a position-detecting mechanism and a position-detecting sensor, the calibration of the sensor easy, the deviation of a web from the reference line of the sensor easy to find. The position-detecting mechanism comprises (i) a light-emitting means 13 to emit a beam of visible light to a subject of measurement and (ii) a regulating means 14 to regulate the beam so that its cross section will be in a certain shape at the place of the subject of measurement and detects the position of the subject of measurement. Because the light-emitting means 13 emits a beam of visible light, the spot lit up by the beam on a subject of measurement is visible to the operator. Accordingly, the operator can judge the position of the subject of measurement by using his eyes alone without using a scale and easily, safely judge its position even while it is running on its production line.
US07719695B2
A sensor device includes a source of radiation and a reflective surface having a contour that directs radiation reflected from the surface along a field having at least two parallel sides. In a disclosed example, the reflective surface contour is at least partially curvilinear. A disclosed example includes a laser diode as the source of radiation and the reflective surface directs the reflected radiation in a direction that is generally perpendicular relative to a path that light follows as it emanates from the laser diode. The reflective surface in one example shapes the reflected radiation from a source that provides radiation along a path with obliquely oriented sides, the reflected radiation has at least two parallel sides. A disclosed sensor device is useful for measuring at least one feature of a part or object placed within a field of view of a sensing element that can detect the reflected radiation.
US07719681B2
A two-chamber electron impact emission sensor effective for monitoring vapor flux of materials in the presence of interfering species is described. The sensor includes two independent electron excitation regions and one photodetector for monitoring emission from excited species from both chambers. Copper vapor flux from an evaporation source was accurately measured in the presence of interfering H2O vapor, and Ga vapor flux from an evaporation source was accurately monitored in the presence of interfering CO2 gas. The invention permits deposition rates to be monitored using electron-impact emission spectroscopy with significantly improved accuracy in the presence of interfering gases at high partial pressures.
US07719678B2
Various aspects of the present invention are directed to a nanowire configured to couple electromagnetic radiation to a selected guided wave and devices incorporating such nanowires. In one aspect of the present invention, a nanowire structure includes a substrate and at least one nanowire attached to the substrate. A diameter, composition, or both may vary generally periodically along a length of the at least one nanowire. A coating may cover at least part of a circumferential surface of the at least one nanowire. The nanowire structure may be incorporated in a device including at least one optical-to-electrical converter operable to convert a guided wave propagating along the length of the at least one nanowire, at least in part responsive to irradiation, to an electrical signal. Other aspects of the present invention are directed to methods of fabricating nanowires structured to support guided waves.
US07719672B2
The invention provides a macro inspection apparatus including: a stage on which an inspection object is placed; a light source that irradiates light on an upper surface of the inspection object from an angular direction arbitrarily selected relative to the upper surface of the inspection object; and a line sensor which is placed in an angular direction selected relative to the upper surface of the inspection object so that an optical axis thereof corresponds with an edge of the upper surface area irradiated by the light source and which receives reflected light from the edge of the upper surface area of the inspection object.
US07719653B2
The present invention relates to a substrate for a liquid crystal display device and a liquid crystal display device which are used as, for example, a display unit of an electronic apparatus, and an object of the present invention is therefore to provide a substrate for a liquid crystal display device and a liquid crystal display device capable of providing high transmittance, high luminance, and good display characteristics as well as a high production yield. A substrate for a liquid crystal display device is provided with a storage capacitor bus line formed approximately parallel with a gate bus line, a first pixel electrode connected electrically to the source electrode of a transistor, a second pixel electrode formed so as to be opposed to part of the source electrode of the transistor via an insulating film and to be separate from the first pixel electrode, and a slit formed between the adjoining end portions of the first pixel electrode and the second pixel electrode and having a slit width which is greater than a shortest width in a region over the storage capacitor bus line.
US07719636B2
An embodiment of this document relates to an optical sheet and a liquid crystal display using the same. An optical sheet in accordance with an aspect of this document may comprise a base film, and a plurality of projections including at least one of lenticular lens or micro lens, positioned on one surface of the base film. The projection may comprise a first resin and a plurality of first beads, and about 1 to 10 parts by weight of the first bead based on 100 parts by weight of the first resin.
US07719634B2
A sensor is provided, which includes a substrate, an insulating layer formed on the substrate, a semiconductor formed on the insulating layer, an ohmic contact formed on the semiconductor, a sensor input electrode and a sensor output electrode formed on the ohmic contact, and a passivation layer formed on the sensor input electrode and the sensor output electrode. A sensor control electrode may also be formed between the substrate and the insulating layer. A thin film transistor array panel including the sensor and a liquid crystal display panel including the sensor are further provided.
US07719632B2
The present invention provides a liquid crystal display device which can largely enhance a property of focusing light from a backlight. The backlight arranged on a back surface of a liquid crystal panel includes a light guide plate, a light source, a first asymmetrical prism sheet, and a second asymmetrical prism sheet. A reflection surface having an inclination of 2° or less for guiding light from the light source toward the liquid crystal display panel is formed on a back surface of the light guide plate. The first asymmetrical prism sheet and the second asymmetrical prism sheet respectively include projecting portions which extend in the arrangement direction of the light source and are arranged in parallel to each other in the direction which intersects the arrangement direction of the light source.
US07719628B2
A backlight assembly includes a light providing unit, an optical sheet, and a mold frame. The light providing unit generates light. The optical sheet has a main body disposed on the light providing unit and a sheet-guiding portion protruding outward from the main body. The mold frame has a frame shape to receive the light providing unit and the optical sheet and includes a sheet-guiding recess and a securing protrusion adjacent to at least one side of the sheet-guiding recess and protruding with respect to an upper surface of the optical sheet to prevent misalignment of the optical sheet. The sheet-guiding recess receives the sheet-guiding portion.
US07719627B2
A display includes: a display panel; a flexible printed circuit board that is attached to the display panel at a first height; and a frame that has the display panel disposed therein. The frame includes a guide portion that pulls the flexible printed circuit board to the outside of the frame, with the height of the flexible printed circuit board being varied from the first height to a second height by bending the flexible printed circuit board.
US07719624B2
An active device array substrate, including a substrate, a plurality of pixel units, a plurality of first lead wires, an insulating layer, a plurality of second lead wires and a passivation layer, is provided. The active device array substrate has a display area and a peripheral area. The pixel units are disposed in the display area of the substrate. The first lead wires and the second lead wires are disposed in the peripheral area, and electrically connected to the pixel units respectively. The first lead wires have two opposite first tips. Moreover, the first lead wires are covered by the insulating layer having at least a first opening to expose the two opposite first tips. Additionally, the second lead wires are covered by the passivation layer.
US07719623B2
A liquid crystal display (LCD) panel includes pixels arranged in matrix, and first and second scan lines and a storage capacitance line. Each pixel has a first sub-pixel, which is disposed between the first and second scan lines, and first to third thin-film transistors (TFTs) and a pixel electrode divided into first and second regions. The first TFT is electrically connected to the first scan line and the first region. The second TFT is electrically connected to the first scan line and the second region. The third TFT is electrically connected to the second scan line and the second region. The storage capacitance line is electrically connected to the third TFT. A distance between the storage capacitance line and the first scan line is longer than that between the storage capacitance line and the second scan line.
US07719622B2
An LCD include a gate line, a first data line and a second data line arranged to cross each other, thereby defining a unit pixel region, a TFT disposed at a region where the gate line, the first data line and the second data line cross, and having a passivation layer on an exposed channel layer, a common line disposed in parallel to the gate line, a first storage electrode integrally formed with the common line for forming a storage capacitance in the unit pixel region, a second electrode disposed to overlap with the first storage electrode, common electrodes branched from the first storage electrode and disposed at the unit pixel region, and pixel electrodes branched from the second storage electrode and alternately disposed with the common electrodes.
US07719621B2
It is an object of the present invention to display unnaturalness-free images without showing an observer repetitive images in accordance with the observer's viewpoint.A light beam control element 101b limits a viewing area of images composed of light emitted from a light source array 101a. Here, a terminal position detection sensor 102 or an observer position detection sensor 103 detects a relative positional relationship between the observer's eye observing the image formed by the light emitted from the light source array 101a, and the light source array 101a and the light beam control element 101b. Based on the positional relationship detected by these sensors, a display image control device 104 controls the light source array 101a so as to change display contents of the light forming the image with the viewing area limited by the light beam control element 101b.
US07719616B2
A digital audio encoder, digital video conditioner, and a digital modulator are described for producing a television broadcast signal at a desired channel frequency range. Left and right audio channel signals are digitized and encoded according to a stereo standard and then combined to form a stereo audio signal. A second audio programming channel signal may be included. A video input can be digitized and conditioned to form a digital video channel. The stereo audio signal can be placed directly at a desired channel frequency by frequency modulation without the need for using an intermediate frequency. The digital video channel can be placed at a desired frequency by amplitude modulation. The digital and audio channels can be digitally combined to create a television transmission signal at a desired frequency and according to a desired standard.
US07719609B2
A foldable portable instrument with camera includes a first housing and a second housing connected in a foldable manner, a main display portion provided in the first housing, and a camera provided in the second housing. The camera is attached to the second housing such that a perpendicular direction with respect to a display surface of main display portion and an optical axis direction of the camera are identical when the first housing and the second housing are in an opened state. Accordingly, a foldable portable instrument with camera allowing natural image pick-up and directing the camera to a subject in a facilitated manner with a simplified configuration, when an image is picked up by the camera while it is monitored on the display portion, is obtained.
US07719604B2
An aberration compensation system for digital camera and a method therefor are provided, wherein the system includes an optical lens, an axial moving mechanism, a photosensitive element, and an image unit. The photosensitive element is loaded on the axial moving mechanism, and generates a first and a second image at a first and a second focus position. After receiving the first and second images, the image unit respectively calculates a first and a second image capture region and then synthesizes the two regions into a third image. The method includes using the optical lens to project the light beams of an object to be shot, generating the first image and second images, and capturing the distinct portions of the first and second images to be synthesized into the third image. Thereby, the system and method can solve the non-uniformity of the definitions at the center and periphery of each image.
US07719601B2
An image pickup apparatus may include an imaging optical system operative to adjust a focal position of images corresponding to light incident from a lens, a frame arranged movably in an optical axial direction of light incident to the imaging optical system for fixing the imaging optical system by covering the periphery of the imaging optical system, a drive unit operative to move the frame in the optical axial direction to an arbitrary position within a predetermined range, an image pickup device operative to receive light incident through the imaging optical system so as to output a signal corresponding to the received light, and an urging unit inserted between a pedestal base having the image pickup device attached thereto and the frame for urging the frame in the optical axial direction as well as in a direction remote from the image pickup device.
US07719594B2
A solid-state imaging device, and a camera provided with this device, that can output high quality images at high speed are realized by preventing improper OB clamping in a solid-state imaging device that performs pixel mixing in the horizontal direction. Vertical final stages, which are the transfer stages closest to a horizontal transfer component 4, are provided with provided with independent transfer electrodes V3-1, V3-2, V3-3, V6-1, V5-2, and V5-3 that are independent of other columns in a region between the horizontal transfer component and an effective pixel region, and a common transfer electrode that is common to all of the columns in the region between the horizontal transfer component 4 and the OB region. Further, in the vertical final stages, the entire region between the OB region and the horizontal transfer component, or the region minus openings formed for the wiring of V3-1 and V5-1 in the columns closest to the effective pixel region, is covered with a light blocking film.
US07719593B2
An image processing apparatus for processing an image signal, including: an operation processing section performing an operation according to a detected value of the image signal; a latch signal generation section for generating a plurality of latch signals, which indicate a timing of processing for the operation processing section and are based on a plurality of different picture rates applied to the image signal; a latch signal selection section selecting one of the plurality of latch signals inputted from the latch signal generation section and outputting the selected latch signal to the operation processing section; and a latch signal selection indication section indicating to the latch signal selection section a latch signal to be selected from the plurality of latch signals.
US07719591B2
A solid-state imaging device that suppresses crosstalk of light in a semiconductor substrate that caused by diffraction of light is disclosed. According to one aspect of the present invention, there is provided a solid-state imaging device comprising a plurality of pixels, each pixel comprising a photoelectric conversion element that is provided in a semiconductor substrate and performs photoelectric conversion of incident light to store signal charges, a floating junction that is provided in the semiconductor substrate in the proximity of the photoelectric conversion element and temporarily stores signal charges, and a transfer transistor that transfers the signal charges stored in the photoelectric conversion element to the floating junction, wherein at least one transfer transistor includes a gate electrode extended to cover a corresponding photoelectric conversion element.
US07719590B2
A pixel sensor cell of improved dynamic range comprises a coupling transistor that couples a capacitor device to a photosensing region (e.g., photodiode) of the pixel cell, the photodiode being coupled to a transfer gate and one terminal of the coupling transistor. In operation, the additional capacitance is coupled to the pixel cell photodiode when the voltage on the photodiode is drawn down to the substrate potential. Thus, the added capacitance is only connected to the imager cell when the cell is nearing its charge capacity. Otherwise, the cell has a low capacitance and low leakage. In an additional embodiment, a terminal of the capacitor is coupled to a “pulsed” supply voltage signal that enables substantially full depletion of stored charge from the capacitor to the photosensing region during a read out operation of the pixel sensor cell. In various embodiments, the locations of the added capacitance and photodiode may be interchanged with respect to the coupling transistor. In addition, the added capacitor of the pixel sensor cell allows for a global shutter operation.
US07719585B2
A solid-state imaging-device includes a base, frame-shaped ribs provided on the base and forming an internal space, a plurality of wiring members for electrically leading the internal space of a housing formed by the base and the ribs to an external portion, an imaging element fixed to the base inside the internal space, a transparent plate fixed to an upper surface of the ribs, and connecting members electrically connecting electrodes of the imaging element to the wiring members, wherein a plurality of protrusions are provided in a region of the base that faces the imaging element, and the imaging element is fixed by adhesive to the base while being supported by the protrusions. The protrusions enable the imaging element to avoid distortion caused by following the surface of the base, thereby suppressing the effect on electrical properties of the imaging element.
US07719577B2
Disclosed herein is a camera system and camera controller having a modularized design. Camera control functions within the controller are distributed among a number of modules, each module performing a component task of controlling a camera. Individual modules can perform tasks such as generating clock signals, digitizing an analog video signal, and providing multiplexed digital video output. Modules communicate with each other over a common bus sufficient to carry the signals necessary to control the camera. The system implements a RAM-based digital sequencer that provides the capability of loading bit patterns into memory and using these patterns to generate waveforms for clocking a CCD. Clock and readout sequences can be composed in a high level language, compiled and uploaded into the controller. Adjustable clamp and sample signal delays used in digitizing an analog video signal provide the capability to optimize the performance of the system in a given application.
US07719575B2
A regression analysis is carried out (8) using pixel signals having a K-th spectral characteristic as the explanatory variable and pixel signals having an L-th spectral characteristic as the purpose variable in a plurality of pixel positions in an area neighboring a pixel of interest to obtain a pixel signal having the L-th spectral characteristic (9). Pixel signals obtained by low-pass filtering (7a-7c) of the output signals of an imaging device may be used as the explanatory variable and the purpose variable. The occurrence of false colors is thereby reduced when, in a group of pixel signals from pixels arrayed on a two-dimensional plane, each pixel having one of a plurality of spectral characteristics, the missing colors at each pixel position are obtained by interpolation.
US07719571B2
A surveillance system and method for activating communication between at least one wireless input capture device ICD(s) and a corresponding digital input recorder (DIR) and/or another ICD, including the steps of providing base system; at least one user accessing the DIR via user interface either directly or remotely; the DIR and/or ICD searching for signal from the ICD(s) and establishing communication with them, and the DIR polling for information posted by a remote server computer (RSC) based upon user inputs thereto, for providing a secure surveillance system having wireless communication for monitoring a target environment.
US07719569B2
According to one embodiment, an image processing apparatus includes an image-capturing module configured to captures an image, a module configured to detect a first object region from the image, a module configured to extract color information of an image of the first object region, a module configured to detect candidates of a second object region, which is an object of recognition, from the image, a module configured to extract color information of an image of the second object region, and sets reference color data, a module configured to select the candidates of the second object region on the basis of the reference color data and the color information of the image of the first object region with respect to each of the candidates of the second object region, and a module configured to output, as an object of recognition, any one of the candidates of the second object region.
US07719558B1
Systems and methods are disclosed for determining and generating horizontal synchronization signals for a laser printer having a multi-facet rotating mirror. Each horizontal synchronization signal is determined based on measurements of the facets. The measurements are reflective of the configuration of the mirror and may be acquired using one horizontal synchronization sensor. Respective pseudo horizontal synchronization signals may be generated for multiple emitters based on the measurements obtained with the single horizontal synchronization sensor.
US07719555B2
In a line head, a plurality of element arrays arranged in a first direction. Each array includes a plurality of light emission elements arrayed in a second direction which is perpendicularly to the first direction. The light emission elements emit light for forming an electrostatic latent image on a photosensitive surface of an image carrier. A switcher activates the light emission elements in at least one of the element arrays while deactivating the others. A developer develops the latent image as a visible image with toner.
US07719542B1
A system and method displays a gradient of color extending outward from the border of a user interface control such as a text box, list box, check box, radio button, scroll bar or message box. The display may be made in response to an event, such as a mouse over or error. A user interface control has such a gradient of color.
US07719540B2
A method and apparatus for rendering three-dimensional graphics using a streaming render-cache with a multi-threading, multi-core graphics processor are disclosed. The graphics processor includes a streaming render-cache and render-cache controller to maintain the order in which threads are dispatched to the graphics engine, and to maintain data coherency between the render-cache and the main memory. The render-cache controller blocks threads from being dispatched to the graphics engine out of order by only allowing one sub-span to be in-flight at any given time.
US07719535B2
A system and method for translating character strings into another national language and displaying the translated character strings without updating any source code. The character strings are displayed on GUI environment upon the execution of the object computer program. The method for displaying character strings on GUI environment provided by a computer program comprises the steps of; (a) providing an executable program; (b) providing a text file including the character strings and being openable with the executable program; (c) executing the executable program (301); (d) retrieving the text file from the executable program (307); and (e) displaying the character strings included in the opened text file (315).
US07719531B2
A two-dimensional text editing mode is used when editing three-dimensional text. Once the three-dimensional text is selected for editing a two-dimensional text editing mode is automatically entered such that the user may easily edit the text. The two dimensional properties that are associated with the text are displayed within an outline of the shape such that the text may be edited in place. The 2-D properties, such as font, text color, shape color, and the like, are maintained during the editing. After the two-dimensional text editing has been completed, the text is redisplayed according to its 3-D properties.
US07719526B2
To reduce a pseudo contour which occurs when displaying by a time gray scale method. When gradation is expressed with an n bit, bits each of which is shown by a binary of the gray scales are divided into three bit groups, and one frame is divided into two subframe groups. Then, a (0
US07719522B2
An input device and system are described that acquires (measures) raw track pad sensor data and transmits this data to a host computer where it is analyzed by an application executing on one or more host computer central processing units. The resulting input processing architecture provides a track pad input device that is both lower in cost to manufacture and more flexible than prior art track pad input devices. Lower costs may be realized by eliminating the prior art's dedicated track pad hardware for processing sensor data (e.g., a processor and associated firmware memory). Increased flexibility may be realized by providing feature set functionality via software that executes on the host computer. In this architecture, track pad functionality may be modified, updated and enhanced through software upgrade procedures.
US07719521B2
A text input mechanism is provided especially for non-keyboard input devices for inputting text for languages that include large numbers of characters and that are not based on the Roman alphabets. Reading symbols of a language are presented to the user for selection. Reading symbols can be phonetic symbols for composing a pronunciation for a character in the language. Reading symbols can also be sub-characters that make up characters in the language. Upon a user specifying one or more reading symbols for a character, all characters in the language that match the specified reading symbols are dynamically identified and displayed to the user. The user can select the desired character from the displayed characters. The selected character is then entered into a computing system.
US07719512B2
A liquid crystal display (LCD) and corresponding driving method. The LCD includes a liquid crystal display panel for displaying images, a gate driver and a source driver for supplying scan signals and analog pixel signals to gate and data lines of the liquid crystal panel, a backlight unit having a side radiation type LED array that is driven sectionally by a plurality of unit areas to irradiate light to the liquid crystal display panel, and a luminance controller for controlling a luminance of the LED array by unit areas according to surrounding units areas.
US07719508B2
A scan driving apparatus having decreased size and power consumption, a flat panel display having the same, and a driving method thereof. The scan driving apparatus comprises a shift register generating output signals shifted in sequence in response to a clock signal, and a scan signal generator generating at least four scan signals in a cycle of the clock signal based on the output signals from the shift register and at least two control signals.
US07719505B2
A display device including data lines, scan lines, data driver, and scan driver is provided. An image signal output from the data driver has a plurality of data sections respectively corresponding to the data lines. Each predetermined number of image sections is defined as a group, and each group of image sections has a first and second reset data. The scan driver sequentially drives the scan lines of first group according to a first start waveform. The data driver writes the first group of data sections into display units on the scan lines of first group respectively. The scan driver drives the scan lines of first group according to a second start waveform after a predetermined period. The data driver writes the first reset data and the second reset data into the display units on a first portion and a second portion of scan lines respectively.
US07719504B2
A liquid crystal display and a driving method thereof. A gate driver drives a first pixel of the display via a first scanning line within a frame period including first and second data writing intervals. A first data voltage and a second data voltage are transmitted to the first pixel in the first and second data writing intervals, respectively. After the first data writing interval, a first color light source illuminates the first pixel. After the second data writing interval, a second color light source illuminates the first pixel. In a reset interval between the first and second data writing intervals, a voltage of a common line coupled to a storage capacitor of the first pixel is changed from a first common voltage to a second common voltage so that a voltage of a first liquid crystal capacitor of the first pixel is changed.
US07719497B2
A current feedback-type AMOLED driving circuit. The current feedback-type AMOLED driving circuit includes a plurality of pixel circuits each having a data terminal for receiving a pixel current command, and a sense terminal for transmitting pixel current to a driver Integrated Circuit (IC), and a plurality of data lines provided such that a single data line is provided for a single column formed by a plurality of pixel circuits, thus data terminals of the pixel circuits, forming the column, are connected to the data line. In the AMOLED driving circuit, two columns are paired, sense terminals of pixel circuits, forming a first column of the two columns, are connected to a data line for a second column, and sense terminals of pixel circuits, forming the second column, are connected to the data line for the first column. The AMOLED driving circuit is operated such that, when the first column is driven, the data line for the second column is used as a current feedback line for the first column, and when the second column is driven, the data line for the first column is used as a current feedback line for the second column. Accordingly, the number of pads of the driver IC is limited to one per column, and price competitiveness of the driver IC is improved.
US07719490B2
An apparatus for driving a PDP is capable of controlling a scan reference voltage when set up pulses are supplied to scan electrodes Y1 to Ym in a set up period of a reset period and when the scan reference voltage is supplied to the scan electrodes in an address period to reduce the generation of noise. The apparatus for driving the PDP comprises scan electrodes, a scan reference voltage supply comprising a resistance for applying a scan rising waveform that rises to a scan reference voltage with a second slope to the scan electrodes after a rising ramp waveform and a falling ramp waveform having a first slope have been applied to the scan electrodes, and a negative scan voltage supply for applying a negative scan pulse that falls from the scan reference voltage applied by the scan reference voltage supply to the scan electrodes.
US07719489B2
A driving circuit, which can realize the driving waveforms for a PDP without staying at ground potential includes having one side, the X side, of an panel equivalent capacitor Cp of the PDP coupled directly to ground with the Y side of the equivalent capacitor having a Scan IC 99 connected to a plurality of switches, each switch coupled to a different voltage source. One of the switches is bi-directional and coupled to ground.
US07719487B2
A method of driving a gas discharge device for displaying a frame with gradation. A charge producing voltage and a charge adjusting voltage are successively applied in an address preparation period to respective subfields.
US07719478B2
The present invention relates to photonic band gap antennas. This antenna comprises according to a plane of directions x, y, a radiating source and a photonic band gap structure constituted by parallel metal rods, the rods repeating themselves nx times in the direction x and ny times in the direction y. The height of the rods seen from the radiating source is increasing. The invention is able to control the radiation pattern of the antenna in the vertical plane.
US07719475B2
In a window-integrated antenna in vehicles, the heating conductor field (3,4) is used for FM reception as well as for LMS reception. At least one decoupling element (6) is provided for LMS reception which has a high-frequency, but non-galvanic connection to the heating conductor field (3,4). The decoupling element (6) is situated in the heating conductor field, in particular between two adjacent heating conductors (3).
US07719461B1
The invention, called “ORSE Track Fusion”, combines sensor tracks from dispersed sites, when limited communication bandwidth does not permit sharing of individual measurements. Since estimation errors due to maneuver biases are not independent for each sensor, optimal fusion of tracks produced by Kalman filters requires transmission of all the filter gain matrices used to update each sensor track prior to the fusion time. For this reason, prior art has resorted to suboptimal designs. ORSE Track Fusion according to aspects of the invention overcomes this disadvantage by propagating, transmitting, and fusing separately calculated covariance matrices for random and bias estimation errors. Furthermore, with ORSE, each sensor can have its own criteria in forming its track, and track fusion can be performed with different criteria at each processing site. Thus, ORSE Track Fusion has the unique flexibility to optimize track fusion simultaneously for multiple criteria to serve multiple users.
US07719446B2
The invention allows the interpolation factor, a critical parameter in sample rate conversion systems, to be computed in a real-time system where there is a complex relationship between a DSP clock and the data clocks. Typically, two or three of the clocks in such a system will have simple relationships (such as CLOCK1=2*CLOCK2). This relationship leads to degenerate cases where, in fact, there are only one or two clocks to consider rather than three. Furthermore, the invention allows for input data rates that are higher than the DSP clock rate. The invention also provides for an arbitrary time delay to be applied to the output signal.
US07719445B2
Methods of encoding and decoding a multi-channel audio signal and apparatuses for encoding and decoding a multi-channel audio signal are provided. The apparatus for decoding a multi-channel audio signal includes an unpacking extracting which extracts a pilot and data regarding a quantized CLD between a pair of channels of the plurality of channels from the bitstream, a differential decoding unit which restores a quantized CLD by adding the extracted pilot to the extracted data, and an inverse quantization unit which inversely quantizes the restored quantized CLD using a quantization table that considers the location properties of the pair of channels. The methods of encoding and decoding a multi-channel audio signal and the apparatuses for encoding and decoding a multi-channel audio signal can enable an efficient encoding/decoding by reducing the number of quantization bits required.
US07719439B2
An improved energy efficient intelligent rotary pulser for generating a mud pulse in a MWD (measurement while drilling) application. In the rotary pulser, a control circuit activates a brushless motor that rotates a windowed restrictor relative to a fixed housing to act as a shutter and window respectively. Opening of the windowed restrictor allows generally unrestricted mud flow. Closing of the windowed restrictor generally restricts mud flow. The windowed restrictor is powered both in opening and closing operations by the motor.
US07719436B2
Provided is a system, a tool and a method for communicating with a faulted circuit indicator (FCI), the faulted circuit indicator including a detection circuit for monitoring an electrical conductor of a power system. The system includes a display and a first light emitting diode associated with the display. The first light emitting diode generates an optical FCI status signal in response to an occurrence of a fault in the electrical conductor. The system also includes a first microcontroller operatively coupled to the display and the detection circuit, and a handheld user command tool adapted to optically couple with the display. The handheld user command tool is also adapted to generate an optical serial communication. The optical serial communication provides data and commands for operation of the faulted circuit indicator. The display may be remote or integrated into the FCI.
US07719433B1
An extended smoke alarm system and related methods are disclosed. In particular, embodiments of an extended smoke alarm system having wireless-signal-send-and-receive functionalities wherein the system includes one or more flashlights having at least wireless-signal-receiving functionality are detailed. Related methods for system use are also disclosed.
US07719416B2
A method of maintaining a structure includes providing a structure having a component subject to failure. A sensor, a memory and an energy harvesting device are mounted on the structure. The sensor is used and data derived from the sensor logged in the memory, wherein the memory is powered solely with energy derived from the energy harvesting device. The component is replaced if information in the memory shows that the component was subject to damaging usage.
US07719412B2
A transponder which does not require a power source used in an in-wheel motor system and a wheel therewith. The transponder comprises a data transmit/receive antenna, a data transmit/receive section, a sensor circuit, and a sensor power circuit. The sensor power circuit is constituted of a rectification circuit (energy converting means), a storage device and a charging coil and the input side of the rectification circuit is connected to a charging coil and the output side of the rectification circuit is connected to the storage device. The transponder is mounted on a motor rotor provided on an internal surface of a rim section in a tire constituting the wheel, and the charging coil is fixed so as to penetrate through a magnetic field produced by a motor stator.
US07719410B2
A method and apparatus is provided for detecting and avoiding an obstacle using a system of a vehicle. The method includes the steps of detecting a distance between the obstacle and the vehicle, generating an action when the distance between the obstacle and the vehicle is less than a threshold, determining whether an override of the system has been initiated, and disabling the action if it is determined that the override has been initiated. The system includes an obstacle detector, an action generator, an override mechanism, and a processor configured to implement the steps of the method set forth above.
US07719409B1
A hitch mounting assisting system includes a hitch and a hitch connector. A housing is removably mounted on the hitch. The housing has an opening therein. A tether has a free end extending through the opening and removably coupled to the hitch connector. A shaft is rotatably mounted in the housing. A first switch and a second switch are mounted in the housing. The shaft actuates the first switch when the shaft rotates in a first direction and actuates second switch when the shaft rotates in a second direction. The tether rotates the shaft in the first or second directions relative to a direction of misalignment between the hitch and hitch connector. A display screen is in communication with the first and second switches. The display screen indicates required movement of the hitch relative to the hitch connector to align the hitch and the hitch connector.
US07719406B2
An inductive signal transmission device including a transponder circuit (1) having at least one first coil, and an interrogation circuit (3) having at least one second coil (4). The transponder circuit is placed on an object (5) capable of rotating about at least one rotational axis (9) passing through the object. The interrogation circuit is placed on a structure, which can be stationary, to which the object is connected. A coupling coil (2), provided with at least one turn describing a ring, is mounted on the structure or the object coaxially to the rotational axis of the object. This coupling coil acts as the inductive coupling interface between the first coil and the second coil such that the inductive signal transmission is independent of the rotation of the object. The transponder circuit is of the passive type and includes at least one sensor for measuring a physical parameter. The device can be used in the automobile industry by placing the transponder circuit (1) and the coupling coil (2) on the wheel of a vehicle (5) and the interrogation circuit (3) on the chassis or body of the vehicle.
US07719404B2
The invention relates to an electrical and/or optical temperature detector/indicator based on conductive polymers, said detector/indicator being suitably used in such packages for products, the temperature changes of which need to be monitored.
US07719402B2
A diagnostic circuit for a potentiometer that connects a load resistor (laboratory resistor) to the slider of the potentiometer to allow a constant comparison of the contact resistance to measured values in the loaded and/or unloaded state when the slider is being adjusted, or when it is being paused at a critical point. This is accomplished by connecting a pull-up resistor to an input of the microprocessor, to which a load resistor is connected, and which is electrically connected to the slider. The slider itself is connected to an additional input of the microprocessor.
US07719399B2
A laminated coil component includes high-magnetic-permeability ferrite layers that are disposed on both main surfaces of a low-magnetic-permeability ferrite layer. Pores or pores filled with a resin are formed in the low-magnetic-permeability ferrite layer. Nickel in the high-magnetic-permeability ferrite layers does not significantly diffuse into the pores or the pores filled with the resin during firing, and thus, Ni does not readily diffuse into the low-magnetic-permeability ferrite layer.
US07719387B2
A multilayer filter 1 according to an embodiment of the present invention is a multilayer filter in which an inductor section 7 and a varistor multilayer section 9 are arranged to form an interface P, wherein varistor layers 81-84 contain ZnO as a major ingredient and additives of at least one element selected from the group consisting of Pr and Bi, Co, and Al, wherein inductor layers 61-69 contain ZnO as a major ingredient and contains no substantial amount of Co and Al, wherein an inductor diffusion layer 6D contains Li, wherein inductor conductor portions 121-128 are located 20 μm or more away from the interface P, and wherein varistor conductor portions 16, 17 are located 40 μm or more away from the interface P.
US07719386B2
A phase shifter selectively switches between a low-pass filter 13 and a high-pass filter 12 using single pole double throw switches 10a and 10b provided on the input and output sides, respectively, and operatively linked to each other. The single pole double throw switches 10a and 10b include FETs Q1c and Q1d that connect single pole side junctions and the low-pass filter, respectively, and inductance circuits (L1c and R2c, and L1d and R2d) connected in parallel with FETs Q1c and Q1d, respectively. The inductance circuits are respectively comprised of the inductor L1c and the resistor R2c connected in series and of the inductor L1 d and the resistor R2d connected in series.
US07719383B2
A high isolation electronic multiple pole multiple throw (MPNT) switching device is formed as a ring circuit that includes plural poles, plural throws, plural series switches and plural means for shunting. Each series switch receives a control signal, and each means for shunting receives shunt control signals. In one aspect, the shunt control signals include control signals received by distant series switches. In another aspect, the shunt control signals include control signals received by adjacent series switches. In another aspect, the shunt control signals include signals complementary to signals received by adjacent series switches. In another aspect, the shunt control signals include pole DC potentials or throw DC potentials. In another aspect, a switching device may operate in multiple transmission mode or multiple input multiple output (MIMO) mode. The MPNT switching device provides low insertion loss and high isolation at a wide range of frequencies.
US07719381B2
A transmission line balun comprising a tubular ferrite having a longitudinal passageway concentrically positioned over a conductive sleeve having a longitudinal passageway. The end of a coax feeder is positioned in the longitudinal passageway of the sleeve and the sleeve is grounded at its proximal end to the shield of the coax cable. The sleeve buffers the effects of the parasitic line caused by using ferrite in a balun.
US07719377B2
A pulse step modulator employs a plurality of series connected unit step power amplifier modules. Each module is turned on by a turn-on signal to provide a unit step voltage of a given value. An output circuit is connected to the modules for providing an output voltage to a load and wherein the output voltage is a multiple of the unit step voltages in dependence upon the number of modules that are turned on. The modules are sequentially turned on in a given order and are turned off in the reverse order. An encoder provides turn-on signals with each turn-on signal being applied to a selected one of the modules. The number of turn-on signals provided varies as a function of the magnitude of a time varying input signal. A controller alternately turns enables or disables (in a swapping manner) one of a pair of associated modules as the magnitude of the input signal increases and decreases.
US07719368B1
A method of eliminating a runaway condition in a PLL includes the steps of: determining whether the PLL is locked to an input reference signal; when the PLL is not locked to the input reference signal, determining whether a frequency of an output signal generated by the PLL exceeds a prescribed maximum frequency; and when the frequency of the output signal generated by the PLL exceeds the prescribed maximum frequency, resetting the PLL to thereby eliminate the runaway condition.
US07719366B2
Disclosed herein is a phase lock loop (PLL) circuit capable of executing digital control of an oscillation circuit thereof by using a dividing ratio represented by a digital value obtained by dividing an oscillation frequency by a reference frequency. The PLL circuit includes a phase comparator for comparing the digital value obtained by converting the dividing ratio with a digital value representing each cumulative addition value of a clock count expressed in a decimal-point format representing the oscillation signal in each period of a reference signal, a loop-gain control section configured to control the loop gain of the PLL circuit, and an output converging section configured to converge an output by the phase comparator.
US07719365B2
In a method and system for filtering an input signal with a filter included in a phase locked loop (PLL), a unidirectional feedback path is configured from an output of the filter to an input of the filter. The unidirectional feedback path includes a feedback resistor that is configured to adjust a bandwidth of the PLL. A zero path is configured from the output to a voltage reference, such as ground. The zero path includes a capacitor coupled in series with a bias resistor. The bias resistor, which along with the capacitor determines a zero frequency of the filter, is configured to reduce a value of the capacitor without a substantial increase in a phase noise of the PLL due to the unidirectional nature of the feedback. A reduction in the value of the capacitor enables a corresponding reduction in a silicon area to form the capacitor.
US07719358B2
A low frequency analog circuit and a method for designing the same are provided. In a low frequency analog circuit according to the present invention, a part of MOS transistors employed in the circuit are operated at a weak inversion region.
US07719357B2
The present invention provides a differential amplifier with a plurality of input pairs. The differential amplifier not only includes a differential amplifier with a single input pair but also includes a pair of transistors and a current source to provide the input signals of an extra input pair. The pair of transistors and the differential amplifier with a single input pair share a same load unit. In addition, by using control signals to control the on/off state of each current source, the input signals of the plurality of input pairs are switched, and thereby improve the signal quality. Thus, the need of an additional electrostatic discharge device (ESD device) may be avoided, and thereby reduce cost.
US07719353B2
An amplifying apparatus includes a splitting unit for splitting an input signal into a first split signal and a second split signal; phase-shifting unit for phase-shifting the first split signal and the second split signal, respectively; a first amplifying unit for amplifying a first phase-shifted signal and outputting the signal as a first output signal; a second amplifying unit for amplifying, in a substantially identical manner to the first amplifying unit, a second phase-shifted signal and outputting the signal as a second output signal; and a matching unit for matching the first output signal and the second output signal to a first transmission unit and a second transmission unit, respectively. The first transmission unit is for transmitting the first output signal from the matching unit to a load resistor, and the second transmission unit is for transmitting the second output signal from the matching unit to the load resistor.
US07719347B2
In related arts, a body voltage needs to be controlled by separately detecting external environment such as temperature. In the related art, variation such as a process parameter for each individual product has not been considered. A semiconductor integrated circuit according to the present invention includes a comparator comparing a leak current of a first conductive type transistor with a leak current of a second conductive type transistor to output a comparing result, and a conduction control signal generator outputting a signal determining a conduction state of the first conductive type transistor and a conduction state of the second conductive type transistor in a power saving control target circuit in a power saving mode based on the comparing result.
US07719343B2
A charge pump method and apparatus is described having various aspects. Noise injection from a charge pump to other circuits may be reduced by limiting both positive and negative clock transition rates, as well as by limiting drive currents within clock generator driver circuits, and also by increasing a control node AC impedance of certain transfer capacitor coupling switches. A single-phase clock may be used to control as many as all active switches within a charge pump, and capacitive coupling may simplify biasing and timing for clock signals controlling transfer capacitor coupling switches. Any combination of such aspects of the method or apparatus may be employed to quiet and/or simplify charge pump designs over a wide range of charge pump architectures.
US07719332B2
Delay lock loop circuits are described, which may include two or more delay stages that each includes a plurality of selectable delay elements. A reference signal drives an input of the first delay stage, which provides a first output. The first output drives an input of the second delay stage, which provides a second output. The circuits further include a first selector register that is associated with the first delay stage. A value maintained in the first selector register determines a number of the selectable delay elements utilized in the first delay stage. The circuits further include a second selector register associated with the second delay stage. A value maintained in the second selector register determines a number of the selectable delay elements utilized in the second delay stage. Modification of the values maintained in the first and second selector registers are synchronized to the first and second outputs, respectively.
US07719329B1
Phase-locked loop (PLL) fast lock circuit and method using a second frequency controlled feedback loop to complement a primary frequency and phase controlled feedback loop. The second loop may charge a capacitor controlling input voltage to a voltage controlled oscillator (VCO) up and down faster that the primary loop, such as using up and a down charge pumps. In some cases, the second loop uses a frequency detector to detect a difference between a reference and feedback signal frequencies; and in response uses logic to control two pump up and two pump down charge pumps. The frequency detector may be configured to receive a reset signal and a lock signal. The reset signal causes the second loop to send a strong pump up charge to the capacitor without waiting for a difference in the frequencies. The lock signal causes the frequency detector to stops counting the difference in the frequencies.
US07719307B2
A data output driving circuit for a semiconductor apparatus can include a code multiplier configured to multiply a received first code by a multiplication factor determined in response to a control signal and generating a second code; a signal line configured to transmit the second code; and a plurality of data output drivers commonly connected to the signal line and changed in an impedance thereof in response to the second code.
US07719305B2
A logic signal isolator including a micro-transformer with a primary winding and a secondary winding. A transmitter circuit drives the primary winding in response to a received input logic signal such that, in response to a first type of edge in the logic signal, at least a first amplitude signal is supplied to the primary winding and, in response to a second type of edge in the logic signal, a second different amplitude signal is supplied to the primary winding. A receiver circuit receives corresponding first amplitude and second amplitude signals from the secondary winding and reconstructs the received logic input signal from the received signals.
US07719297B2
A probe apparatus for sequentially testing electrical characteristics of chips includes an imaging unit for capturing images of the electrode pads of the inspection substrate, and a unit for calculating contact positions at which the probes are expected to contact with the electrode pads. The probe apparatus further includes a storage unit for storing correction data in which reference points on a reference substrate are associated with correction amounts corresponding to differences between actual and calculated contact positions of the reference points, and a unit for obtaining actual contact positions for the electrode pads by measuring relative positions of the electrode pads with respect to the reference points and correcting the calculated contact positions of the electrode pads based on the relative positions and the correction data.
US07719296B2
In the present invention, an inspection contact structure is attached to the lower surface side of a circuit board in a probe card. In the inspection contact structure, elastic sheets with protruding conductive portions are respectively attached to both surfaces of a silicone substrate. The silicone substrate is formed with current-carrying paths passing therethrough in the vertical direction, and the sheet conductive portions are in contact with the current-carrying paths from above and below. The conductive portions on the upper side are in contact with connecting terminals of the circuit board. At the time of inspection of electric properties of a wafer, electrode pads on the wafer are pressed against the conductive portions on the lower side and thereby brought into contact with them.
US07719291B2
A capacitive sensor with at least one reference impedance (2) and at least one measuring condenser (3), at least one electrical alternating signal source (4), a current supply network (5) and an analysis unit (6) in which the reference impedance (2) and the measuring condenser (3) are connected via the current supply network (5) to the alternating signal source (4) and the analysis unit (6) in such a way that the charge and discharge currents of the reference impedance (2) and the measuring condenser (3) and/or an analysis signal from the analysis unit (6) that characterizes the charge and discharge currents of the reference impedance (2) and the measuring condenser (3) can be analyzed. As a result, the reference impedance (2) can be tuned. The capacitive sensor avoids—at least partially—drawbacks in the capacitive sensors known from the prior art in that the reference impedance can be tuned.
US07719274B2
A non-linear phase correction method is provided. For the non-linear phase correction method, image information is acquired by gradient echo echo planar imaging (EPI). Reference information is acquired by spin echo EPI. The image information is corrected based on the reference information.
US07719273B2
An apparatus for nuclear magnetic resonance measurement includes a measurement portion having a magnet for applying a magnetic field to a sample, a bore within the magnet, a nuclear magnetic resonance probe disposed in the bore, and a container for retaining the sample therein; a mixing filter portion for mixing a small molecule solution with a sample solution; a separating filter portion; a small molecule concentration controlling portion; a transmitter/receiver system; a unit for carrying out circulation solution transfer; a unit for injecting the small molecule solution; a unit for controlling the small molecule concentration; a unit for injecting the sample solution; a unit for holding the sample solution in the measurement portion; a unit for discharging the sample solution; and a unit for carrying out nuclear magnetic resonance measurement of the sample solution.
US07719270B2
In a method and apparatus for accelerated spiral-coded imaging in magnetic resonance tomography using spiral-shaped k-space sampling, the underlying k-matrix is under-sampled such that an additional spiral is obtained by point mirroring of the measured values at the center of the k-matrix. This additional spiral forms a complete data set of the k-matrix together with the first spiral for imaging the output information.
US07719268B2
The present invention is a polarizing process involving a number of steps. The first step requires moving a flowing mixture of gas, the gas at least containing a polarizable nuclear species and vapor of at least one alkali metal, with a transport velocity that is not negligible when compared with the natural velocity of diffusive transport. The second step is propagating laser light in a direction, preferably at least partially through a polarizing cell. The next step is directing the flowing gas along a direction generally opposite to the direction of laser light propagation. The next step is containing the flowing gas mixture in the polarizing cell. The final step is immersing the polarizing cell in a magnetic field. These steps can be initiated in any order, although the flowing gas, the propagating laser and the magnetic field immersion must be concurrently active for polarization to occur.
US07719263B2
The invention relates to an inductive position measuring device or goniometer having two to no more than five digital oscillators, each of which contains measuring coils or reference coils. Particularly favorable for one application as a transmission sensor is a coil array for three or four oscillators that includes two measuring coils and/or two reference coils. When one plate-shaped measuring element that is sensitive for eddy currents passes through the measuring area, a measuring coil arranged in a planar manner is increasingly covered. One reference coil is arranged such that it does not touch the movement track of the measuring element, but is exposed to the same ambient conditions (temperatures) as the measuring coil. Another reference coil is arranged such that it is covered by the measuring element in the entire measuring area and therefore can compensate the fluctuations in the spacing height between the planar coil array and the measuring element that occur during operation. It is also possible to use additional height reference coils to compensate tilting of the measuring element. Pulse frequencies of the digital oscillator signals are counted asynchronously and subtracted by pairs in a digital evaluation circuit.
US07719261B2
Systems and methods according to exemplary embodiments address, among other features, the area of calibrating a sensor using a constant vector field. In one exemplary embodiment, a method for calibrating a sensor includes the steps of placing the sensor in a cube, rotating the cube between a plurality of different orientations, collecting at least one reading from the sensor from each of the plurality of different orientations and calibrating the sensor using the collected readings.
US07719257B2
A current sensing module for disposal proximate a conductor is disclosed. The current sensing module includes a housing having a first section and a second section that together define an opening for receiving the conductor therethrough. The second section is in operable connection with the first section. The current sensing module further includes a micro-electromechanical system (MEMS) based current sensor disposed within the first section proximate the opening for receiving the conductor.
US07719251B2
A switching mode power converter may include a modulation circuit to dynamically control a variable switching frequency of the power converter based on an error voltage of the power converter. The power converter may also include a control circuit connected to the modulation circuit and arranged to dynamically limit an inductor current in the power converter while the switching frequency of the power converter changes. A variable limit on the inductor current may be based on the error voltage of the power converter, a load current of the power converter, or information from a power manager of a system in which the power converter resides. In some implementations, the power converter may also include a disabling circuit to control the modulation circuit to disable the variable switching frequency when a sufficiently large load transient is detected.
US07719239B2
A voltage regulator for controlling over-voltage conditions in an electrical generator by rapidly discharging the generator field winding current into a discharge resistor upon the detection of the over-voltage. A field discharge transistor is switched by a soft switching circuit to direct the generator field winding current to the discharge resistor. A hysteresis circuit detects when a point of regulation voltage exceeds a first threshold triggering the discharge of the generator field winding current. The hysteresis circuit also detects when the point of regulation voltage goes below a second lower threshold and triggers the field discharge transistor to bypass the discharge resistor and return to a normal mode.
US07719238B2
In a charging/discharging control system for controlling an allowable power level of a secondary battery at the time of charging/discharging operations, excessive discharging or recharging of the secondary battery is prevented, and excessive suppression of the charging/discharging of the secondary battery is prevented. A vehicle ECU controls charging/discharging of the secondary battery in accordance with a predetermined allowable power level. A battery ECU detects an actual loading power level of a secondary battery; calculates a differential power level between the detected actual loading power level and an allowable power level; measures the number of times the calculated differential power level has become equal to or lower than a predetermined threshold value; and downwardly revises the allowable power level when the count has become equal to or greater than a predetermined upper-limit level.
US07719235B2
Provided is a charge/discharge protection circuit, which has a simple circuit configuration using a double-throw semiconductor switching device and is capable of recovering from a state where charging/discharging is inhibited with the double-throw semiconductor switching device being turned off. The charge/discharge protection circuit includes a charge/discharge control circuit which is provided with a second terminal for detecting which one of a charger and a load is connected to an external terminal. The second terminal has a first resistor and a first switch connected in series between a power source, and has a second resistor and a second switch connected in series between a ground.
US07719231B2
An equilibrated charging method for n cells of a lithium-ion or lithium-polymer battery, connected in series. The method is characterised in carrying out a continuous monitoring of the levels of charge of the different cells (1), from the beginning of the operation of charging the battery (2) and during the process and, as a function of the analysis of the levels of charge, to carry out a uniform supply to all the cells (1), or an equilibration of the levels of charge of the cells (1), by supplying the same in different manners, as a function of the levels of charge thereof.
US07719224B2
The invention includes a system and method for generating simulated encoder outputs in a control system. An output pulse width between reference position inputs is computed, the output pulse width being based upon a difference between an updated reference position input and a previous reference position input, and upon a time interval between the reference position inputs. Next, a plurality of simulated encoder pulses is output between updates of the reference position input based upon the computed output pulse width. The output pulse is thereafter adjusted in a closed loop manner between updates of the reference position input.
US07719223B2
A circuit for indirectly measuring a sign of a current flowing in an inverter stage coupled to a phase of a motor or indirectly measuring the sign of the voltage induced by a counter Electromotive Force (EMF) in a coil of the phase of the motor, the inverter stage being connected between a power supply and the ground. The circuit includes a gate driver circuit coupled to the inverter stage for alternatively connecting the phase of the motor to the power supply and to ground, the gate driver circuit having a current sign detection circuit, wherein the current sign detection circuit senses the sign of the current flowing in the inverter stage, or the sign of the counter EMF for controlling the commutation of switches in the inverter stage.
US07719204B1
A method for controlling striations in a lamp powered by an electronic ballast includes the steps of generating an asymmetric lamp current using an unbalanced circuit component in the electronic ballast and supplying that current to the lamp. The unbalanced circuit component may be an unbalanced output transformer or an unbalanced DC choke. The output transformer is unbalanced by offsetting the number of turns on each side of the tap on the primary winding of the transformer. In a similar manner, the DC choke is unbalanced by offsetting the number of turns in each winding of the choke.
US07719196B2
The present invention includes a waveguide for outputting radio frequency wave, a vacuum envelope provided with a slow-wave circuit, a coaxial connection part connecting the waveguide and the vacuum envelope, an insulating window member which is provided in the coaxial connection part and which hermetically seals a said of vacuum envelope and a said of waveguide, a coaxial center conductor of exterior portion with one end supported by the waveguide, and a coaxial center conductor of an interior portion with one end abutting on the slow-wave circuit and the other end connected to the coaxial center conductor of the exterior portion. The waveguide is provided with a screw part supporting the coaxial center conductor of the exterior portion movably in an axial direction of the coaxial center conductor of the exterior portion. An end portion of the coaxial center conductor of the exterior portion is connected to the end portion of the coaxial center conductor of the interior portion movably in the axial direction of the coaxial center conductor of the exterior portion.
US07719189B2
A plasma display panel is provided. The plasma display panel includes a substrate and a phosphor layer. The phosphor layer has a red phosphor layer, a green phosphor layer and a blue phosphor layer. At least one of a start point of the red phosphor layer, a start point of the green phosphor layer and a start point of the blue phosphor layer is different from a start point of the remaining phosphor layer.
US07719187B2
The various embodiments of the invention provide an addressable or a static emissive display comprising a plurality of layers, including a first substrate layer, wherein each succeeding layer is formed by printing or coating the layer over preceding layers. Exemplary substrates include paper, plastic, rubber, fabric, glass, ceramic, or any other insulator or semiconductor. In an exemplary embodiment, the display includes a first conductive layer attached to the substrate and forming a first plurality of conductors; various dielectric layers; an emissive layer; a second, transmissive conductive layer forming a second plurality of conductors; a third conductive layer included in the second plurality of conductors and having a comparatively lower impedance; and optional color and masking layers. Pixels are defined by the corresponding display regions between the first and second plurality of conductors. Various embodiments are addressable, have a substantially flat form factor with a thickness of 1-3 mm, and are also scalable virtually limitlessly, from the size of a mobile telephone display to that of a billboard.
US07719185B2
An organic light emitting display (OLED), which includes a display unit and a controlling unit, is provided. The display unit includes an organic light emission layer and a transparent thin film transistor (TFT) to drive the organic light emission layer, and the display unit emits light into two opposite surfaces (upper and lower surfaces). The controlling unit includes an electro-optical layer that is capable of being switched from one state to another state by applying voltage to the layer. The controlling unit controls transmission of light emitted from the display unit. Therefore the flat panel display of the present invention is capable of displaying an image in one surface or in two surfaces. The selection of surface of image display can be manually or automatically controlled by a user. The controlling unit can includes a liquid crystal device, an electrophoretic device, or an electrochromic device.
US07719181B2
An organic EL device includes a substrate; first electrodes corresponding to individual pixels on the substrate; partitions partitioning the first electrodes to define substantially rectangular pixel regions; organic functional layers, corresponding to the individual pixels, disposed at least in the pixel regions; a second electrode disposed on the organic functional layers and the partitions; and auxiliary lines disposed on a top or bottom surface of the second electrode to support the conductivity of the second electrode. The auxiliary lines extend through the pixel regions so as to cross longer sides thereof and divide the pixel regions into a plurality of subregions.
US07719179B2
An electron emission display device comprises: a front panel which includes a front substrate, an anode electrode formed on a surface of the front substrate, and a fluorescent layer; a rear panel which includes a rear substrate disposed facing the front substrate at a predetermined distance, electron emitters formed on the rear substrate, and at least one driving electrode that controls the emission of electrons from the electron emitters; a sealing member which seals the front and rear panels; and at least one dielectric layer included in the sealing member and having a dielectric constant less than that of the sealing member.
US07719171B2
A method of fabricating a hermetic terminal having an annular ring, a lead arranged to penetrate through the ring in which one end side thereof is an inner lead portion electrically connected to a piezoelectric vibrating piece and the other end side thereof is an outer lead portion electrically connected to outside as the ring is between them, and a filler fixing the lead to the ring, wherein the hermetic terminal seals the piezoelectric vibrating piece inside a case, the method includes the steps of: applying plating to a hermetic terminal intermediate having the lead fixed in the ring with the filler to plate the ring and the lead; setting the hermetic terminal intermediate after subjected to plating on a holding member; and flattening an end part of an inner lead portion in the lead to form a stair portion in the hermetic terminal intermediate set on the holding member.
US07719165B2
The invention relates to a method and a circuit arrangement for the precise, dynamic, digital control of especially piezoelectric actuators for micropositioning systems, comprising a regulator, whereby in order to minimise position order deviations the future system behaviour is estimated and current correction signals for the purpose of a feedforward correction are obtained. According to the invention, the signal of the command variable is passed via a switchable bypass to a digital/analog converter with highest resolution for the purpose of reducing the latency times in the feedforward loop of the sampling system, with said converter being operated at the sampling rate of the sampling system. The feedforward loop leads to a fast digital/analog converter which is controlled independent of the sampling system. The output signals of the converters, which represent control voltages are supplied in an added-up form to the device to be controlled, in particular, to a piezoelectric actuator which together with a position sensor forms the controlled system.
US07719163B2
An actuator that can be driven at a reduced voltage and manufactured with ease, and a method for manufacturing the same are provided. The actuator includes second supporting portions 31 and 32 secured to a supporting substrate 4 through a spacer, fixed portions 33 and 34 secured to the supporting substrate 4 with no intervention of the spacer, fixed comb electrodes 331 and 341 integrally formed the fixed portions 33 and 34 and meshing with movable comb electrodes 211 and 212 in a spaced-apart relationship, and bridge portions 35 and 36 for connecting the fixed portions 33 and 34 to the second supporting portions 31 and 32. The fixed portions 33 and 34 are affixed to the supporting substrate 4 in a condition that they are deflected toward the supporting substrate 4 with respect to the second supporting portions 31 and 32 while bending the bridge portions 35 and 36, thereby initially deflecting the fixed comb electrodes 331 and 341 so as to be out of alignment with the movable comb electrodes 211 and 212 in a thickness direction of the supporting substrate 4.
US07719158B2
A slip-ring brush includes a holder and a brush element that has three regions. The brush element is joined in the first region to the holder, and exhibits a cross-sectional geometry having a cross-sectional area in the second region, which is predetermined for the contacting with a slip ring. The brush element has the same cross-sectional area in the third region as in the second region. The brush element is additionally arranged such that its third region is disposed between the first region and the second region. The cross-sectional geometry of the brush element in the third region is shaped so that it deviates from the cross-sectional geometry of the second region, to reduce the effective spring stiffness of the brush element.
US07719152B2
A rotating shaft is accommodated in a case. A ferromagnetic portion is formed on the rotating shaft, and electromagnets are provided to the case. Many projecting portions are formed so as to be arranged in a direction along which the movement of the rotating shaft is required to be regulated. Furthermore, Many projecting portions are likewise formed on the ferromagnetic portion. According to this construction, magnetic flux occurring in the electromagnets concentrates, so that restoring force occurs in the axial direction with suppressing reduction of the attractive force in a radial direction to the ferromagnetic portion. Therefore, the movement in the axial direction of the rotating shaft can be regulated.
US07719148B2
In a motor stator structure, a neutral-point bus ring is arranged along an inner peripheral portion of a stator, and alternately includes a larger-diameter portion, a first link portion, a smaller-diameter portion, and a second link portion. An end of a wound wire pulled out of a coil is located between radially-extending adjacent first and second link portions. A connecting terminal is connected at one end to the end of the wound wire, and at the other end to the first and second link portions. The use of the neutral-point bus ring ensures that a neutral point can be formed without bending the end of the wound wire of the coil into a U-shape. Particularly when a rectangular cross-section wire difficult to bend is used as the wound wire, the processing cost can be reduced.
US07719147B2
A multi-phase electric motor comprises a stator comprising a plurality of wire coils surrounding a non-magnetizable core; a rotor with permanent magnets embedded therein, the rotor being disposed adjacent to the stator, the rotor being mounted on a rotatable drive shaft; a power source; a position sensor operably connected to the rotor; and a control circuit operably connected to the power source, the position sensor, and the wire coils, for controlling distribution of electrical energy to the wire coils. In this motor the control mechanism transfers electrical charge from a first coil to a second coil.
US07719146B2
A power tool 1 includes a cylindrical-shaped yoke 31, magnets 32 provided in the interior of the yoke 31, an armature 41 disposed rotatably in the interior of the yoke 31, a cooling fan 7 rotatably secured to the armature 41, a fan guide 8 disposed on the periphery of the cooling fan 7, and a cylindrical-shaped housing 2 for storing the yoke 31 therein. The fan guide 8 is contacted with the axial-direction one end face of the yoke 31, and the fan guide 8 is engaged with the yoke 31 in the rotation direction thereof.
US07719144B2
A vertical actuator has a stationary part that includes an upper part made of magnetic material which is magnetically separated from a yoke which bears a coil. The upper magnetic part generates an overall reluctance force on the movable part of the actuator which, over the entire functional range of the actuator, is slightly greater than the gravitational force. When the coil is not energized, the movable part has a position of stable equilibrium which is in the upper section of this functional range.
US07719135B2
There is provided a circuit for managing a multi-level power supply. The circuit includes a comparator that compares a voltage level (Vs1) of a lower voltage supply bus to a voltage level (Vs2) of a higher voltage supply bus, and a switch that routes current from the lower voltage supply bus to the higher voltage supply bus if Vs2
US07719121B2
A microelectronic package includes a microelectronic element having contacts, a flexible substrate spaced from and overlying the microelectronic element and a plurality of conductive posts extending from the flexible substrate and projecting away from the microelectronic element. The conductive posts are electrically interconnected with the microelectronic element. Each conductive post has a conductive base that is in contact with the flexible substrate and a conductive tip that extends from the base, with the base of the conductive post having a larger diameter than the tip of the conductive post. In certain embodiments, the conductive base and the conductive tip have a cylindrical shape.
US07719112B2
An integrated circuit chip comprising a bond wire and a mass of magnetic material provided on the bond wire, wherein the mass of magnetic material increases the inductance of the bond wire.
US07719098B2
The present invention stacks integrated circuits into modules that conserve board surface area. In a precursor assembly devised as a component for a stacked circuit module in accordance with a preferred embodiment of the present invention, one or more stiffeners are disposed at least partially between a flex circuit and an integrated circuit. In a two-high stacked circuit module devised in accordance with a preferred embodiment of the present invention, an integrated circuit is stacked above a precursor assembly. The two integrated circuits are connected with the flex circuit of the precursor assembly. The present invention may be employed to advantage in numerous configurations and combinations of integrated circuits in modules.
US07719097B2
A semiconductor device includes a semiconductor element, a transparent member separated from the semiconductor element by a designated length and facing the semiconductor element, a sealing member sealing an edge surface of the transparent member and an edge part of the semiconductor element, and a shock-absorbing member provided between the edge surface of the transparent member and the sealing member and easing a stress which the transparent member receives from the sealing member or the semiconductor element.
US07719088B2
A high-frequency bipolar transistor includes an emitter contact adjoining an emitter connection region, a base contact adjoining a base connection region, and a collector contact adjoining a collector connection region. A first insulation layer is disposed on the base connection region. The collector connection region contains a buried layer, which connects the collector contact to a collector zone. A silicide or salicide region is provided on the buried layer and connects the collector contact to the collector zone in a low-impedance manner. A second insulation layer is disposed on the collector connection region but not on the silicide region.
US07719075B2
A scanning head for an optical position-measuring system includes a receiver grating, formed of photosensitive areas, for the scanning of locally intensity-modulated light of differing wavelengths. The receiver grating is formed from a semiconductor layer stack of a doped p-layer, an intrinsic i-layer and a doped n-layer. The individual photosensitive areas have a first doped layer and at least a part of the intrinsic layer in common and are electrically separated from one another by interruptions in the second doped layer.
US07719069B2
In one illustrative example, a three terminal magnetic sensor includes a collector region made of a semiconductor material, a base region, and an emitter region. An insulator layer is formed between the collector region and a carrier substrate body which carries the three terminal magnetic sensor. The insulator layer serves to reduce a capacitance otherwise present between the collector region and magnetic media at a magnetic field sensing plane of the three terminal magnetic sensor. Thus, the insulator layer electrically isolates the collector region from the carrier substrate body. The structure may be formed through use of a separation by implanting oxygen (SIMOX) technique or a wafer-bonding technique, as examples.
US07719058B2
A Mixed-Signal Semiconductor Platform Incorporating Castellated-Gate MOSFET device(s) capable of Fully-Depleted operation is disclosed along with a method of making the same. The composite device/technology platform has robust I/O applications and includes a starting semiconductor substrate of a first conductivity type. One or more isolated regions of at least a first conductivity type is separated by trench isolation insulator islands. Within an isolated region designated for castellated-gate MOSFETs there exists a semiconductor body consisting of an upper portion with an upper surface, and a lower portion with a lower surface. Also within the castellated-gate MOSFET region, there exists a source region, a drain region, and a channel-forming region disposed between the source and drain regions, and are all formed within the semiconductor substrate body. The channel-forming region within the isolated castellated-gate MOSFET region is made up of a plurality of thin, spaced, vertically-orientated conductive channel elements that span longitudinally along the device between the source and drain regions. One or more of the trench isolated regions may contain at least one type or polarity of logic and/or memory computing device. Alternately or additionally, one or more type of Logic and/or memory device may be incorporated within vertically displaced regions above the active body region of the semiconductor wafer, embedded within Interlevel Dielectric Layers.
US07719053B2
A semiconductor device comprises a semiconductor region of the first conduction type. A first main electrode is connected to the semiconductor region. A base region of the second conduction type is formed on the semiconductor region. A diffused region of the first conduction type is formed on the base region. A second main electrode is connected to the diffused region and the base region. A first trench is formed extending from a surface of the diffused region to the semiconductor region. A second trench is formed from the first trench deeper than the first trench. A gate electrode is formed on a side of the first trench via a first insulator film. A protruded electrode is formed in the second trench via a second insulator film as protruded lower than the gate electrode.
US07719049B2
The present invention relates to a flash memory device and a fabrication method thereof. A trench may be formed within a junction region between word lines by etching a semiconductor substrate between not only a word line and a select line, but also between adjacent word lines. Accordingly, the occurrence of a program disturbance phenomenon can be prevented as the injection of hot carriers into a program-inhibited cell is minimized in a program operation.
US07719044B2
In one aspect, the invention includes a method of forming a roughened layer of platinum, comprising: a) providing a substrate within a reaction chamber; b) flowing an oxidizing gas into the reaction chamber; c) flowing a platinum precursor into the reaction chamber and depositing platinum from the platinum precursor over the substrate in the presence of the oxidizing gas; and d) maintaining a temperature a within the reaction chamber at from about 0° C. to less than 300° C. during the depositing. In another aspect, the invention includes a platinum-containing material, comprising: a) a substrate; and b) a roughened platinum layer over the substrate, the roughened platinum layer having a continuous surface characterized by columnar pedestals having heights greater than or equal to about one-third of a total thickness of the platinum layer.
US07719040B2
Realized is a solid-state imaging device capable of achieving both a finer pixel size and high light receiving efficiency with an excellent image characteristic. A high concentration p-well layer (5) is partially formed in the interior of a semiconductor substrate (1) centering on a region under a STI (6), and a photoelectric conversion layer (9a, 9b) is formed so as to extend to a region under a gate electrode (10a, 10b). Furthermore, a salicide region (12a, 12b) covers only a portion of a surface of the gate electrode (10a, 10b) and is formed at a position closer to a side at which a drain region (13) is provided. Thus, an incident light is allowed to pass through a portion, included in the surface of the gate electrode (10a, 10b), on which the salicide region (12a, 12b) is not formed, and then to be further incident on the photoelectric conversion layer (9a, 9b) extending to the region under the gate electrode (10a, 10b).
US07719015B2
An LED is provided comprising two or more light-emitting Type II interfaces wherein at least two of the Type II interfaces differ in transition energy by at least 5%, or more typically by at least 10%, and wherein at least one of the Type II interfaces is within a pn junction. Alternately, an LED is provided comprising two or more light-emitting Type II interfaces wherein at least two of the Type II interfaces differ in transition energy by at least 5%, or more typically by at least 10%. The Type II interfaces may include interfaces from a layer which is an electron quantum well and not a hole quantum well, interfaces to a layer which is a hole quantum well and not an electron quantum well; and interfaces that satisfy both conditions simultaneously. The Type II interfaces may be within a pn or pin junction or not within a pn or pin junction. In the later case, emission from the Type II interfaces may be photopumped by a nearby light source. The LED may be a white or near-white light LED. In addition, graphic display devices and illumination devices comprising the semiconductor device according to the present invention are provided.
US07718999B2
An electronic device with a semiconductor layer of (I) wherein X is O or NR′; m represents the number of methylenes; M is a conjugated moiety; R and R′ are selected from the group consisting of at least one of hydrogen, a suitable hydrocarbon, and a suitable hetero-containing group; a represents the number of 3-substituted thiophene units; b represents the number of conjugated moieties, and n represents the number of polymer repeating units.
US07718996B2
A semiconductor device may include a first monocrystalline layer comprising a first material having a first lattice constant. A second monocrystalline layer may include a second material having a second lattice constant different than the first lattice constant. The device may also include a lattice matching layer between the first and second monocrystalline layers and comprising a superlattice. The superlattice may include a plurality of groups of layers, and each group of layers may include a plurality of stacked semiconductor monolayers defining a semiconductor base portion and at least one non-semiconductor monolayer thereon. The at least one non-semiconductor monolayer may be constrained within a crystal lattice of adjacent base semiconductor portions, and at least some semiconductor atoms from opposing base semiconductor portions may be chemically bound together through the at least one non-semiconductor monolayer therebetween.
US07718990B2
An active material electronic device with a containment layer. The device includes an active chalcogenide, pnictide, or phase-change material in electrical communication with an upper and lower electrode. The device includes a containment layer formed over the active material that prevents escape of volatilized matter from the active material when the device is exposed to high temperatures during fabrication or operation. The containment layer further prevents chemical contamination of the active material by protecting it from reactive species in the processing or ambient environment. Once the containment layer is formed, the device may be subjected to high temperature or chemically aggressive environments without impairing the compositional or structural integrity of the active material.
US07718989B2
A memory cell device has a bottom electrode and a top electrode, a plug of memory material in contact with the bottom electrode, and a cup-shaped conductive member having a rim that contacts the top electrode and an opening in the bottom that contacts the memory material. Accordingly, the conductive path in the memory cells passes from the top electrode through the conductive cup-shaped member, and through the plug of phase change material to the bottom electrode. Also, methods for making the memory cell device include steps of forming a bottom electrode island including an insulative element and a stop element over a bottom electrode, forming a separation layer surrounding the island, removing the stop element to form a hole over the insulative element in the separation layer, forming a conductive film in the hole and an insulative liner over conductive film, etching to form a cup-shaped conductive film having a rim and to form an opening through the insulative liner and the bottom of the cup-shaped conductive film to the surface of the bottom electrode, forming a plug of phase change memory material in the opening, and forming a top electrode in contact with the rim of the cup-shaped conductive film.
US07718985B1
Methods, systems, apparatus, devices for tracking, controlling and providing feedback on droplets used in EUV source technology. The method and system track and correct positions of droplet targets and generated plasma including generating the droplet target or plasma, optically imaging the generated target, determining position coordinates, comparing the position coordinates to a set optimal position to determine if a deviation has occurred and moving the generated target back to the optimal position if the deviation has occurred. The optical imaging step includes activating a light source to image the generated target, the light source is strobed at approximately the same rate as the droplet production to provide illumination of the droplet for stroboscopic imaging. The step of moving is accomplished mechanically by moving the generated target back to the predefined position or electronically under computer control.
US07718982B2
Interposing a programmable path length of one or more materials into a particle beam modulates scattering angle and beam range in a predetermined manner to create a predetermined spread out Bragg peak at a predetermined range. Materials can be “low Z” and “high Z” materials that include fluids. A charged particle beam scatterer/range modulator can comprise a fluid reservoir having opposing walls in a particle beam path and a drive to adjust the distance between the walls of the fluid reservoir under control by a programmable controller. A “high Z” and, independently, a “low Z” reservoir, arranged in series, can be used. When used for radiation treatment, the beam can be monitored by measuring beam intensity, and the programmable controller can adjust the distance between the opposing walls of the “high Z” reservoir and, independently, the distance between the opposing walls of the “low Z” reservoir according to a predetermined relationship to integral beam intensity. Beam scattering and modulation can be done continuously and dynamically during a treatment in order to deposit dose in a target volume in a predetermined three dimensional distribution.
US07718980B2
A beam processing system is for causing a particle beam extracted from a beam generating source to pass through a mass analysis magnet device, a mass analysis slit, and a deflection scanner in the order named, thereby irradiating the particle beam onto a processing object. The mass analysis slit is installed between the mass analysis magnet device and the deflection scanner at a position where the particle beam having passed through the mass analysis magnet device converges most in a lateral direction. A first DC quadrupole electromagnet and a second DC quadrupole electromagnet are installed on an upstream side and a downstream side of the mass analysis slit, respectively.
US07718978B2
An ion source is provided that can generate an ion beam in which the width is wide, the beam current is large, and the uniformity of the beam current distribution in the width direction is high, and that can prolong the lifetime of a cathode. The ion source 2a has: a plasma generating chamber 6 having an ion extraction port 8 extending in the X direction; a magnet 14 which generates a magnetic field 16 extending along the X direction, in the plasma generating chamber 6; indirectly-heated cathodes 20 which are placed respectively on the both sides of the plasma generating chamber 6 in the X direction, and which are used for generating a plasma i0 in the chamber 6, and increasing or decreasing the density of the whole of the plasma 10; and plural filament cathodes 32 which are juxtaposed in the X direction in the plasma generating chamber 6, and which are used for generating the plasma i0 in the chamber 6, and controlling the density distribution of the plasma 10.
US07718974B2
An x-ray converter element has an x-ray-permeable and moisture-impermeable substrate, an x-ray-permeable carrier that is connected to the substrate, and a scintillator that is applied on the substrate, and an optically-transparent and moisture-impermeable protective layer that covers the scintillator.
US07718968B1
A detector assembly for imaging a scene over a predetermined temperature range and a predetermined wavelength range including a central wavelength includes an imaging-sensor array, a plurality of focusing elements and a plurality of optical filtering elements. The imaging-sensor array includes a plurality of detector-array sections and the focusing elements are arranged with respect to the detector array such that each focusing element is capable of focusing upon a corresponding one of the detector-array sections an image of the scene correlating to the image of the scene that each of the other focusing elements is capable of focusing upon the detector-array section corresponding thereto. Each focusing element and the detector-array section corresponding thereto defines an associated optical path. Disposed within each optical path is an optical filtering element such that electromagnetic energy that passes through that filtering element impinges upon the detector-array section optically correlated with that filtering element. Each filtering element is configured to transmit, at a filter-specific maximum intensity, the central wavelength at a temperature disparate from the temperature at which each of the other filtering elements is configured to transmit the central wavelength. The transmittance as a function of temperature for each filtering element at least partially overlaps the transmittance as a function of temperature of at least one other filtering element among the plurality of filtering elements, thereby extending the operative temperature range of the detector assembly.
US07718966B2
An infrared solid state imaging device includes a pixel area with arranged infrared detection pixels and a integration circuit for modulating output current based on the output of the pixel. The integration circuit contains an integrating transistor that modulates a current based on the difference in potential between first and second constant current devices, a integration capacitor for storing the modulated current and being reset periodically, a bias current supply transistor, a switch for connecting the drain with the gate of the bias current supply transistor, a capacitor providing AC coupling between the output of the integrating transistor and the integrating capacitor, a gate bias switch for providing the integrating transistor with a bias voltage, a switch for selecting, as input to the integrating transistor, either one of outputs from the first and second constant current devices, and a capacitor for providing AC coupling between the switch and the gate of the integrating transistor.
US07718964B2
A high time-resolution ultrasensitive optical detector, using a planar waveguide leakage mode, and methods for making the detector. The detector includes a stacking with a dielectric substrate, a detection element, first and second dielectric layers, and a dielectric superstrate configured to send photon(s) into the light guide formed by the first layer. The thicknesses of the layers is chosen to enable a resonant coupling between the photon(s) and a leakage mode of the guide, the stacking having an absorption resonance linked to the leakage mode for a given polarization of the photon(s).
US07718963B2
A radiation sensor and a method for making the radiation sensor are described. An ionizing radiation sensitive area is formed in a radiation insensitive or hardened die. When the sensitive area is impacted by ionizing radiation, properties of the sensitive area change. For example, the changed property may be charge density, threshold voltage, leakage current, and/or resistance. Circuitry for measuring these property changes is located in a radiation hardened area of the die. As a result, a radiation sensor may be fabricated on a single die.
US07718958B2
A mass spectroscopic reaction-monitoring method including: forcing charge-laden liquid drops to move along a traveling path; exposing to a laser beam a region to be formed of a liquid sample surface, the laser beam having an irradiation energy sufficient to cause analytes present behind the liquid sample surface to be desorbed to fly along a flying path; introducing to the region at successive points of time a liquid sample containing one reactant that undergoes an ongoing chemical reaction as a first analyte to form one product as a second analyte; and positioning the liquid sample surface relative to the laser beam at each point of time such that the flying path intersects the traveling path for enabling occlusion of at least one of the first and second analytes in at least one charge-laden liquid drop to thereby form at least a corresponding one of first and second ionized analytes.
US07718956B2
Elemental analysis of an earth formation is obtained using measurements from a gamma ray logging tool. From the elemental analysis, an estimate of the carbon content and the sulfur, vanadium, nickel, titanium and/or molybdenum content of the formation is determined. A table look-up is used to estimate the viscosity from the elemental composition.
US07718955B2
A method for correcting data collected with a neutron emitting instrument, includes: obtaining characterization data for the instrument, the characterization data including inelastic background data of the instrument; and correcting the collected data according to the characterization data. A computer program product and an instrument are provided.
US07718943B2
The present invention provides various improvements in components for optical based moisture sensing systems and to moisture sensing systems incorporating the components. In at least one embodiment an imager sensor based moisture sensing system is provided that is capable of detecting a moisture pattern.
US07718938B2
A spatial information detection system, which is capable of, even when detecting spatial information from a common target space by use of a plurality of detection devices, achieving accurate detection without causing interference between the detection devices. Each of the detection devices has a light emitting source for projecting light intensity-modulated with a modulation period into the target space, a photodetector for receiving light from the target space, and an evaluation portion for detecting the spatial information of the target space from a change between the light projected from the light emitting source and the light received by the photodetector. The system includes a timing control portion for controlling the timings of projecting the lights from the light emitting sources such that a light projection period of the light emitting source of one of the detection devices does not overlap with the light projection period of the light emitting source of another detection device.
US07718931B2
An electric heater (10) incorporates at least one heating element (20), at least one wall member (16) upstanding in the heater, and a device (42) is provided for detecting a cooking utensil (6) supported on an upper surface (4) of a cooking plate (2) overlying the heater. The device (42) includes at least one inductively-operating loop (44) of electrically conductive material having a plurality of portions (50, 52, 54) adapted to extend over and spaced from the at least one electric heating element (20) between fixed supporting regions (56, 58, 60, 62) on the at least one wall member (16). The at least one loop (44) of electrically conductive material is such that the plurality of portions (50, 52, 54) are substantially incapable of self-support as such at normal operating temperatures of the electric heater. The plurality of portions (50, 52, 54) are supported by elongate members (64, 66, 68) of heat-withstanding material.
US07718926B2
In order to detect a change in the temperature of a substrate (2) and a change of the distribution of oxygen radical concentration near a surface of the substrate (2), a lamp power in each zone of a heater (3) and a pressure in a reactor (1) are measured, the measured lamp power in each zone of the heater (3) and the measured pressure in the reactor (1) are inputted to the prediction equation of process model of a monitoring device (16)to predict the thickness profile of the substrate (2), and it is decided whether an abnormality occurs in thermal processing on the substrate (2) based on the predicted thickness profile.
US07718923B1
A sunshade for an automobile placed upon a dashboard in the interior of the vehicle provides a reflective outer surface to deflect heat and sunlight through the windshield into a vehicle during hot weather conditions and also provides the outer surface with heat strip elements when enabled during cold weather to provide a radiant heat to the windshield to prevent ice build-up on the windshield maintaining a clear windshield during freezing temperatures, the heat strip elements drawings a low voltage current from a rechargeable battery supply or a 12 volt DC power from a cigarette lighter plug, or both.
US07718918B2
A production line method of resistance welding comprising the steps of contacting a metal sheet with an electrode having an initial contact surface area at a force to provide a pressure to the metal sheet; applying a current though the electrode to the metal sheet; measuring dimensional changes of the electrode; correlating dimensional changes in the electrode to changes in the initial contact surface area; and adjusting the force to compensate for the changes in the initial contact surface area of the electrode to maintain pressure to the metal sheet. The force may be adjusted by stepping the force to maintain pressure to the faying surface of the metal sheet to be welded. By maintaining the pressure at the faying surface the life cycle of the electrodes may be increased without forming discrepant welds.
US07718915B2
A shielding gas for MAG welding wherein a carbon steel solid wire is used for lap fillet welding of a galvanized steel sheet; wherein the shielding gas is a mixed gas composition consisting of 8 to 15% by volume of oxygen, 20 to 30% by volume of carbon dioxide, and residual % by volume of argon.
US07718914B2
A method of gas-shielded metal arc joining using a consumable electrode having an alternating polarity (GMA-AC). A shielding gas containing argon is used to improve process stability and working speed.
US07718913B2
An alternator disconnector circuit-breaker of the invention includes a cylindrical cam (40) for optimizing the sequence for opening/closing the switch-over first switch (10), the circuit-breaker second switch (20), and the disconnector third switch (30). The cam (40) has a cylindrical wall in which three slots (42), and preferably three pairs of slots, of different shapes, are defined; an end element of an element driving a respective one of the switch contacts is mounted to slide in each slot.
US07718910B2
A movable contact assembly includes a movable contact having a dome shape, a base sheet contacting an upper surface of the movable contact, a columnar portion provided on an upper surface of the base sheet, and a light guide sheet provided on an upper surface of the columnar portion. The light guide sheet has a light-receiving surface for introducing light into the light guide sheet, and allows the introduced light to be emitted from an upper surface of the light guide sheet. The base sheet includes a dome portion having a concave lower surface, and a flat portion connected with an outer edge of the dome portion. The columnar portion is positioned on the upper surface of the dome portion away from the outer edge of the dome portion of the base sheet. This movable contact assembly provides a switch illuminating its upper surface and being activated easily with a preferable feeling.
US07718905B2
An electronic device has housing having plural inner surfaces, plural modules in the housing, and a communication section provided on each of the plural modules. The communication sections perform wireless communication to each other. One inner surface having the largest area among the plural inner surfaces of the housing has an electric wave absorber that absorbs an electric wave for use of the wireless communication.
US07718899B2
The invention relates to a high pressure, high voltage penetrator assembly for subsea use, wherein the assembly is upright attachable to a wet gas, subsea gas compressor, and wherein the assembly includes a penetrator unit for feed-through of electric power to a compressor motor; a funnel shaped housing with a housing chamber, the penetrator unit being located at an upper end of the chamber; a grid located inside the chamber transversely of a longitudinal axis of the chamber, the penetrator unit being located above the grid, a filter located in the chamber below the grid and above an inlet to a housing of the compressor motor, and a sensor unit extending into the chamber from the penetrator unit and towards, but spaced from the grid.
US07718896B1
In communication cable of high capacity according to present invention, conductor of diameter d is coated by insulation material to form wire of diameter D, plural number of said wire are twisted by pitch p to form pairs, plural number of said pairs are twisted by collective pitch P, and said communication cable of high capacity comprise sheath wrapping said pairs, and the diameter d of said conductor and diameter D of said wire and pitch p and collective pitch P and impedance of said wires are defined by function of compensation coefficient A (81
US07718892B2
A housing unit for securing electronics of a control module to a vehicle may include a housing and at least two connection members. The connection members connected to the housing may be adapted to engage an adaptor member (e.g., bracket) configured to be secured to a vehicle. The connection members may include at least one connection member configured to hook into the adaptor member and at least one connection member configured to snap into the adaptor member. Protrusion(s) may be included on the connection member(s) and be configured to contact the adaptor member to substantially eliminate transverse movement of the housing. The protrusion(s) may be crush-rib(s). The housing may include features to position, support, and minimize vibration of the electronics, where the electronics maybe disposed on a printed circuit board (PCB).
US07718877B2
The invention relates to a device for setting skin tension, in particular for use in a musical instrument such as a kettledrum. The device comprises a tensioning star provided with an engaging element for engaging an operating mechanism for adjusting the tensioning star in an axial adjusting direction, substantially parallel to a central axis of the tensioning star. The tensioning star is also provided with a plurality of arms extending substantially in radial directions of which at least a part is provided with a coupling element for coupling to a tensioning rod construction attachable to the skin. In addition, the device comprises an adjusting device for adjusting the distance between a coupling element and the central axis of the tensioning star.
US07718870B1
According to the invention, there is provided seed and plants of the hybrid corn variety designated CH771816. The invention thus relates to the plants, seeds and tissue cultures of the variety CH771816, and to methods for producing a corn plant produced by crossing a corn plant of variety CH771816 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH771816.
US07718859B2
According to the invention, there is provided seed and plants of the corn variety designated CV391950. The invention thus relates to the plants, seeds and tissue cultures of the variety CV391950, and to methods for producing a corn plant produced by crossing a corn plant of variety CV391950 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV391950 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV391950.
US07718854B2
The invention relates to the novel cotton variety designated 04T042. Provided by the invention are the seeds, plants, plant parts and derivatives of the cotton variety 04T042. Also provided by the invention are tissue cultures of the cotton variety 04T042 and the plants regenerated therefrom. Still further provided by the invention are methods for producing cotton plants by crossing the cotton variety 04T042 with itself or another cotton variety and plants produced by such methods.
US07718850B2
The invention relates to methods and compositions for modulating properties of fruit dehiscence in plants such Brassicaceae plants, specifically to improved methods and means for reducing seed shattering in Brassicaceae plants, particularly the Brassicaceae plants grown for oil production, to a degree which is agronomically important.
US07718842B2
The invention concerns a process for separating meta-xylene from a hydrocarbon feed comprising isomers containing 8 carbon atoms, comprising: a step for bringing said feed into contact with a faujasite type zeolite adsorbant, the percentage of water in the adsorbant being in the range 0 to 8% by weight and the adsorption temperature being from 25° C. to 250° C.; a desorption step employing a solvent selected from tetraline and its alkylated derivatives; a step for separating meta-xylene from the desorbant.
US07718836B2
The present invention relates to an integrated process for the production of high purity 2,6-dimethylnaphthalene starting from hydrocarbon mixtures containing naphthalene and/or isomers of methylnaphthalene and/or isomers of dimethylnaphthalene and/or isomers of polymethylnaphthalene, and from an alkylating agent, preferably methanol, reacted in the presence of a methylated benzene solvent or mixture of various methylated benzene solvents, preferably selected from toluene, xylene and trimethylbenzene, and a catalyst consisting of ZSM-12 zeolite and an inorganic ligand.
US07718835B2
Disclosed herein is a process of producing high purity and high yield dimethylnaphthalene by dehydrogenating a dimethyltetralin isomer using a metal catalyst for dehydrogenation. The metal catalyst contains a carrier selected from alumina (Al2O3), silica (SiO2), a silica-alumina mixture and zeolite. The metal catalyst also contains 0.05 to 2.5% by weight of platinum (Pt), 0.1 to 3.0% by weight of tin (Sn) or indium (In), 0.5 to 15.0% by weight of at least one selected from the group consisting of potassium (K), magnesium (Mg) and cesium (Cs), 0.3 to 3.0% by weight of chlorine, and 0.01 to 3.0 % by weight of zinc (Zn) or gallium (Ga) as active components based on an element weight of the final catalyst.
US07718834B2
A method for preparing linear long chain fatty alcohols having 20 to 40 carbon atoms by a growth reaction of ethylene on aluminum compounds.
US07718833B2
Methods for purifying glycerin contaminated with one or more lower boiling alcohols such as methanol, ethanol, straight, branched or cyclic C3-C6 alcohols, and the like. The methods are particularly useful for purifying crude glycerin phases recovered from the synthesis of biofuels. The present invention uses distillation techniques to strip alcohol contaminants from glycerin. In contrast to conventional methods that carry out distillation either under substantially anhydrous or very wet conditions, the present invention carries out distillation in the presence of a limited amount of water, e.g., from about 0.8 to about 5 parts by weight of water per 100 parts by weight of contaminated glycerin to be purified.
US07718825B2
A process for converting an arylamine into an arylamine derivative, includes (i) providing a first arylamine compound; (ii) formylating the first arylamine compound to form a formyl substituted arylamine compound, where the first arylamine compound is not a formyl substituted arylamine compound; and (iii) acidifying the formyl substituted arylamine compound, in the presence of a solvent and a solid organic catalyst, to convert formyl functional groups into acid functional groups to form an acidified compound.
US07718823B2
This invention relates to toluate ester compositions and their use as solvent, plasticizers, extender and/or diluents in binder formulations, a method of producing such ester compositions, as well as polymer compositions containing such liquid ester compositions. The method of making toluate based esters by reacting methyl-p-toluate with ethylene glycol, diethylene or triethylene glycol, butanediol, etc. More particularly, this invention relates to the mono- or di-ester of methyl toluic acid with a diol containing 2 to 6 carbon atoms that are low viscosity liquids at 25° C. The most common polymer that employs plasticizer is polyvinyl chloride (PVC). Typical amounts of plasticizer in PVC are from about 3 wt. % to about 50 wt. %. Phenolic resins generally require solvents, diluents and/or extenders that reduce the volatility and viscosity of the resin, especially when it is used in building and automotive products. Typical amounts of solvent are from about 5 wt. % to about 65 wt. %.
US07718822B2
The compound of formula (I) is a water-stable, long acting β2-selective adrenoceptor agonist useful as a bronchodilator in the treatment of bronchoconstriction associated with reversible obstructive airways diseases and the like.
US07718821B1
This invention relates to a process for producing electron deficient olefins, such as 2-cyanoacrylates, using an iminium salt.
US07718812B2
The invention relates to a process for the conversion of group X in a 2-(6-substituted)-1,3-dioxane-4yl) acetic acid derivative according to formula 2 into a group OY in the presence of a phase transfer catalyst and an oxylating agent, by using as a phase transfer catalyst a quarternary phosphonium ion and by using as an oxylating agent an OY-ion. X stands for a halogen and R1, R2 and R3 are each independently a C1–4 alkylgroup or R1 and R2 together with the C-atom to which they are bound form a 5- or 6-membered cycloalkyl; Y stands for RA-CO— or for RB—SO2- with RA, RB are chosen from the group of alkyl or aryl with 1–12 C-atoms.
US07718789B2
Novel isolated plant polynucleotide promoter sequences are provided, together with genetic constructs comprising such polynucleotides. Methods for using such constructs in modulating the transcription of DNA sequences of interest are also disclosed, together with transgenic plants comprising such constructs.
US07718786B2
Ligation-mediated method of recombining polynucleotides in vitro. Polynucleotides from a library are fragmented and the fragments are hybridized to an assembly template. The hybridized fragments are iteratively re-hybridized and ligated until the ends of the hybridized fragments are adjacent to the ends of other hybridized fragments on the assembly template. A final ligation produces recombined polynucleotides.
US07718784B2
In one embodiment, the present invention relates to fluorescent nucleic acid constructs and methods of using these switchable constructs to rapidly screen for target molecule interactions. More particularly, an RNA/DNA chimera comprising a fluorophore-quencher pair and a nucleic acid construct is disclosed for the rapid screening of interactions between the HIV-1 nucleocapsid protein, NCp7, and a stem-loop region, SL3, of the HIV-1 RNA, or antagonists thereof. The compositions and methods disclosed herein can be used in preferred aspects of the present invention for diagnosing disease states, distinguishing the presence of infectious or toxic agents, drug discovery and design, and molecular electronic applications.
US07718781B2
The present invention provides hydroxypyridinone and hydroxypyrimidone chelating agents. Also provides are Gd(III) complexes of these agents, which are useful as contrast enhancing agents for magnetic resonance imaging. The invention also provides methods of preparing the compounds of the invention, as well as methods of using the compounds in magnetic resonance imaging applications.
US07718776B2
Monoclonal antibodies and hybridomas producing them that interact with osteoprotegerin ligand (OPGL) are provided. Methods of treating osteopenic disorders by administering a pharmaceutically effective amount of antibodies to OPGL are also provided. Methods of detecting the amount of OPGL in a sample using antibodies to OPGL are further provided.
US07718752B2
A process for producing a resorcinol-formalin resin containing no salts, having a moderate flowability when transformed into an aqueous solution, and having a reduced content of resorcinol monomer and a reduced content of resorcinol-formalin resin of resorcinol pentanuclear or higher nuclear bodies, the whole steps including an one-stage reaction and liquid-liquid distribution being conducted in the same reactor, which comprises adding resorcinol, an inorganic salt, and an organic solvent having a solubility parameter of 7.0 to 12.5 to a water solvent, stirring the mixture to give a two-phase system containing no remaining solid matter, adding an acid catalyst, adding formalin dropwise into the reaction system to cause a liquid-liquid heterogeneous reaction to proceed, removing the aqueous layer, adding an organic solvent and water to the reaction product layer, the amount of the water being half of the amount of the organic solvent, stirring the resulting mixture, allowing it to stand, and then removing the aqueous layer to obtain the resorcinol-formalin resin.
US07718751B2
The present invention concerns a pre-mix for a syntactic phenolic foam composition; a syntactic phenolic foam composition; and a process for preparing the syntactic phenolic foam composition.The pre-mix comprises thermally expandable and/or expanded thermoplastic microspheres, the microspheres comprising a thermoplastic polymer shell made of a homopolymer or copolymer of 100 to 25, for example 93 to 40, parts by weight of a nitrile-containing, ethylenically unsaturated monomer, or a mixture thereof; and 0 to 75, for example 7 to 60, parts by weight of a non-nitrile-containing, ethylenically unsaturated monomer, or a mixture thereof; and a propellant, or a mixture thereof, trapped within the thermoplastic polymer shell; and one of either a highly reactive phenolic resole resin capable of fully crosslinking at temperatures between 15° C. and 60° C., optionally in the presence of up to ten times its own weight in water, and having, typically, a free phenol content of 12-15% (w/w); or an acidic catalyst for curing the phenolic resole resin.The process comprises either curing the above-mentioned pre-mix in the presence of the other of the acidic catalyst; and the highly reactive phenolic resole resin, as defined above or, alternatively, curing all three components, together with any other components.
US07718750B2
The present invention is directed to organo-silicone compound that have alkoxylated allyl alcohol groups of different degree of ethylene oxide and or propylene oxide present on two or more different groups. It is also directed to the use of that compound in personal care and other applications. These compounds by virtue of their unique structure provide outstanding emulsions including microemulsions.
US07718730B2
A two-component adhesive, sealant, or coating composition containing (i) a first component containing a portion of an alkoxysilane-functional urethane and water; and (ii) a second component containing the remaining portion of the alkoxysilane-functional urethane and a catalyst. The alkoxysilane-functional urethane includes the reaction product of (a) the reaction product of a hydroxy functional compound and a polyisocyanate, that contains isocyanate groups; with (b) an amine functional aspartate. The composition is used in a method of bonding a first substrate to a second substrate. The method includes (a) combining component i) and component ii) to form a mixture, applying a coating of the mixture to at least one surface of the first substrate or the second substrate, and contacting a surface of the first substrate with a surface of the second substrate. The method is used make an assembly.
US07718728B2
This invention relates to a rubber composition having a high interaction between rubber component and carbon black, a good wear resistance and an excellent low heat buildup (low hysteresis loss), and more particularly to a rubber composition comprising (A) 100 parts by mass of a rubber component containing not less than 10% by mass of a conjugated diene polymer having a polymer chain with at least one functional group selected from the group consisting of particular substituted amino group and cyclic amino group, (B) not less than 20 parts by mass of carbon black and (C) not more than 1.0 part by mass of a polycyclic aromatic compound (PCA).
US07718727B2
Fluoroplastics containing fluorocarbon resins and silicones are prepared by first mixing a fluorocarbon resin with a compatibilizer, then adding a curable organopolysiloxane with a radical initiator, and vulcanizing the organopolysiloxane in the mixture. The fluoroplastics can be processed by various techniques, such as extrusion, vacuum forming, injection molding, blow molding or compression molding, to fabricate plastic parts. The resulting fabricated parts can be re-processed (recycled) with little or no degradation of mechanical properties.
US07718719B2
A method of stabilizing a normally solid polyalkylene carbonate resin against thermal and hydrolytic decomposition, including the step of adding a cyclic amine selected from the group consisting of imidazole and 2-ethyl 4-methylimidazole at a wt. % of 5 to 45% of the normally solid polycarbonate resin. And, a method of producing tough coatings with excellent adhesion to both ferrous and non-ferrous metals, including the steps of: a) dissolving polyalkylene carbonate resin and a cyclic amine selected from the group of consisting of imidazole and 2-ethyl 4-methylimidazole at a wt. % of 5 to 45% of the normally solid polycarbonate resin in a solvent selected from the group consisting of methyl ethyl ketone and propylene glycol mono methyl ether acetate by mechanical mixing so as to form a solution; b) coating the ferrous or non-ferrous metals with the solution so as to form a coated metal; c) air drying the coated metal to evaporate the solvent so as to form an air-dried coated metal; and, d) curing the air-dried coated metal for a time selected from the group consisting of at least 12 hours at ambient temperature and 15 minutes at 150° C.
US07718714B2
An actinic energy ray-curable resin is obtained by reacting an unsaturated monocarboxylic acid (c) with a terminal epoxy group of an epoxy resin having an unsaturated group and a hydroxyl group in its side chains and an epoxy group in its terminal and further reacting a polybasic acid anhydride (d) with the hydroxyl group of the above-mentioned epoxy resin, wherein the above-mentioned epoxy resin is a product of the polyaddition reaction of a reaction product (I) of a polybasic acid anhydride (a) and a compound (b) having at least one unsaturated double bond and one alcoholic hydroxyl group in its molecule, a compound (II) having at least two carboxyl groups in its molecule, and a bifunctional epoxy compound (III), wherein at least either one of the carboxyl group-containing compound (II) and the bifunctional epoxy compound (III) is a compound containing no aromatic ring. A photocurable and thermosetting resin composition comprising this actinic energy ray-curable resin, a photopolymerization initiator, a diluent, and a cyclic ether compound is useful as a solder resist for a printed circuit board, interlaminar insulating materials for a multi-layer printed circuit board, and the like.
US07718709B2
A fat or oil composition comprising a polyvalent unsaturated fatty acid component and an emulsifying agent having an HLB of 4 or less, wherein the amount of the emulsifying agent having an HLB of 4 or less is from 25 to 300 parts by weight, based on 100 parts by weight of the polyvalent unsaturated fatty acid component. The fat or oil composition can be used as an oil-in-water droplet emulsion composition. The fat or oil composition and the oil-in-water droplet emulsion composition can be used for foodstuff and the like.
US07718698B2
The invention relates to a process for decreasing the amount of environmental pollutants in a mixture comprising a fat or an oil, being edible or for use in cosmetics, the fat or oil containing the environmental pollutants, which process comprises the steps of adding a volatile working fluid to the mixture, where the volatile working fluid comprises at least one of a fatty acid ester, a fatty acid amid, a free fatty acid and a hydro-carbon, and subjecting the mixture with the added volatile working fluid to at least one stripping processing step, in which an amount of environmental pollutant present in the fat or oil, being edible or for use in cosmetics, is separated from the mixture together with the volatile working fluid. The present invention also relates to a volatile environmental pollutants decreasing working fluid, for use in decreasing an amount of environmental pollutants present in a fat or oil, being edible or for use in cosmetics. In addition, the present invention relates to a health supplement, a pharmaceutical and an animal feed product prepared according to the process mentioned above.
US07718688B2
The present invention relates generally to nitro-1,2-dihydro-3H-benzo[e]indoles and related analogues, to their preparation, and to their use as hypoxia-selective drugs and radiosensitizers for cancer therapy, both alone or in combination with radiation and/or other anticancer drugs.
US07718687B2
The present invention relates to prodrugs of dihydropyrazole compounds that are useful for treating cellular proliferative diseases, for treating disorders associated with KSP kinesin activity, and for inhibiting KSP kinesin. The invention also related to compositions which comprise these compounds, and methods of using them to treat cancer in mammals.
US07718685B2
The present invention relates to 4,5-bis(4-methoxyphenyl)imidazole compound inducing differentiation of myoblasts or muscle fibers into neuron cells and a pharmaceutical composition including said compound. More specifically, it relates to 2-(2-fluorenyl)-4,5-bis(4-methoxyphenyl)imidazole that induces differentiation of myoblasts or muscle fibers, all pharmaceutically acceptable isomers, salts, hydrates, solvates and prodrug thereof, and a pharmaceutical composition including said compound.
US07718683B2
Compounds are provided that act as potent antagonists of the CCR2 or CCR9 receptor. Animal testing demonstrates that these compounds are useful for treating inflammation, a hallmark disease for CCR2 and CCR9. The compounds are generally aryl sulfonamide derivatives and are useful in pharmaceutical compositions, methods for the treatment of CCR2-mediated diseases, CCR9-mediated diseases, as controls in assays for the identification of CCR2 antagonists and as controls in assays for the identification of CCR9 antagonists.
US07718682B2
Novel diphenylethylene compounds and derivatives thereof containing thiazolidinedione or oxazolidinedione moieties are provided which are effective in lowering blood glucose level, serum insulin, triglyceride and free fatty acid levels in animal models of Type II diabetes. The compounds are disclosed as useful for a variety of treatments including the treatment of inflammation, inflammatory and immunological diseases, insulin resistance, hyperlipidemia, coronary artery disease, cancer and multiple sclerosis.
US07718678B2
Disclosed are compounds of the formula and the pharmaceutically acceptable salts thereof. X is N or N+O−, and Y is N or N+O−, provided that at least X or Y is N. The compounds are useful for the treatment of chemokine-mediated diseases such as COPD.
US07718676B2
The present invention relates to novel compounds selected from 2-aminoaryloxazoles of formula I that selectively modulate, regulate, and/or inhibit signal transduction mediated by certain native and/or mutant tyrosine kinases implicated in a variety of human and animal diseases such as cell proliferative, metabolic, allergic, and degenerative disorders. More particularly, these compounds are potent and selective c-kit, bcr-abl, FGFR3 and/or Flt-3 inhibitors.
US07718675B2
The application relates to novel amino alcohols of the general formula (I) where R, R1, R2, R3, R4, R5 and R6 each have the definitions illustrated in detail in the description, to a process for their preparation, and to the use of these compounds as medicines, in particular as renin inhibitors.
US07718669B2
The invention relates to triazolopyridine derivatives of general formula (I), which are defined as cited in the description, to their pharmaceutically applicable salts and to their use as medicaments.
US07718664B2
A method of inhibiting or reducing occurrence or intensity of pruritus including administering to a patient an effective amount of one or more of the morphinan derivative having a nitrogen-containing cyclic group of the Formula (Ia): wherein R1 is cyclopropylmethyl; R2 and R3 are independently hydrogen, hydroxy, C1-C5 alkoxy, C3-C7 alkenyloxy, C7-C13 aralkyloxy or C1-C5 alkanoyloxy; and the Formula (Ia) includes (+), (−) and (±) isomers or the pharmaceutically acceptable acid addition salt thereof.
US07718663B2
An object of the present invention is to provide an antipruritic agent having a novel action mechanism.The present invention provides an antipruritic agent comprising a compound represented by the following general formula (1): wherein R1 represents a hydrogen atom or alkyl; the ring Q represents a cyclohexylene group or a phenylene group; A1 and A2 represent a single bond or an alkylene group; E represents —NHCO—; A3 represents a single bond or a divalent saturated or unsaturated aliphatic hydrocarbon group; R3 represents a non-cyclic aliphatic hydrocarbon group; and R4 and R5 are the same or different and each represents a hydrogen atom or alkyl, or a pharmaceutically acceptable salt thereof as an active ingredient.
US07718659B2
The invention is concerned with novel heteroarylacetamides of formula (I) Rd—C(O)—N(Re)—Rc—CH2—C(O)—N(Ra)(Rb) (I) wherein Ra to Re are as defined in the description and in the claims, as well as physiologically acceptable salts thereof. These compounds inhibit the coagulation factor Xa and can be used as medicaments.
US07718655B2
Trisubstituted triazines can be synthesized from cyanuric chloride. These compounds are useful anti-tubulin agents for treating cancer and proliferative diseases.
US07718652B2
The present invention is directed to substituted benzothiadiazinedioxide derivatives of formula I: or a pharmaceutically acceptable salt, stereoisomer or tautomer thereof, which are monoamine reuptake inhibitors, compositions containing these derivatives, and methods of their use for the prevention and treatment of conditions, including, inter alia, vasomotor symptoms, sexual dysfunction, gastrointestinal disorders and genitourinary disorder, depression disorders, endogenous behavioral disorders, cognitive disorders, diabetic neuropathy, pain, and other diseases or disorders.
US07718647B2
The present invention generally relates to a series of compounds, to pharmaceutical compositions containing the compounds, and to use of the compounds and compositions as therapeutic agents. More specifically, compounds of the present invention are hexahydroazepinoindole and octahydroazepinoindole compounds. These compounds are serotonin receptor (5-HT) ligands and are useful for treating diseases, disorders, and conditions wherein modulation of the activity of serotonin receptors (5-HT) is desired (e.g. anxiety, depression and obesity).
US07718638B2
This invention discloses (20R)-23,23-difluoro-2-methylene-19-nor-bishomopregnacalciferol-vitamin D analogs, and specifically (20R)-23,23-difluoro-1α-hydroxy-2-methylene-19-nor-bishomopregnacalciferol, and pharmaceutical uses therefor. This compound exhibits pronounced activity in arresting the proliferation of undifferentiated cells and inducing their differentiation to the monocyte thus evidencing use as an anti-cancer agent and for the treatment of skin diseases such as psoriasis as well as skin conditions such as wrinkles, slack skin, dry skin and insufficient sebum secretion. This compound also has little, if any, calcemic activity and therefore may be used to treat autoimmune disorders or inflammatory diseases in humans as well as renal osteodystrophy. This compound may also be used for the treatment or prevention of obesity.
US07718637B2
This invention discloses (20S)-23,23-difluoro-2-methylene-19-nor-bishomopregnacalciferol-vitamin D analogs, and specifically (20S)-23,23-difluoro-1α-hydroxy-2-methylene-19-nor-bishomopregnacalciferol, and pharmaceutical uses therefor. This compound exhibits pronounced activity in arresting the proliferation of undifferentiated cells and inducing their differentiation to the monocyte thus evidencing use as an anti-cancer agent and for the treatment of skin diseases such as psoriasis as well as skin conditions such as wrinkles, slack skin, dry skin and insufficient sebum secretion. This compound also has little, if any, calcemic activity and therefore may be used to treat autoimmune disorders or inflammatory diseases in humans as well as renal osteodystrophy. This compound may also be used for the treatment or prevention of obesity.
US07718636B2
This invention provides pharmaceutical uses for 2-methylene-19-nor-20(S)-1α,25-dihydroxyvitamin D3. Administration of this compound increases the life expectancy of human beings, especially elderly human beings. In particular, it increases the survival rate of females lacking estrogen, especially post-menopausal females, and reduces mortality resulting from spontaneous development of malignant tumors in both males and females.
US07718631B2
The present invention provides three BCAS2 related nucleotide sequences. The present invention also provides a composition comprising a nucleotide sequence of small interfering RNA of BCAS2 gene. The present invention further provides a method for treating p53 containing cancer comprising administrating a subject with an effective amount of the said composition.
US07718630B2
Delta protein expression in a cell is reduced by introducing miR-1 into the cell, and detecting a resultant reduction of Delta protein expression in the cell.
US07718626B2
A method of repressing a cell-cycle gene, which is regulated by an E2F transcription factor, in a cell, wherein the method comprises contacting the cell with a cell-cycle gene-repressing amount of ErbB3 binding protein (Ebp1); a method of inhibiting prostate cancer in a mammal, wherein the method comprises administering to the mammal a prostate cancer-inhibiting amount of Ebp1; a composition comprising an Ebp1-expressing viral vector that expresses a cell-cycle gene-repressing amount of Ebp1; and a composition comprising polymer-packaged DNA comprising and expressing a cell-cycle gene-repressing amount of Ebp1.
US07718623B2
An immunostimulatory oligonucleotide that is represented by the general formula 5′-Gm-GACGATCGTC-Gn-3′ or 5′-Gm-CACGATCGTG-Gn-3′ (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: GGACGATCGTCGGGGGGGGG (SEQ. ID. NO.: 1), GGGACGATCGTCGGGGGGGG (SEQ. ID. NO.: 2), GGGGACGATCGTCGGGGGGG (SEQ. ID. NO.: 3), GGGGGGGACGATCGTCGGGG (SEQ ID NO: 4), GGGGGGGGACGATCGTCGGG (SEQ. ID. NO.: 5), GGGGGGGGGACGATCGTCGG (SEQ. ID. NO.: 6), GGGGGGGGGGACGATCGTCG (SEQ. ID. NO.: 7), and GGGGGGGGGCACGATCGTGG (SEQ. ID. NO.: 8).
US07718613B2
This invention relates to peptides useful for releasing active agent in the fields of diagnostics and drug delivery.
US07718610B2
Retrocyclin peptides are small antimicrobial agents with potent activity against bacteria and viruses. The peptides are nonhemolytic, and exhibit minimal in vitro cytotoxicity. A pharmaceutical composition comprising retrocyclin as an active agent is administered therapeutically to a patient suffering from a bacterial and/or viral infection, or to an individual facing exposure to a bacterial and/or viral infection, especially one caused by the HIV-1 retrovirus or other sexually-transmitted pathogens.
US07718608B2
Disclosed are methods of treating a subject suffering from irritable bowel syndrome which involves administering rifaximin to the subject and reducing the symptoms of irritable bowel syndrome. Also disclosed are methods of improving the symptoms in a subject caused by irritable bowel syndrome.
US07718604B2
The use of IL-22 for the treatment of metabolic disorders including hyperlipidemia, obesity, hyperinsulinemia and diabetes. IL-22 may also be used in combination with insulin for diabetes.
US07718600B2
Compounds that bind cellular IAPs (inhibitor of apoptosis proteins) are disclosed. The compounds are mimetics of the N-terminal tetrapeptide of IAP-binding proteins, such as Smac/DIABOLO, IIid, Grim and Reaper, which interact with a specific surface groove of IAP. Also disclosed are methods of using these compounds for therapeutic, diagnostic and assay purposes.
US07718596B2
A unit dose fabric treatment system comprises a water soluble container in which a liquid fabric treatment composition is disposed, the composition comprising one or more fatty acid esters wherein, in at least one of the fatty acid esters, the average proportion of C18 chains is less than 60%, preferably less than 50%, more preferably less than 40%, e.g. less than 30% by weight of the total weight of fatty acid chains in the fatty acid ester.
US07718595B2
The invention encompasses liquid cleaning compositions, for example, dish washing liquids, and methods of their manufacture and use, which possess enhanced cleaning ability. The cleaning compositions of the invention include acidic light duty liquid cleaning compositions with low toxicity and antibacterial efficacy on surfaces, for example, hard surfaces.
US07718594B1
The current invention encompasses a microemulsion having environmentally safe components, the microemulsion exhibiting optical clarity and stability over a wide range of temperatures. The microemulsion also forms a part of a decontaminant solution for treating chemical and biological contaminant agents, the solution preferably containing peroxycarboxylic acids generated from solids as the primary decontamination agent. The solution is a single phase emulsion that is both stable and effective over a broad range of temperatures, the range extending well below 0° C. There is also disclosed a microemulsion decontaminate solution having components that stabilize the included solid and peroxycarboxylic acids.
US07718592B2
Coated sodium percarbonate particles, having an inner shell layer which comprises at least one inorganic, hydrate-forming salt as the main constituent, and an outer shell layer which comprises an alkali metal thiosulfate, an alkaline earth metal thiosulfate and/or an ammonium thiosulfate, are stable to storage and have an improved storage stability in detergents and cleaning agents. Detergents and cleaning agents which comprise such sodium percarbonate particles show a reduced oxidative attack on oxidation-sensitive constituents of the composition during storage. Machine dishwashing agents in the form of tablets which comprise such sodium percarbonate particles and a corrosion protection agent for silver show a reduced yellowing of the tablets during storage.
US07718590B2
A variety of compositions that are particularly applicable for removing one or more of resist, etching residue, planarization residue, and copper oxide from a substrate comprising copper and a low-k dielectric material are described. The resist, residues, and copper oxide are removed by contacting the substrate surface with the composition, typically for a period of 30 seconds to 30 minutes, and at a temperature between 25° and 45° C. The composition includes a fluoride-providing component; at least 1% by weight of a water miscible organic solvent; an organic acid; and at least 81% by weight water. Typically the composition further includes up to about 0.4% of one or more chelators.
US07718587B2
A lubricant composition is provided for use in lubricating a conveyor track for bottles, cans, kegs and other containers for beverages and foodstuffs. The composition comprises a phosphate ester of the formula R1—(OCH2CH2)n—O—P(O)(OH)2 where n is in the range of from 0 to 10, and R1 is a C9 to C20 saturated or unsaturated alkyl group or a mixture of such alkyl groups; and water. The composition has a pH of from about 1 to about 3.5. The composition optionally further comprises a biocidal agent, an acid, and a synthetic surfactant. Also disclosed is a method for lubricating a conveyor track by applying an effective amount of such a lubricating composition.
US07718586B2
Disclosed is composition useful for reducing the concentration of mercaptans in hydrocarbons comprising: (A) a first diazo component and (B) a second component comprising a nucleophilic acceptor. The composition can be added to hydrocarbons such as fuel oil to reduce mercaptans without increasing turbidity or color. Triethylene diamine and 1,2-epoxyhexadecane are disclosed to be exemplary diazo and nucleophilic acceptor components.
US07718581B2
A method of reducing wear in a cutting head of a tunnel boring machine, by means of the addition at the cutting head of a foamed aqueous liquid composition, which comprises a foaming agent and a lubricant, the lubricant being selected from the group consisting of high molecular weight polyethylene oxides and bentonite. Preferred foaming agents are anionic and nonionic surfactants. Wear rates of cutting elements of TBMs boring in hard rock are considerably reduced. A wear-reducing foamable concentrate is also described.
US07718580B2
The present invention provides an internal olefin composition comprising a mixture of 60 to 80% by mass of an olefin having 16 carbon atoms and 40 to 20% by mass of an olefin having 18 carbon atoms wherein a content of an α-olefin in the mixture is 10% by mass or less, and a content of a branched olefin in the mixture is 10% by mass or less, which has a good biodegradability even when discharged into the environments, a less toxicity against marine organisms, etc., and a sufficient fluidity when used as a base oil for oil drilling, etc.
US07718574B2
Methods for depositing, at a very high deposition rate, a biaxially-textured film on a continuously moving metal tape substrate are disclosed. These methods comprise: depositing a film on the substrate with a deposition flux having an oblique incident angle of about 5° to about 80° from the substrate normal, while simultaneously bombarding the deposited film using an ion beam at an ion beam incident angle arranged along either a best ion texture direction of the film or along a second best ion texture direction of the film, thereby forming the biaxially-textured film, wherein a deposition flux incident plane is arranged parallel to a direction along which the biaxially-textured film has a fast in-plane growth rate. Superconducting articles comprising a substrate, a biaxially-textured film deposited on said substrate by said methods above; and a superconducting layer disposed on the biaxially-textured film are also disclosed.
US07718572B2
An aqueous microcapsule suspension liquid exhibiting an excellent (long-term) storage stability and allowing easy re-dispersion and dilution with water even after such a storage, is produced by adding a microorganism-fermented polysaccharide of succinoglycan type as a thickening agent into a microcapsule slurry, or by adding such a microorganism-fermented polysaccharide as a thickening agent to a microcapsule slurry after uniform dilution with water.
US07718561B2
The present invention relates to a catalyst for preparing phthalic anhydride by gas phase oxidation of o-xylene and/or naphthalene, comprising at least three catalyst zones which have different compositions and, from the gas inlet side toward the gas outlet side, are referred to as first, second and third catalyst zone, the catalyst zones having in each case an active composition comprising TiO2, and the active composition content decreasing from the first catalyst zone disposed toward the gas inlet side to the third catalyst zone disposed toward the gas outlet side, with the proviso that (a) the first catalyst zone has an active composition content between about 7 and 12% by weight, (b) the second catalyst zone has an active composition content in the range between 6 and 11% by weight, the active composition content of the second catalyst zone being less than or equal to the active composition content of the first catalyst zone, and (c) the third catalyst zone has an active composition content in the range between 5 and 10% by weight, the active composition content of the third catalyst zone being less than or equal to the active composition content of the second catalyst zone. Also described is a preferred process for preparing such a catalyst and the preferred use of the titanium dioxide used in accordance with the invention.
US07718559B2
A method of fabricating doped quartz component is provided herein. In one embodiment, the doped quartz component is a yttrium doped quartz ring configured to support a substrate. In another embodiment, the doped quartz component is a yttrium and aluminum doped cover ring. In yet another embodiment, the doped quartz component is a yttrium, aluminum and nitrogen containing cover ring.
US07718556B2
A medical film that is excellent in biocompatibility and bioabsorbability and has an excellent strength in suturing and bonding is provided. A reinforcing material 12 made of a biodegradable polymer is placed in a gelatin solution so as to allow the solution to infiltrate in the reinforcing material 12 and then the gelatin is dried. This allows the gelatin that has infiltrated entirely in an internal part of the reinforcing material 12 to gel, thereby forming a gelatin film 11. Thus, a medical film 1 in which the reinforcing material 12 and the gelatin film 11 are integrated is obtained. The gelatin film 11 preferably is a cross-linked gelatin film.
US07718552B2
A method and device of nanostructured titania that is crack free. A method in accordance with the present invention comprises depositing a Ti film on a surface, depositing a masking layer on the Ti film, etching said masking layer to expose a limited region of the Ti film, the limited region being of an area less than a threshold area, oxidizing the exposed limited region of the Th.ucsbi film, and annealing the exposed limited region of the Ti film.
US07718549B2
A method of making a transistor having first and second electrodes, a semiconductive layer, and a dielectric layer; said semiconductive layer comprising a semiconductive polymer and said dielectric layer comprising an insulating polymer; characterised in that said method comprises the steps of: (i) depositing on the first electrode a layer of a solution containing material for forming the semiconductive layer and material for forming the dielectric layer; and (ii) optionally curing the layer deposited in step (i); wherein, in step (i), the solvent drying time, the temperature of the first electrode and the weight ratio, of (material for forming the dielectric layer): (material for forming the semiconductive layer) in the solution are selected so that the material for forming the semiconductive layer and the material for forming the dielectric layer phase separate by self-organisation to form an interface between the material for forming the semiconductive layer and the material for forming the dielectric layer.
US07718538B2
A pulsed plasma system with pulsed sample bias for etching semiconductor structures is described. In one embodiment, a portion of a sample is removed by applying a pulsed plasma process, wherein the pulsed plasma process comprises a plurality of duty cycles. A negative bias is applied to the sample during the ON state of each duty cycle, while a zero bias is applied to the sample during the OFF state of each duty cycle. In another embodiment, a first portion of a sample is removed by applying a continuous plasma process. The continuous plasma process is then terminated and a second portion of the sample is removed by applying a pulsed plasma process.
US07718529B2
Ultrafine dimensions, smaller than conventional lithographic capabilities, are formed employing an efficient inverse spacer technique comprising selectively removing spacers. Embodiments include forming a first mask pattern over a target layer, forming a spacer layer on the upper and side surfaces of the first mask pattern leaving intermediate spaces, depositing a material in the intermediate spacers leaving the spacer layer exposed, selectively removing the spacer layer to form a second mask pattern having openings exposing the target layer, and etching the target layer through the second mask pattern.
US07718525B2
Methods of forming a metal interconnect and an IC chip including the metal interconnect are disclosed. One embodiment of the method may include providing an integrated circuit (IC) chip up to and including a middle of line (MOL) layer, the MOL layer including a contact positioned within a first dielectric; recessing the first dielectric such that the contact extends beyond an upper surface of the first dielectric; forming a second dielectric over the first dielectric such that the second dielectric surrounds at least a portion of the contact, the second dielectric having a lower dielectric constant than the first dielectric; forming a planarizing layer over the second dielectric; forming an opening through the planarizing layer and into the second dielectric to the contact; and forming a metal in the opening to form the metal interconnect.
US07718518B2
A doped silicon layer is formed in a batch process chamber at low temperatures. The silicon precursor for the silicon layer formation is a polysilane, such as trisilane, and the dopant precursor is an n-type dopant, such as phosphine. The silicon precursor can be flowed into the process chamber with the flow of the dopant precursor or separately from the flow of the dopant precursor. Surprisingly, deposition rate is independent of dopant precursor flow, while dopant incorporation linearly increases with the dopant precursor flow.
US07718510B2
A laser processing method is provided, which, even when a substrate formed with a laminate part including a plurality of functional devices is thick, can cut the substrate and laminate part with a high precision.This laser processing method irradiates a substrate 4 with laser light L while using a rear face 21 as a laser light entrance surface and locating a light-converging point P within the substrate 4, so as to form modified regions 71, 72, 73 within the substrate 4. Here, the quality modified region 71 is formed at a position where the distance between the front face 3 of the substrate 4 and the end part of the quality modified region 71 on the front face side is 5 μm to 15 μm. When the quality modified region 71 is formed at such a position, a laminate part 16 (constituted by interlayer insulating films 17a, 17b here) formed on the front face 3 of the substrate 4 is also cut along a line to cut with a high precision together with the substrate 4.
US07718505B2
The method of forming a semiconductor structure in a substrate comprises, forming a first trench with a first width We and a second trench with a second width Wc, wherein the first width We is larger than the second width Wc, depositing a protection material, lining the first trench, covering the substrate surface and filling the second trench and removing partially the protection material, wherein a lower portion of the second trench remains filled with the protection material.
US07718502B2
A semiconductor apparatus includes a wiring pattern, an insulating film, and a thin-metal-film resistor element. The insulating film is formed on the wiring pattern having connection holes vertically penetrating there-through to expose part of the wiring pattern at bottom regions of the connection holes. The connection holes are arranged with a space there-between. The thin-metal-film resistor element is formed on the insulating film and extending to continuously overlay and contact surfaces of the insulating film, inner walls of the connection holes, and the wiring pattern at the bottom regions of the connection holes.
US07718498B2
A semiconductor device suitable for a source-follower circuit, provided with a gate electrode formed on a semiconductor substrate via a gate insulation film, a first conductivity type layer formed in the semiconductor substrate under a conductive portion of the gate electrode and containing a first conductivity type impurity, first source/drain regions of the first conductivity type impurity formed in the semiconductor substrate and extended from edge portions of the gate electrode, and second source/drain regions having a first conductivity type impurity concentration lower than that in the first source/drain regions and formed adjoining the gate insulation film and the first source/drain regions in the semiconductor substrate so as to overlap portions of the conductive portion of the gate electrode.
US07718489B2
A semiconductor structure and method for forming the same. The structure includes multiple fin regions disposed between first and second source/drain (S/D) regions. The structure further includes multiple front gates and back gates, each of which is sandwiched between two adjacent fin regions such that the front gates and back gates are alternating (i.e., one front gate then one back gate and then one front gate, and so on). The widths of the front gates are greater than the widths of the back gates. The capacitances of between the front gates and the S/D regions are smaller than the capacitances of between the back gates and the S/D regions. The distances between the front gates and the S/D regions are greater than the distances between the back gates and the S/D regions.
US07718487B2
A method of manufacturing a ferroelectric layer, including: forming a first ferroelectric layer above a base by a vapor phase method; and forming a second ferroelectric layer above the first ferroelectric layer by a liquid phase method.
US07718486B2
Methods and systems for fabricating integrated pairs of HBT/FET's are disclosed. One preferred embodiment comprises a method of fabricating an integrated pair of GaAs-based HBT and FET. The method comprises the steps of: growing a first set of epitaxial layers for fabricating the FET on a semi-insulating GaAs substrate; fabricating a highly doped thick GaAs layer serving as the cap layer for the FET and the subcollector layer for the HBT; and producing a second set of epitaxial layers for fabricating the HBT.
US07718476B2
A method of fabricating a display apparatus includes depositing a first layer on a substrate while a mask is disposed at a first distance from the substrate, and forming a second layer on the substrate while the mask is disposed at a second distance larger than the first distance from the substrate after forming the first layer. Thus, the present invention provides a method of fabricating a display apparatus, in which a single mask is used in forming an electron injection layer and a common electrode.
US07718474B2
A semiconductor device includes a pair of select gate structures which are opposed to each other and which are formed in a select transistor formation area, each of the select gate structures including a gate insulating film formed on a semiconductor substrate and a gate electrode formed on the gate insulating film, and a pair of memory cell gate structure groups which are formed in a pair of memory cell formation areas between which the select transistor formation area is interposed and each of which has a plurality of memory cell gate structures arranged at the same pitch, the pair of select gate structures having sides which are opposed to each other, and at least the upper portion of each of the opposed sides of the select gate structures being inclined.
US07718473B2
An HF control bi-directional switch component of the type having its gate referenced to the rear surface formed in the front surface of a peripheral well of the component, including two independent gate regions intended to be respectively connected to terminals of a transformer having a midpoint connected to the rear surface terminal of the component.
US07718472B2
An integrated circuit package-on-package stacking method includes forming a leadframe interposer including: forming a leadframe having a lead; forming a molded base only supporting the lead; and singulating the leadframe interposer from the leadframe.
US07718468B2
A method includes (a) preparing a substrate, and (b) growing a ZnO-containing compound semiconductor layer above the substrate by supplying at the same time at least Zn and O as source gases and S as a surfactant.
US07718458B2
A method and resulting device for reducing an electrical field at an isolation gap in a capacitive actuator includes providing a bottom electrode layer and forming a pattern in the bottom electrode layer having an isolation gap between center and outer electrode components of the patterned electrode. A spacing material is deposited in the isolation gap, the spacing material having a greater height than a remainder of the patterned electrode, and a sacrificial material is deposited conformably on a surface of the patterned electrode and spacing material. The method also includes applying a deformable electrode to a surface of the sacrificial material, whereby removal of the sacrificial and spacing materials results in a greater spacing between the deformable electrode and the electrode layer at a region of the isolation gap than over a remainder of the spacing between the patterned electrode layer and deformable surface.
US07718457B2
A method of producing a MEMS device provides an apparatus having structure on a first layer that is proximate to a substrate. The apparatus has a space proximate to the structure. The method adds doped material to the space. The doped material dopes at least a portion of the first layer.
US07718456B2
A package for housing a light-emitting element wherein a via hole for wiring provided so as to pass through an insulating substrate is arranged in such a manner that it is positioned under a reflector frame; a method for manufacturing the above package for housing a light-emitting element which comprises the steps of separately providing a green sheet for the substrate and a green sheet for the frame, causing a paste containing a ceramic powder to be present between the two green sheets to bind them, and subjecting them to degreasing and sintering, to thereby integrate them.
US07718429B2
A method of efficiently and conveniently inducing differentiation from bone marrow stromal cells to skeletal muscle cells, which comprises the steps of: (a) the step of adding one or more kinds of substances selected from the group consisting of a cyclic AMP increasing agent, a cAMP analogue, and a cell differentiation stimulating factor to a culture of bone marrow stromal cells, wherein said bone marrow stromal cells are not treated with a demethylating agent, and culturing the cells; (b) the step of introducing a Notch gene and/or a Notch signaling related gene into the cells obtained in the step (a), and culturing the cells to obtain a culture of myoblasts, provided that said culture does not contain the cells introduced with the gene and non-introduced cells; and (c) the step of adding a Notch ligand to the culture of myoblasts obtained in the step (b), and culturing the cells.
US07718418B2
Systems, methods, compositions and apparatus relating to genome selection are disclosed.
US07718408B2
The present application provides a method of reducing and/or removing diglyceride from an edible oil, comprising admixing an edible oil with an acyl acceptor substrate and a diglyceride: glycerol acyltransferase, wherein the diglyceride:glycerol acyltransferase is characterized as an enzyme which in an edible oil is capable of transferring an acyl group from a diglyceride to glycerol. The diglyceride:glycerol acyltransferase can comprise the amino acid sequence motif GDSX. The present invention also relates to the use of a diglyceride:glycerol acyltransferase in the manufacture of an edible oil, for reducing and/or removing diglyceride from said edible oil and to the use of said enzyme in the manufacture of a foodstuff comprising an edible oil for improving the crystallization properties of said foodstuff.
US07718407B2
A process for the preparation of vitamin K2 (MK-7) comprising the culture of Bacillus subtilis mutant strain GN13/72-DSM 17766 deposited on Dec. 5, 2005 at the DSMZ.
US07718403B2
The present invention regards a variety of methods and compositions for whole genome amplification and whole transcriptome amplification. In a particular aspect of the present invention, there is a method of amplifying a genome comprising a library generation step followed by a library amplification step. In specific embodiments, the library generating step utilizes specific primer mixtures and a DNA polymerase, wherein the specific primer mixtures are designed to eliminate ability to self-hybridize and/or hybridize to other primers within a mixture but efficiently and frequently prime nucleic acid templates.
US07718394B2
Encephalotoxin produced by activated mononuclear phagocytes is present in individuals having neurological disease including neurodegenerative and neuro-inflammatory diseases, such as Alzheimer's disease (AD), HIV-1-associated dementia (HAD), Creutzfeldt-Jakob disease, Mild Cognitive Impairment, prion disease, minor cognitive/motor dysfunction, acute stroke, acute trauma, or neuro-AIDS. Biochemical detection of encephalotoxin according to the methods of the invention will allow diagnosis of neurological disease in early, presymptomatic stages, thereby allowing early intervention in disease progression as well as identification of subjects or populations at risk for developing neurodegenerative disease. The methods of the invention also provide a mechanism for monitoring progression and treatment of neurological disease.
US07718389B2
The present invention relates to a stabilization composition of coelenterazine or an analog thereof, a kit, a method for measuring a coelenterazine-based biological luminescence, containing coelenterazine or the analog thereof and an antioxidant.
US07718384B2
The present invention discloses a method using human soluble ErbB3, for example p85-sErbB3, as a negative regulator of heregulin-stimulated ErbB2, ErbB3, and ErbB4 activation. The present invention also discloses p85-sErbB3 binding to heregulin with an affinity comparable to that of full-length ErbB3, and competitively inhibiting high affinity heregulin binding to ErbB2/ErbB3 heterodimers on the cell surface of breast carcinoma cells. The present invention also uses p85-sErbB3 to inhibit heregulin-induced phosphorylation of ErbB2, ErbB3, and ErbB4 in cells, as a negative regulator of heregulin-stimulated signal transduction, and as a block for cell growth. The present invention is also directed to nucleic acids and expression vectors encoding p85-sErbB3, host cells harboring such expression vectors, and methods of producing the protein. The present invention discloses a method of therapeutically treating human malignancies associated with heregulin-mediated cell growth such as breast and prostate cancer.
US07718383B2
The present invention relates to the discovery of a specific human taste receptor in the T2R taste receptor family, hT2R64 that responds to particular bitter compounds The present invention further relates to the use of this receptor in assays for identifying ligands that modulate the activation of this taste receptor. These compounds may be used as additives and/or removed from foods, beverages and medicinals in order to modify (block) T2R-associated bitter taste. A preferred embodiment is the use of the identified compounds as additives in foods, beverages and medicinals for blocking bitter taste.
US07718381B2
The present invention concerns a method of identifying a cell colony which expresses a soluble variant of a target protein which method comprises (a) subjecting the cell colony to conditions which are capable of causing lysis thereof; (b) filtering the lysate through a filter having pores which allow only soluble proteins to pass through the filter; and (c) detecting target protein which has passed through the filter where the target is not detected an the basis of its own enzymatic activity. The invention further covers the identification of a cell colony expressing a soluble variant of a membrane protein using steps (a) and (b) of the method above. A kit for use in the methods is also covered by the invention.
US07718376B2
The present invention relates to the identification of a specific population of cell types, in particular somatic stem cells including haematopoietic stem cells, mesenchymal stem cells and keratinocyte stem cells. The invention also provides for methods of isolation and uses of the stem cells. Derived from the methods of the present invention, there is provided a method of identifying a stem cell comprising the steps of: obtaining a cell sample including stem cells; detecting the presence of angiotensin converting enzyme (ACE) or a fragment thereof on a cell; and identifying the stem cells having ACE or a fragment thereof.
US07718368B2
The invention generally features the use of Yaba monkey tumor virus nucleic acid molecules and polypeptides for the treatment or prevention of immunoinflammatory disorders.
US07718367B2
Methods and kits are provided for diagnosing, monitoring, or predicting preeclaimpsia in a pregnant woman, trisomy 18 and trisomy 21 in a fetus, as well as for detecting pregnancy in a woman, by quantitatively measuring in the maternal blood the amount of one or more RNA species derived from a set of genetic loci and comparing the amount of the RNA species with a standard control.
US07718359B2
The invention relates to a method for inducing protection against the 4 serotypes of dengue fever in a patient, comprising: (a) the administration of a monovalent vaccine comprising a vaccinal virus of a first serotype of dengue fever, and (b) the administration of a tetravalent vaccine comprising vaccinal viruses of the four serotypes of dengue fever, in which administration (b) is made between at least 30 days and not more than 12 months following the first administration (a).
US07718352B2
There is provided a process for producing an EL element by photolithography, which process can produce an EL element having improved luminescence efficiency. The production process comprises the steps of removing a photoresist from photoresist layer-covered parts of an electroluminescent layer and cleaning the surface of the electroluminescent layer parts from which the photoresist has been removed.
US07718351B2
Methods and apparatuses involving biocompatible structures for tissue engineering and organ replacement and, more specifically, biocompatible structures formed by three-dimensional fabrication, are described. In some embodiments, the biocompatible structures are scaffolds for cells that can be used as tissue engineering templates and/or as artificial organs. The structures may be three-dimensional and can mimic the shapes and dimensions of tissues and/or organs, including the microarchitecture and porosities of the tissues and organs. Pores in the structure may allow delivery of molecules across the structure, and may facilitate cell migration and/or generation of connective tissue between the structure and its host environment. Structures of the invention can be implanted into a mammal and/or may be used ex vivo as bioartificial assist devices.
US07718349B2
The invention relates to a method for producing submicron structures using a shadow mask, whereby a material charge and/or energy charge occurs through the openings of the shadow mask. The method comprises the following steps: a film which is used as a shadow mask and which is made of a masking material is applied to the substrate, tears are produced in the film, the tears extending until the substrate, edge areas of the film arranged on the tears are detached thereby exposing the substrate and the material or the energy is applied to the substrate by the tears, also above the exposed edge area of the shadow mask film.
US07718336B2
A photoconductor containing a supporting substrate, a photogenerating layer; and at least one charge transport layer where the photogenerating layer contains a photogenerating pigment and a chelating additive or agent of, for example, a β-diketone, a ketoester, a hydroxyl carboxylic acid, a hydroxyl carboxylic acid ester, a keto alcohol, or an amino alcohol.
US07718335B2
An image bearing member is provided, including a substrate and a surface layer formed by optically curing at least a radical polymerizable compound with a charge transport structure and a radical polymerizable monomer without a charge transport structure, wherein the transmission factor of the surface layer for light having a wavelength by 25 nm longer than an absorption end wavelength of photo-absorption spectrum of the surface layer prior to optical curing is not less than 65%.
US07718330B2
An image forming method characterized in that a plurality of toner images which differ in color is formed as superposed; a plurality of the superposed toner images is simultaneously transferred onto a sheet of recording paper; the turbidity of toners of each color which form a plurality of the toner images is less than 60; and the maximum turbidity difference among said toners of each color is 5-45.
US07718329B2
Provided is a method of fabricating a liquid crystal display device. The method includes fabricating a liquid crystal panel divided into transmission and non-transmission regions, and including an upper substrate and a lower substrate, which are spaced apart from and opposite to each other, and a liquid crystal layer filled between the substrates, wherein the lower substrate has a plurality of thin film transistors; depositing a transparent conductive layer having a certain thickness on the upper substrate exposed to the exterior of the liquid crystal panel; and performing an etching process for removing the entire transparent conductive layer and a portion of the upper substrate to form irregular prominences and depressions on a surface of the upper substrate exposed to the exterior. Therefore, it is possible to improve readability and contrast ratio by diffusely reflecting external light and scattering internal light.
US07718326B2
This invention addresses the scalability problem of periodic “nanostructured” surface treatments such as those formed by interference lithography. A novel but simple method is described that achieves seamless stitching of nanostructure surface textures at the pattern exposure level. The described tiling approach will enable scaling up of coherent nanostructured surfaces to arbitrary area sizes. Such a large form factor nanotechnology will be essential for fabricating large aperture, coherent diffractive elements. Other applications include high performance, antiglare/antireflection and smudge resistant Motheye treatments for display products such as PDA's, laptop computers, large screen TV's, cockpit canopies, instrument panels, missile and targeting domes, and, more recently, “negative-index” surfaces. Although ideal for seamless stitching of nanometer scale patterns, the technology is broadly applicable to any situation where an arbitrarily large area needs to be seamlessly tiled with a smaller base pattern that has periodic overlap able boundaries.
US07718325B2
An image forming medium includes a substrate and an imaging layer coated on or impregnated into said substrate, where the imaging layer includes as a photochromic material a spiropyran compound having a conjugated pathway, dispersed in a polymeric binder, wherein the photochromic material exhibits a reversible transition between a colorless state and a colored state in response to heat and light.
US07718322B2
Disclosed in an electrolyte for a rechargeable lithium battery, including a mixture of organic solvents including a cyclic solvent and a nitrile-based solvent represented by formula 1 and a lithium salt.
US07718320B2
A family of Li-ion battery cathode materials and methods of synthesizing the materials. The cathode material is a defective crystalline lithium transition metal phosphate of a specific chemical form. The material can be synthesized in air, eliminating the need for a furnace having an inert gas atmosphere. Excellent cycling behavior and charge/discharge rate capabilities are observed in batteries utilizing the cathode materials.
US07718319B2
The present invention includes compositions and methods of making cation-substituted and fluorine-substituted spinel cathode compositions by firing a LiMn2−y−zLiyMzO4 oxide with NH4HF2 at low temperatures of between about 300 and 700° C. for 2 to 8 hours and a η of more than 0 and less than about 0.50, mixed two-phase compositions consisting of a spinel cathode and a layered oxide cathode, and coupling them with unmodified or surface modified graphite anodes in lithium ion cells.
US07718314B2
A cathode material capable of improving capacity and superior low temperature characteristics, and a battery using the cathode material are provided. A cathode and an anode are layered with an electrolyte layer and a separator in between. The cathode contains a complex oxide containing lithium, manganese, nickel, and cobalt; a complex oxide containing lithium and at least one of nickel and cobalt; and a complex oxide containing lithium and manganese and having a spinel structure or a phosphorus oxide containing lithium and iron at a given ratio.
US07718310B1
An electrochemical cell is described. The cell comprises a cathode material contacted to a perforated current collector having a portion left uncovered and an anode material contacted to an anode current collector. The anode comprises first and second strips positioned on opposite sides of the cathode, which is also in the form of a strip, but one that is much longer than each of the anode strips. Proximal ends of the anode strips reside adjacent to where the cathode is secured to a terminal pin/sleeve assembly. Distal ends of the anode strips are adjacent to the opposed ends of the cathode strip. A separator sheet segregating the anode from direct contact with the cathode provides an upper portion at least partially sealed to a lower portion along an aligned peripheral edge and through the uncovered perforations of the cathode current collector to lock the cathode in position. The anode and cathode are then wound into a galaxy electrode assembly housed in a cylindrical casing and activated with an electrolyte.
US07718301B2
A fuel supply apparatus for supplying fuel to a fuel cell has a fuel supply unit and a water suction unit. When the fuel cell is mounted onto the fuel supply apparatus, the apparatus supplies fuel to the fuel cell and removes the water inside the fuel cell by suction.
US07718300B2
The present invention relates to frame elements for monopolar fuel cell stacks, permitting a simplified electrical wiring and/or a simplified and improved assembly of monopolar fuel cell stacks. They permit a significant miniaturization of monopolar arrangements.
US07718298B2
A bipolar plate for a fuel cell is provided that includes a flowfield having an active surface with an inlet region and an outlet region. The active surface of the flowfield is in communication with the inlet region and the outlet region and has at least one flow channel formed therein. The at least one flow channel further has a cross-sectional area at the outlet region that is less than a cross-sectional area at the inlet region. In particular embodiments, the at least one flow channel is bifurcated. A fuel cell stack including a fuel cell and the bipolar plate is also provided.
US07718288B2
A fuel cell system that employs a diode electrically coupled between bipolar plates in a fuel cell of a fuel cell stack for preventing the fuel cell between the plates from reversing its polarity. The diode is a thin-sheet p-n diode including doped semiconductor layers and has a thickness relative to the thickness of the MEA in the fuel cell so that the overall stack thickness does not increase. When the fuel cell is operating properly the diode does not conduct and all of the current through the fuel cell goes through the MEA. If the electric load on the stack increases to a level beyond the capability of the fuel cell, where the potential across the fuel cell goes significantly below zero, the diode will begin to conduct so that any current that cannot travel through the MEA with the cell voltage less than one negative forward diode voltage drop is able to go around the MEA through the diode.
US07718286B2
An abnormality detecting device of a fuel cell system according to the invention includes a hydrogen off-gas circulation passage for making hydrogen off-gas discharged from a fuel cell flow back to an anode; a discharge passage for discharging part of the hydrogen off-gas, which is circulated through the hydrogen off-gas circulation passage, from the hydrogen off-gas circulation passage; a hydrogen discharge valve provided in the discharge passage; abnormality determining means for determining whether an abnormality has occurred in opening/closing of the hydrogen discharge valve and gas state quantity detecting means for detecting a gas state quantity of the hydrogen off-gas, the gas state quantity detecting means being provided in the discharge passage at a position downstream from the hydrogen discharge valve. The abnormality determining means determines whether an abnormality has occurred in opening/closing of the hydrogen discharge valve based on the gas state quantity of the hydrogen off-gas.
US07718284B2
A base insulating layer of an FPC board includes a rectangular first insulating portion and a second insulating portion that outwardly extends from one side of the first insulating portion. A conductor layer is formed on one surface of the base insulating layer. The conductor layer includes a pair of rectangular collector portions and a pair of extraction conductor portions that extend in a long-sized shape from the collector portions. One collector portion is formed in a first region of the first insulating portion of the base insulating layer, and the other collector portion is formed in a second region of the first insulating portion. One extraction conductor portion extends from the one collector portion to the second insulating portion, and the other extraction conductor portion extends from the other collector portion to the second insulating portion.
US07718278B2
Provided is an anthracene derivative compound represented by Formula 1 below and an organic light-emitting device using the same: wherein Ar1, Ar2, R1, R2, R′, m, n, j, k, and X are as defined in the specification. The anthracene derivative compound is advantageously used in the production of an organic light-emitting device with better driving voltage, efficiency, and color purity.
US07718271B2
A laser welding material and laser welding method which can satisfactorily weld resin members of different resin materials that have no or little adhesive property is provided and includes a set of resin materials constituting a first resin member, a second resin member and a third resin member in which the first resin member and the second resin member are different materials and the first resin member does not absorb laser light and which is used for laser-welding the three members by overlapping the third resin member with the first and second resin members and irradiating laser light to the three members from the first resin member side, and a layer welding method.
US07718269B2
Provided is a technology capable of improving the reliability of a semiconductor device using a SiOC film as an interlayer film. In the invention, by forming an interlayer film from a SiOC film having a Si—CH3 bond/Si—O bond ratio less than 2.50% or having a strength ratio determined by the FT-IR of a Si—OH bond to a SiO—O bond exceeding 0.0007, a strength ratio of a SiH bond to a SiO—O bond at a wavelength of 2230 cm−1 exceeding 0.0050 and a strength ratio of a Si—H bond to a SiO—O bond at a wavelength of 2170 cm−1 exceeding 0.0067, the interlayer film has a relative dielectric constant of to 3 or less, and owing to suppression of lowering in hardness or elastic modulus, has improved mechanical strength.
US07718265B2
Provided is a release sheet which is non-silicone-based and has a good releasability from a layer of a pressure sensitive adhesive and which has a stable antistatic property without being influenced by the air environment and is free of bleeding out of ionic substances derived from an antistatic agent. The release sheet is prepared by providing an undercoat layer containing a polyurethane-based resin and 0.1 to 45% by mass of a lithium salt-based antistatic agent and a layer of a rubber-based release agent formed by coating and drying a liquid containing a release agent in order on a substrate.
US07718263B2
An aqueous primer composition of the present invention includes a water-dispersible polyisocyanate (A) and an acrylic resin water dispersion (B), wherein a polystyrene equivalent weight average molecular weight, determined using gel permeation chromatography, of an acrylic resin in the acrylic resin water dispersion (B) is 350,000 or more, and a glass transition temperature, determined by using a differential scanning calorimeter, of the acrylic resin is 15° C. to 130° C., and a weight ratio between the water-dispersible polyisocyanate (A) and the acrylic resin water dispersion (B) is (A):(B)=70:30 to 50:50.
US07718262B2
Microspheres, populations of microspheres, and methods for forming microspheres are provided. One microsphere configured to exhibit fluorescent and magnetic properties includes a core microsphere and a magnetic material coupled to a surface of the core microsphere. About 50% or less of the surface of the core microsphere is covered by the magnetic material. The microsphere also includes a polymer layer surrounding the magnetic material and the core microsphere. One population of microspheres configured to exhibit fluorescent and magnetic properties includes two or more subsets of microspheres. The two or more subsets of microspheres are configured to exhibit different fluorescent and/or magnetic properties. Individual microspheres in the two or more subsets are configured as described above.
US07718244B1
A protective mat assembly for a boxing ring includes a substantially trapezoidal base mat having multiple strips of hook and loop fasteners on the upper surface thereof. A similarly-shaped absorbent foam pad includes a plurality of mating hook and loop fastener strips on a lower surface to engage those of the base mat. The absorbent pad includes foot indentions for receiving a boxer's feet, and openings for receiving the legs of a boxer's stool. Accordingly, when a fighter sits on the stool between rounds, the underlying absorbent pad collects any fluids that would otherwise fall onto the ring surface.
US07718240B2
Elastomeric film-like products such as natural latex gloves are coated with novel lubricity compositions and compositions which protect the skin of the wearer from certain undesirable medical conditions. In powder-coated gloves, the coating composition comprises rice starch, and optionally USP-grade colloidal oatmeal in pharmaceutically accepted concentration. In powder-free gloves, the coating composition comprises colloidal oatmeal enhanced water or beta glucan solution, optionally in combination with one or more other starch components. Colloidal oatmeal enhanced water, and methods of making the colloidal oatmeal enhanced water are also disclosed. In addition, beta glucan solution, and methods of making the beta glucan solution are also disclosed. A liquid referred to herein as Polycoat may also be made by mixing colloidal oatmeal enhanced water with beta glucan solution, and the resulting liquid may be applied to elastomeric articles such as gloves.
US07718234B2
A liquid crystal display is provided which is capable of reducing the occurrence of defective display due to variations in the initial alignment direction of a liquid crystal alignment control film in a liquid crystal display of an IPS scheme, realizing the stable liquid crystal alignment, providing excellent mass productivity, and having high image quality with a higher contrast ratio. The liquid crystal display has a liquid crystal layer disposed between a pair of substrates, at least one of the substrates being transparent, and an alignment control film formed between the liquid crystal layer and the substrate. At least one of the alignment control films comprises photoreactive polyimide and/or polyamic acid provided with an alignment control ability by irradiation of substantially linearly polarized light.
US07718223B1
A method for controlling density or tower height of carbon nanotube (CNT) arrays grown in spaced apart first and second regions on a substrate. CNTs having a first density range (or first tower height range) are grown in the first region using a first source temperature range for growth. Subsequently or simultaneously, CNTs having a second density range (or second tower height range), having an average density (or average tower height) in the second region different from the average density (or average tower height) for the first region, are grown in the second region, using supplemental localized heating for the second region. Applications for thermal dissipation and/or dissipation of electrical charge or voltage in an electronic device are discussed.
US07718218B2
Thin-film magnetic head, method of manufacturing the same, head Gimbal assembly, and hard disk drive
A thin-film magnetic head has a laminated construction comprising a main pole layer having a magnetic pole tip on a side of the medium-opposing surface opposing a recording medium, a write shield layer opposing the magnetic pole tip forming a recording gap layer, on the side of the medium-opposing surface, and a thin-film coil wound around at least a portion of the write shield layer. The thin-film magnetic head has an upper yoke pole layer having a larger size than the portion of the main pole layer which is more distant from the medium-opposing surface than the recording gap layer, wherein the upper yoke pole layer is joined to the side of the main pole layer which is near the thin-film coil.
US07718217B2
An object of the present invention is to provide a method and an apparatus for marking an electric wire at a low cost. An apparatus 1 for marking an electric wire forms a band mark 21 on a part of an outer face 5a of the electric wire 3. The band mark 21 is formed along the entire circumference of the part of the outer face 5a of the electric wire 3. The marking apparatus 1 tightens the electric wire 3 in a state where a tensile force is applied in a longitudinal direction. The marking apparatus 1 includes a nozzle 35 for injecting coloring agent toward an uppermost position 10 of the outer face 5a of the electric wire 3. The nozzle 35 has an open end 42 which is opposed to the electric wire 3 and capable of passing the coloring agent. A straight line L extending between a center C1 of the open end 42 and a center C2 of the electric wire 3 lies along a vertical direction.
US07718215B2
An apparatus for forming alignment layer includes a printing stage for supporting a substrate thereon, at least one inkjet head having at least one spray hole above the printing stage, the spray hole spraying an alignment material onto the substrate, a head support supporting the inkjet head, a pitch measuring unit adjacent to the inkjet head, and a display unit displaying measured results provided by the pitch measuring unit.
US07718210B2
The present invention provides a novel cellular solid structure which can be used to structure an oil-water mixture into a semi-solid state. The invention is particularly useful in the manufacture of food products, such as margarine-like spreads, other spreads and dips and dairy-like products such as whipped toppings and creamy fillings.
US07718209B2
A low common salt soy sauce, which has good flavor, significantly suppresses elevation of blood pressure, prevents cardiac hypertrophy, and is also available as special nutritious food, is obtained. 1.0% to 10.0% by weight of potassium chloride and 0.1% to 5.0% by weight of γ-aminobutyric acid are added to a reduced common salt soy sauce, so as to obtain a low common salt soy sauce of issue. Otherwise, a KCl-containing low common slat soy sauce is obtained by: (1) a common production method of soy sauce, in which a mixed solution consisting of KCl and common salt is used as mother water; (2) a method of subjecting a soy sauce obtained using saline solution as mother water to electrodialysis, a membrane treatment, or the like, so as to eliminate common salt from the above soy sauce, and then adding KCl thereto; or other methods. Thereafter, γ-aminobutyric acid is added to the above KCl-containing low common salt soy sauce, so as to obtain a low common salt soy sauce comprising 0% to 10% by weight of common salt, 1.0% to 10.0% by weight of potassium chloride, and 0.1% to 5.0% by weight of γ-aminobutyric acid.
US07718208B2
Disclosed are improved packages and methods for packaging meat, fish, poultry, vegetables or other food products. A package of the present invention is a vacuum skin package comprising a multilayer film comprising at least one layer of an organic acid modified ionomer blend and at least one layer of an ethylene-containing polymer, such as an ethylene/vinyl acetate copolymer, wherein the film has specific gas permeability requirements.
US07718204B2
There is provided use of a conversion agent to prepare from a food material a foodstuff comprising at least one functional ingredient, wherein the at least one functional ingredient has been generated from at least one constituent of the food material by the conversion agent.
US07718196B2
Methods for generating highly enriched Th1/Tc1 and Th2/Tc2 functions are described. In particular, the generation of these functions are attained by the addition of an immune suppression drug, rapamycin or a rapamycin derivative compound. In addition to enhanced purity of T cell function, the T cells generated in rapamycin also express molecules that improve immune T cell function such as CD28 and CD62L. Such rapamycin generated functional T cell subsets may have application in the prevention or treatment of GVHD after allogeneic hematopoietic stem cell transplantation, the treatment of autoimmunity, or the therapy of infection or cancer.
US07718191B2
The invention relates to the novel use of a pharmaceutical product which combines domperidone and pseudoephedrine sulphate substances and which can be used to reduce or stop moderate or severe snoring.
US07718190B2
Certain diacylglycerol-polyethyleneglycol (DAG-PEG) lipids are especially useful for forming thermodynamically stable liposomes. Such liposomes are useful for a variety of purposes, including the delivery of therapeutic agents.
US07718189B2
Provided are lipid antiinfective formulations substantially free of anionic lipids with a lipid to antiinfective ratio is about 1:1 to about 4:1, and a mean average diameter of less than about 1 μm. Also provided is a method of preparing a lipid antiinfective formulation comprising an infusion process. Also provided are lipid antiinfective formulations wherein the lipid to drug ratio is about 1:1 or less, about 0.75:1 or less, or about 0.50:1 or less prepared by an in line fusion process. The present invention also relates to a method of treating a patient with a pulmonary infection comprising administering to the patient a therapeutically effective amount of a lipid antiinfective formulation of the present invention. The present invention also relates to a method of treating a patient for cystic fibrosis comprising administering to the patient a therapeutically effective amount of a lipid antiinfective formulation of the present invention.
US07718184B2
Coated particles of metal (such as calcium) silicate that exhibit excellent odor neutralization and sebum absorption properties when present within certain cosmetic and/or personal care formulations and suspensions are provided. Uncoated calcium silicate exhibits a high pH level that may have a deleterious effect upon such cosmetic and/or personal care compositions, thereby rendering the overall composition ineffective for its intended purpose, particularly if the calcium silicate is present in its usual state at high loading levels. Alternatively, if certain materials present within personal care compositions exhibit a sufficiently low pH level, the effectiveness of such calcium silicates may be compromised as well. Such novel coated/treated calcium silicates thus permit high loadings of this beneficial odor neutralizing/sebum absorbing additive within cosmetic and/or personal care formulations without causing any appreciable instability issues or viscosity modification concerns or allow for coexistence with such low pH materials without any appreciable reduction in performance capabilities of the calcium silicates themselves. Certain personal care compositions comprising these novel coated calcium silicate particulates are encompassed within this invention as well.
US07718183B2
The invention relates to three isolated DNA molecules that encode for proteins, BigL1, BigL2 and BigL3, in the Leptospira sp bacterium which have repetitive Bacterial-Ig-like (Big) domains and their use in diagnostic, therapeutic and vaccine applications. According to the present invention, the isolated molecules encoding for BigL1, BigL2 and BigL3 proteins are used for the diagnosis and prevention of infection with Leptospira species that are capable of producing disease in humans and other mammals, including those of veterinary importance.
US07718171B2
Use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable proteins, with a lactic acid bacterium to obtain a fermented food material which comprises active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate and/or the fluctuations in the heart rate of a mammalian.
US07718168B2
The present invention provides a medical implant material comprising mammalian transglutaminase and a polymer, wherein the transglutaminase is provided in the absence of free divalent metal ions and wherein the polymer is associated with the transglutaminase binding protein. Preferably, the transglutaminase is a tissue transglutaminase, which is coated on, impregnated into or covalently linked to the polymer. The polymer may be naturally occuring or synthetic, and may be biodegradable or non-biodegradable. The medical implant material may further comprise a reinforcing agent and/or one or more additional polymers. The invention further provides the use of a mammalian transglutaminase in a method for improving the biocompatibility of a medical implant material, the method comprising the steps of (i) providing a medical implant material comprising a polymer associated with a binding protein for binding the transglutaminase, and (ii) treating said material with a mammalian transglutaminase.
US07718160B2
The invention, in one aspect, relates to radiolabeled compounds. The invention also relates to radiolabeled liposomes and methods of making and using thereof. The invention also relates to kits for preparing radiolabeled liposomes.
US07718159B2
The invention describes a process for co-production of electricity and a hydrogen-rich gas by steam reforming of a hydrocarbon fraction with input of calories by combustion with the hydrogen that is produced inside the steam reforming reactor-exchanger.
US07718157B1
Targeted lipids and lipid particles are described which are assemblies of multipolar lipids, targeting molecules such as antibodies and polyanions. The lipids are of particular use for the delivery of bioactive substances such as nucleic acids to cells in vitro and especially in vivo.
US07718156B2
Carbon nanostructures are formed from a carbon precursor and catalytic templating nanoparticles. Methods for manufacturing carbon nanostructures generally include (1) forming a precursor mixture that includes a carbon precursor and a plurality of catalytic templating particles, (2) carbonizing the precursor mixture to form an intermediate carbon material including carbon nanostructures, amorphous carbon, and catalytic metal, (3) purifying the intermediate carbon material by removing at least a portion of the amorphous carbon and optionally at least a portion of the catalytic metal, and (4) heat treating the purified intermediate carbon material and/or treating the purified intermediate carbon material with a base to remove functional groups on the surface thereof. The removal of functional groups increases the graphitic content of the carbon nanomaterial and decreases its hydrophilicity.
US07718151B1
An improved process for deacidizing a gaseous mixture using phase enhanced gas-liquid absorption is described. The process utilizes a multiphasic absorbent that absorbs an acid gas at increased rate and leads to reduced overall energy costs for the deacidizing operation.
US07718145B2
A polyisocyanate production system is provided that can stably produce chlorine from hydrogen chloride produced secondarily while reacting stably between carbonyl chloride and polyamine and can perform an effective treatment of the hydrochloric gas produced secondarily. A hydrochloric gas control unit 32 controls a flow-rate control valve 23 to keep constant an amount of hydrogen chloride supplied from a hydrogen chloride purifying tank 4 to a hydrogen chloride oxidation reactor 6 via a second hydrochloric-gas connection line 11 to be constant, and also controls a pressure control valve 22 based on an inner pressure of the hydrogen chloride purifying tank 4 input from a pressure sensor 25 to discharge the hydrochloric gas from the hydrogen chloride purifying tank 4 to the hydrogen chloride absorbing column 5 via a first hydrochloric-gas connection line 10, so as to keep an inner pressure of the hydrogen chloride purifying tank 4 to be constant.
US07718142B2
An apparatus configured for treating sulfur at an elevated pressure. Embodiments of the apparatus comprises a vessel into which the sulfur is injected and a device for alleviating the pressure of the sulfur.
US07718131B2
Disclosed herein is a holder for biological sample containers such as well plates. The holder comprises a flat vacuum bed surrounded by a seal. A container is placed within the seal and a vacuum is applied, pressing and flattening the lower surface of the sample container against the flat vacuum bed. Samples in all portions of the container may then be imaged without the need to refocus on each portion of the container. For imaging, a sample in a well can be illuminated by a beam of light arranged so that a part or all of the sample is illuminated by direct rays that have not passed through the well plate. The beam is redirected to other parts of the well if a single illumination does not cover the whole well, so that the sample to be imaged using a series of partial images.
US07718122B2
This invention relates to particulate forms of carrier materials containing an oxidant, especially hypohalite or hypohalous acid, especially a dry particulate form of dilute or concentrated hypochlorite and hypochlorous acid compositions. The invention also relates to uses for these particles, such as for generating hypochlorous acid vapor to control the growth of mold or bacteria, to deactivate allergens and allergen causing agents, and to control odors.
US07718120B2
A system and method are provided for the thermal and non-thermal (oxidation) plasma treatment of medical waste using an electrode-less induction (thermal) and capacitive (non-thermal) plasma torches. The medical waste is pre-treated by liquid nitrogen, crushed and pulverized by LN2 crusher/pulverizer, and conveyed to the nitrogen/water thermal plasma reactor, which converts the powdered medical waste into carbon black and generated gas (resulting from the thermal step) is directed to the Oxygen non-thermal plasma reactor for post-treatment. The system is equipped with an emission control unit, dual frequency pulse RF power supply, and Liquid Nitrogen Generator. The off gas from LN2 crusher (nitrogen) is used for the induction plasma torch and off gas from LN2 generator (oxygen) is used as a plasma gas for the Non-thermal plasma torch.
US07718118B2
The present invention relates to creep-resistant magnesium-based alloys with low susceptibility to hot tearing, and with improved ductility, impact strength and fracture toughness, and corrosion resistance. The alloys contain at least 96 wt % magnesium, 1.5 to 1.9 wt % neodymium, 0.10 to 0.30 wt % yttrium, 0.35 to 0.70 wt % zirconium, 0.05 to 0.35 wt % zinc, 0.01 to 0.10 wt % calcium, 0.01 to 0.15 wt % strontium, and 0.0000 to 0.0005 wt % beryllium, and they are suitable for low pressure and gravity castings. Articles, that are castings of the alloys, are suitable for applications at temperatures as high as 175-250° C.
US07718112B2
Nanometer scale structures, and methods of making the same are disclosed.
US07718106B2
Medical devices including a proximal tubular member, a distal tubular member, and an intermediate tubular member connecting the proximal tubular member to the distal tubular member, and related methods.
US07718105B2
A method for fabricating a product, such as an amimatronic character, with artificial skin. The method includes providing data defining an exterior surface geometry of the product. A base geometry model of the product is generated based on the exterior surface geometry data, which in turn is used to fabricate a prototype of the product. Then, an exterior skin mold is formed using the product prototype mounted on an alignment block. The method includes fabricating an inner support structure based on the base geometry model having an exterior geometry smaller than the 3D base geometry model by the thickness of the exterior skin. The inner support structure is positioned within the mold with the inner support structure mounted upon the alignment block, which is received in the mold. The product is formed by pouring material for an exterior skin layer into the mold and over the inner support structure.
US07718103B2
A process for forming flexible noise attenuating cutting line for use in rotary vegetation trimmers formed of at least two monofilament polymer strands bonded together in a twisted disposition or a single strand twisted about its central axis in which the strand or strands are extruded in a molten disposition through a single die that is rotated during the extruding step either to twist the two strands together about a central longitudinal axis or a single strand about its own longitudinal axis such that upon cooling, stretching and heating, a flexible noise attenuating line is created in a continuous online process.
US07718101B2
A process for producing a friction material based on a sheet-like carbon fiber woven fabric for wet-friction elements, such as clutch linings or synchronizing ring linings. The woven fabric of carbon fibers is impregnated with a binder, in particular with a resin, to form a binder-impregnated fiber material. The prepreg is cured for a curing period under a curing temperature which is elevated with respect to the ambient temperature and is pressed mechanically on its surfaces with a pressing mold before the start and/or at least during part of the curing period.
US07718094B2
A method for the formation of metallic nanoparticles, such as gold and silver nanoparticles, which involves, combining in a single solution, solvent, metal ions and copolymers under conditions such that metal nanoparticles are formed. The copolymers have both reducing components and stabilizing components. The method can be used to form metal nanoparticles having a desired shape and size.
US07718082B2
The invention concerns a powder metallurgical composition containing, preferably a coarse, soft magnetic iron or iron-based powder, wherein the particles are surrounded by an insulating inorganic coating and as lubricant at least one non-drying oil or liquid having a crystalline melting point below 25° C., a viscosity (η) at 40° C. above 15 mPas and wherein said viscosity is temperature dependent according to the following formula: 10 log η=k/T+C wherein the slope k is above 800 T is in Kelvin and C is a constant in an amount between 0.05 and 0.4% by weight of the composition.
US07718080B2
Methods and devices for selective etching in a semiconductor process are shown. Chemical species generated in a reaction chamber provide both a selective etching function and concurrently form a protective coating on other regions. An electron beam provides activation to selective chemical species. In one example, reactive species are generated from a plasma source to provide an increased reactive species density. Addition of other gasses to the system can provide functions such as controlling a chemistry in a protective layer during a processing operation. In one example an electron beam array such as a carbon nanotube array is used to selectively expose a surface during a processing operation.
US07718078B2
A manufacturing method of a circuit board is provided. Firstly, a substrate board having a plurality of through holes is provided. Next, a first metal layer is electro-less plated on the surface of the substrate board and the surface of the through holes. Then, a second metal layer is plated on the first metal layer. After that, the second metal layer and the first metal layer are patterned to form a patterned circuit layer. Lastly, a third metal layer is plated on the patterned circuit layer.
US07718072B2
Magnetic handling structure (1a) comprising a retractable magnet (4) and a probe (3) for the manipulation of magnetic particles in biological samples and methods of handling magnetic particles in biological samples.
US07718069B2
The invention relates to a method and system for treating an aqueous liquid containing dissolved minerals and dissolved hydrocarbons. Method steps and apparatus for treating a waste water feed stream are disclosed which utilize a warm lime softening system in fluid communication with the waste water feed stream, wherein sludge from the warm lime softening system is recycled to improve lime utilization and enhance silica and boron removal without the addition of an external source of magnesium. In addition, a microfiltration system and/or an air stripper system may be used in fluid communication with at least one reverse osmosis system to produce a treatment water that meets state and federal guidelines for surface discharge.
US07718059B2
An apparatus for producing magnetized water. The apparatus comprises a plurality of magnet bars arranged in a radial manner, in which each magnet bar is structured such that a plurality of neodymium based permanent magnets is stacked in a stainless steel pipe in a manner such that like poles of the permanent magnets face each other. Thanks to this structure, the apparatus has a large contact area between the magnetic field and water flowing through the apparatus, thereby activating water by changing the structure of water. In more detail, the apparatus comprises a magnet bunch including a plurality of fixed magnet bars, a plurality of standard magnet bars, an upper plate disposed on upper ends of the fixed and standard magnet bars, a lower plate disposed on lower ends of the fixed and standard magnet bars, and a spacing plate disposed between the upper and lower plates; a housing having a cylindrical main body for enclosing the magnet bunch therein, an opening in an upper end portion thereof, and a lower part having a funnel shape and a liquid passage; and a cover 50 for covering the opening of the housing, the cover being coupled to the housing in a detachable manner and having a funnel shape and a liquid passage.
US07718039B2
A process for reactive distillation wherein a carboxylic acid is reacted in a reaction section of a reactive distillation column with an alcohol under esterifying conditions in the presence of a catalyst to form an ester, wherein a first supply stream comprising the carboxylic acid, a second supply stream comprising the alcohol and a third supply stream comprising an inert entrainer are supplied to the reactive distillation column, wherein the first supply stream is supplied to the column at a first entry level located just above or at the top of the reaction section, the second supply stream is supplied to the column at a second entry level located in or just below the reaction section and below the first entry level, and the third supply stream is supplied to the column at a third entry level located in or below the reaction section and not above the second entry level and wherein a bottom stream comprising the ester formed and unreacted carboxylic acid is obtained and a top stream comprising unreacted alcohol, water and entrainer is obtained.
US07718035B2
An improved creping adhesive is prepared by first reacting a dibasic carboxylic acid, or its ester, half-ester, or anhydride derivative, with a polyalkylene polyamine, preferably in aqueous solution, under conditions suitable to produce a water soluble polyamide. The water-soluble polyamide is then reacted with an epihalohydrin until substantially fully cross-linked, and stabilized by acidification with phosphoric acid at the end of the polymerization reaction to form a water-soluble poly(aminoamide)-epihalohydrin creping adhesive that is re-wetable and facilitates water spray removal of buildup so as to lengthen the life of the creping blades, with attendant significant decrease in downtime and maintenance.
US07718034B2
A refiner steam separation system according to the present invention includes a blowline for transporting a mixture of fiber material from a refiner to an inlet of a steam separator. Waste steam is discharged from the separator through a waste steam outlet. Cleaned fiber material is discharged from the separator through an exit, which prevents a substantial portion of the waste steam from passing through the exit. A relay pipe communicates with the exit and a dryer duct, and transports cleaned fiber material therebetween. A resin input communicates with the relay pipe, and supplies resin therein. The resin is mixed with the cleaned fiber material prior to the cleaned fiber material being dried in the dryer duct. The present invention is also directed to a method of reducing VOC emissions generated during refining cellulosic fibrous material.
US07718028B2
A process for forming fluid filled units is disclosed. In the process, a web having a series of side connected pouches are fed to an inflation station. The pouches are connected by a line of perforations. First perforations of the line of perforations that extend from an inflation opening of each pouch are shorter than second perforations of the line of perforations that extend from the first perforations toward a side edge of each pouch. The pouches filled with fluid and sealed to form fluid filled units.
US07718016B2
Methods of making multilayered, hydrogen-containing intermetallic structures including at least two adjacent metal layers are disclosed. At least one of the metal layers contains hydrogen, which can be introduced into the metal by plasma hydrogenation. The intermetallic structures can have high hydrogen contents and micrometer-sized and nanometer-sized dimensions.
US07718014B2
The present invention provides a low alloy steel and a weld joint thereof excellent in hydrochloric acid corrosion resistance and sulfuric acid corrosion resistance, said low alloy steel containing, in mass, C: 0.001 to 0.2%, Si: 0.01 to 2.5%, Mn: 0.1 to 2%, Cu: 0.1 to 1%, Mo: 0.001 to 1%, Sb: 0.01 to 0.2%, P: 0.05% or less, and S: 0.05% or less, with the balance consisting of Fe and unavoidable impurities; and the acid corrosion resistance index AI of said low alloy steel being zero or positive. Here, said AI is given by the following expression, AI/10,000=0.0005+0.045×Sb %−C %×Mo %, where % means mass %.
US07718012B2
A method of improving the effectiveness of semiconductor cleaning solvents is provided. Insoluble gas bubbles, typically air, hinder wet chemical cleaning methods. Preferred embodiments include purging a first, insoluble gas from the cleaning system and replacing it with a second, soluble gas. After replacing the first gas with the second gas, the wafer is rinsed in the cleaning solvent. Any gas bubbles trapped within narrow, recessed features during cleaning rapidly dissolve due to the second gas's solubility. Temperature adjustments during the process may further enhance cleaning.
US07718007B2
A substrate supporting member, and a substrate processing apparatus including the substrate supporting member are provided. The substrate supporting member for mounting and supporting a substrate on a substrate supporting surface thereof, and controlling a temperature of the substrate by thermal transfer between the substrate and the substrate supporting surface, wherein the substrate supporting surface is smaller than the substrate, and includes a central region, an intermediate region, and a peripheral region. A thermal conductivity between the substrate and the peripheral region is greater than that between the substrate and the central region which is greater than that between the substrate and the intermediate region located between the central region and the peripheral region.
US07718005B2
Film forming equipment (20) is provided with a treatment container (22), a gas supplying system for supplying the container with a treatment gas including a film forming gas, and an exhaust system for exhausting the atmosphere in the container. In the treatment container, a placing table (46) having a placing plane for placing a flat board shaped body to be treated (W) is arranged. The body to be treated on the placing table is heated by a heater (80). A clamping apparatus (56) is provided to abut/separate to and from a surface peripheral part of the body to be treated, so as to press/release the body to be treated on and from the placing table. On the placing plane of the placing table, a suction structure (92) having a recessed part (94) is formed for temporarily sucking the body to be treated by pressure difference, by forming a substantially hermetic space between the placing plane and the rear plane of the body to be treated.
US07718002B2
A crystal manufacturing apparatus for manufacturing a group III nitride crystal includes a crucible that holds a mixed molten liquid including an alkali metal and a group III metal; a reaction vessel accommodating the crucible in the reaction vessel; a heating device that heats the crucible with the reaction vessel; a holding vessel having a lid that is capable of opening and closing, accommodating the reaction vessel and the heating device in the holding vessel; a sealed vessel accommodating the holding vessel in the sealed vessel, having an operating device that enables opening the lid of the holding vessel for supplying source materials into the crucible and taking out a manufactured GaN crystal under a sealed condition, and closing the lid of the holding vessel that is sealed in the sealed vessel, the sealed vessel including an inert gas atmosphere or a nitrogen atmosphere; and a gas supplying device for supplying a nitrogen gas to the mixed molten liquid through each of the vessels.
US07718000B2
One provides (101) disperse ultra-nanocrystalline diamond powder material that comprises a plurality of substantially ordered crystallites that are each sized no larger than about 10 nanometers. One then reacts (102) these crystallites with a metallic component. The resultant nanowire is then able to exhibit a desired increase with respect to its ability to conduct electricity while also substantially preserving the thermal conductivity behavior of the disperse ultra-nanocrystalline diamond powder material. The reaction process can comprise combining (201) the crystallites with one or more metal salts in an aqueous solution and then heating (203) that aqueous solution to remove the water. This heating can occur in a reducing atmosphere (comprising, for example, hydrogen and/or methane) to also reduce the salt to metal.
US07717996B2
A sprayable coating agent is disclosed in the form of granules with which the granules are compacted to form a pressed piece, subsequently ground up and optionally sieved, whereby the granules have the following particle-size distribution: 0%-40% by weight: 0-600 microns; 5%-55% by weight: 600-1250 microns; 5%-95% by weight: >1250 microns; or 15% by weight: 0-800 microns; 0%-85% by weight: 800-2000 microns; 0%-15% by weight: >2000 microns. Likewise disclosed are its production, further processing and use for internal and external applications.
US07717980B2
A contaminant extraction apparatus, systems and method for extracting contaminants, such as particles and polar molecules, from an air flow containing a contaminated gas such as air so that the contaminants are expelled from the embodiments after they are extracted. One method includes the steps of generating two electric fields in separate air flow channels separated by an extraction grid with the second electric field having a greater potential difference than the first electric field; generating a first air flow through the first air flow channel and a second air flow through a second air flow channel; dispensing charged liquid droplets into the first air flow using at least one charged droplet generator; allowing the droplets to transfer charge to those contaminants; and expelling the contaminants into the second air flow using the potential difference in the second electric field.
US07717977B2
The producing unit for continuously producing metal microparticles formed of a multicomponent alloy accompanied by the generation of a byproduct gas through an early reaction of the formation of the metal particles comprises a first mixing unit for continuously supplying and mixing a plurality of solutions for conducting the early reaction, a second mixing unit for continuously supplying another solution to the reaction liquid containing the metal microparticles formed in the early reaction and for mixing the two solutions, to introduce dissimilar metal atoms into the crystal lattices of the metal microparticles, and a gas-liquid separation unit that is installed in a midway of the pipe which is made so as to have enough length to finish the early reaction, and which continuously passes the reaction liquid to the second mixing unit from the first mixing unit, and that continuously removes the byproduct gas generated with the proceeding of the early reaction.
US07717976B2
A method for making a strain aging resistant steel comprises adding boron to the steel, wherein substantially all of the boron in the steel forms boron nitride. A method for making steel comprises adding a nitride-forming element to the steel to lower the free nitrogen content of the steel to a free nitrogen content specification. A high-carbon steel contains boron nitride, wherein the free nitrogen content of the steel is less than 80 ppm. A strain aging resistant steel wherein the carbon content of the steel is between about 0.54 percent and about 0.75 percent.
US07717973B2
A cyclone dust-separating apparatus includes a cyclone unit having air inflow and air outflow parts that separate dust or dirt from air, the cyclone unit being installed such that a longitudinal axis thereof is substantially horizontally arranged; a dust bin joined to a bottom end of the cyclone unit that collects the dust or dirt separated by the cyclone unit, the dust bin installed in such a manner that a longitudinal axis thereof is substantially perpendicular to the longitudinal axis of the cyclone unit; a nonporous envelope detachably disposed in the dust bin that stores the dust or dirt collected into the dust bin; and a pressure difference-generating passage to communicate an outlet of the air outflow part and the dust bin with each other so as to allow the nonporous envelope to come in contact with an inner surface of the dust bin by a pressure difference between the dust bin and the air outflow part.
US07717964B2
The disclosure relates to the dyeing of keratin materials using styryl hydroxy(cyclo)alkylamino thiol/disulfide fluorescent dyes. Disclosed herein is a dye composition comprising a styryl hydroxy(cyclo)alkylamino thiol/disulfide fluorescent dye and a dyeing process with, for example, a lightening effect on keratin materials such as hair, using said composition. Disclosed herein are novel thiol/disulfide fluorescent dyes and the uses thereof in lightening keratin materials. This composition makes it possible to obtain a lightening effect which can be resistant and visible on dark keratin fibers.
US07717958B2
A spinal mobility preservation apparatus and methods are disclosed. The spinal mobility preservation apparatus may include a proximal body, an intermediate body, a distal body, and an expandable membrane. The proximal body and the distal body secure the mobility preservation apparatus to adjacent vertebral bodies. At least one of an intermediate body and an expandable membrane secure the proximal body to the distal body and provide a degree of support to a spinal motion segment defined by the adjacent vertebral bodies. A single proximal body and an expandable membrane may also compose a spinal mobility preservation apparatus. The proximal body secured to one of a superior or an inferior vertebral body and the expandable membrane extending into the intervertebral disc space to support the spinal motion segment.
US07717941B2
A linking element for a spinal fixing system is designed to link at least two implantable connecting assemblies. The linking element is formed at least partly of a support made of polymeric material and of two rods with a first rod, bent or not, substantially coaxial with the support, and a second rod formed of turns surrounding the first rod with the turns being at least partly embedded in the support. A spinal fixing system has at least two implantable connecting assemblies linked by at least one linking element.
US07717936B2
A transvascular embolic protection system for safely capturing and retaining embolic material released during an interventional procedure comprises an embolic protection device (1) and a delivery catheter (2) for delivery of the embolic protection device (1) to a desired location in the vascular system. A pack (4) is provided to safely store and prepare the embolic protection system for use. The pack (4) comprises a tray (5) with a channel (6) extending in a looped configuration around the tray (5) for receiving the delivery catheter (2). A loading device (7) is mounted in the tray (5) adjacent to the delivery catheter (2). The embolic protection device (1) is mounted in an expanded configuration in a well (90) in the tray (5). A pushing device (8) for loading the collapsible embolic protection device (1) into the delivery catheter (2) is mounted in the tray (5) adjacent to the embolic protection device (1).
US07717934B2
Catheters, assemblies, and methods for delivering and recovering embolic protection devices. Catheters are provided that can be advanced over single length guide wires and which can be retracted over single length wire shafts of distal embolic protection devices. One catheter is a two-port catheter having two sidewall ports, a distal end port, and a proximal end port. The two-port catheter can be advanced over a guide wire threaded between the distal end port and the distal sidewall port. An embolic protection device wire shaft can be back loaded into the distal end port and out the proximal sidewall port. A three-port catheter includes a distal end port, and distal, intermediate, and proximal sidewall ports. The distal sidewall port can be dimensioned to accept passage of a filter body through the port. The distal end port can be dimensioned to accept only a guide wire to provide a smooth transition from the guide wire to the small profile distal end. The guide wire can extend between the distal end port and the intermediate port while the filter body shaft can extend through the proximal port, to be distally urged through the distal sidewall port. Another catheter embodiment is a slotted catheter, including a biased, normally open slot over most of its length. The slot can be sufficiently small to resist unwanted transverse movement of a wire through the slot. The slotted catheter can be retracted over a wire by forcing the wire through the resilient slot.
US07717928B2
A surgical tool which comprises an elongated body having a proximal end and a distal end, first and second sets of tissue approximating structures having deployed and retracted positions relative to the elongated body, an actuating mechanism extending from the proximal end of the elongated body for independently deploying and retracting each of the first and second sets of tissue approximating structures, a drainage lumen extending from a drainage aperture at the distal end of the elongated body to the proximal end, a main balloon adjacent to the distal end of the elongated body, and a strap connector extending from the elongated body that is connectable with a stabilization strap.
US07717923B2
Over-the-scope stent introducers for detachably engaging at least a portion of the outside of an endoscope insert and for delivering a stent are provided. Embodiments include an inner member having a distal first end portion and a proximal second end portion and openings defining a channel. The inner member includes an outer surface, inner endoscope engaging surface, and stent abutting restraint disposed at the first end portion. Embodiments also include an outer member having a distal section and proximal section having openings defining a passageway sized to slideably receive at least a portion of the inner member, and a stent carrying inner chamber disposed at the distal section passageway and being configured to releasably contain a stent. In alternative embodiments, the inner and outer members are elongated to dispose substantially concentrically over a majority of an endoscope insert.
US07717920B2
A prosthesis is installed in a cavity that traverses a joint between a talus and a calcaneus. The cavity is established by intramedullary guidance with respect to the major axis of the tibia by access through the calcaneus.
US07717916B2
An external fixation device for holding bone fragments in place includes a housing having a number of rotationally adjustable pin holders, each of which is held by a clamping member that simultaneously clamps the pin holder within an internal mounting surface of the housing and a bone pin within the pin holder. A first embodiment includes a number of internal mounting surfaces, each of which can include a single pin holder. A second embodiment includes one or two internal mounting surfaces, each of which holds a row of pin holders that is clamped in place by a single clamping member.
US07717915B2
An ultrasonic coagulation and cutting apparatus includes: an ultrasonic transducer for a treatment using ultrasonic vibrations on body tissue; a probe for transmitting generated ultrasonic vibrations to the distal end thereof; a movable gripping member for cooperating with the outer surface of the probe in gripping therebetween body tissue; an operation unit operated to move the gripping member; an operation transmitting member for transmitting the operation of the operation unit to the gripping member; and high frequency power supply connecting portions for electrically connecting the probe and the gripping member to predetermined portions of a high frequency power supply for a treatment using high frequency current on the body tissue. At least coagulation of the body tissue using high frequency current is started in a first gripping state. Cutting of the body tissue using ultrasonic vibrations generated by the ultrasonic transducer is started in a second gripping state.
US07717913B2
A surgical instrument comprises, in accordance with the present invention, an elongate probe, a sleeve, a sleeve extension and at least one cauterization electrode. The probe is an ultrasonic element, serving to convey ultrasonic vibrations (as standing waves) to organic tissues at a surgical site. The probe has a working tip and a longitudinal axis. The sleeve surrounds the probe with the working tip of the probe projecting from a distal or free end of the sleeve. The sleeve extension is disposed at the distal or free end of the sleeve and defines a multiplicity of apertures having respective axes oriented at least substantially parallel to the longitudinal axis. The electrode has a distal or free end removably inserted through one of the apertures.
US07717912B2
The present invention provides systems, apparatus and methods for selectively applying electrical energy to body tissue in order to ablate, contract, coagulate, or otherwise modify a target tissue or organ. The closed configuration is adapted for clamping and coagulating a target tissue while the apparatus is operating in the sub-ablation mode, while the open configuration is adapted for ablating the target tissue via molecular dissociation of tissue components. A method of the present invention comprises clamping a target tissue or organ with an electrosurgical probe. A first high frequency voltage is applied between the active electrode and the return electrode to effect coagulation of the clamped tissue. Thereafter, a second high frequency voltage is applied to effect localized molecular dissociation of the coagulated tissue.
US07717905B2
A system and method for performing laser induced optical breakdown (LIOB) in corneal tissue of an eye requires calculating a pattern of focal spots. LIOB is then induced at a first focal spot, and is continued at a plurality of interim focal spots within a time period τ. Each focal spot has a diameter “d1” and generates a temporal cavitation bubble of diameter “d2”. It then collapses within time “τ” to a substantially stationary diameter “d3”, with (d1≦d3≦d2). Importantly, each focal spot is located more than “d2” from every other interim focal spot within the time period of “τ”. At the time “τ”, a second focal spot in the pattern can be generated at a distance “d3” from the first focal spot. This process is then continued with another plurality of interim focal spots being generated within another time period “τ”.
US07717902B2
A catheter for draining urine from the bladder and which is composed of a flexible plastic tube (1) having an insertion aid (2) secured to the insertion end of the tube. Thus the insertion aid and tube may be inserted into the urethra and guided therethrough into the bladder. The tube (1) has at least one orifice (4) in the region adjacent the insertion aid (2). Also, the insertion aid (2) connects with essentially the same diameter to the tube (1) and ends with a rounded head portion (3), whose diameter may be slightly larger than the diameter of the tube (1). The insertion aid may be significantly more flexible as compared to the tube.
US07717897B2
A flexible non-PVC, non-DEHP polyolefin container or bag for medical fluids has an elongated container body formed of polyolefin film. The container has one or more ports equipped with a polyolefin fill tube and port closure assembly. The container includes a concave seam on at least one of its longitudinal sides.
US07717894B2
A liquid-absorbent sheet containing: a liquid-absorbent surface material mainly containing a pulp; a liquid-absorbent nonwoven fabric; a liquid-absorbent rear material mainly containing a pulp; and a super absorbent polymer; wherein the super absorbent polymer is disposed at least between the liquid-absorbent surface material and the liquid-absorbent nonwoven fabric as an A layer and between the liquid-absorbent nonwoven fabric and the liquid-absorbent rear material as a B layer, the super absorbent polymer being contained in a total amount of 200 to 400 g/m2, which is allocated in the A layer at 30 to 50% by mass, the liquid-absorbent nonwoven fabric layer at 0 to 40% by mass, and the B layer at 30 to 70% by mass, and the content ratio of the super absorbent polymer in the A layer is less than or equal to the content ratio of the super absorbent polymer in the B layer.
US07717888B2
The Huber needle is drawn into a protective cap and sheath arrangement after use for disposal purposes. The cap is tethered to a housing in which the needle is mounted by the sheath. The sheath is made of a film material that has a high tensile strength and a low percent of elongation, such as polyester. The sheath is initially mounted about the needle in a collapsed accordion-like condition between the cap and housing. When the cap is moved along the needle, the sheath is played out over the needle. The cap houses a spring clip to snap over a bore through which the needle is retracted to prevent re-emergence of the needle. The flexible nature of the sheath allows the sheath to pass about the two legs of the Huber needle.
US07717886B2
A closed system, needleless valve device includes a generally tubular body defining an internal cavity. On the proximal end of the body there is an opening which is preferably sufficiently large to receive an ANSI standard tip of a medical implement. The distal end of the body has a generally tubular skirt. The valve also includes a hollow spike having a closed tip. The spike includes at least one longitudinal 18-gauge hole located distal the tip, and is seated inside the cavity such that the tip is below the proximal end of the body. An annular support cuff is connected to the spike which seals off a portion of the cavity of the body such that an upper cavity containing the tip is defined. The valve also includes a plastic, resilient silicone seal which fills the upper cavity and opening and covers the tip of the spike so as to present a flush surface. An adaptor enables the valve to be attached to a resealable container.
US07717876B2
The invention relates to a perfected retractable needle safety syringe comprising a hollow cylinder, a needle holder, a needle and a piston with an operating stem, said stem exhibiting an axial hole wherein there are seated a retraction pre-loaded spring and an extractor element. The extractor element exhibits a recess or seat intended for interacting with the needle holder, and at the side opposite the needle holder, a projection or annular rib.
US07717875B2
A hydraulically assisted actuator in a handle connects with a catheter having a deflectable distal ablation tip. The hydraulic actuator translates small mechanical movement by a clinician into large travel movements of connected steering cables and increased tension in the ablation tip for greater deflection. The hydraulic system further dampens the return of the ablation tip from a deflected position to an equilibrium position. The hydraulic actuation system is also incorporated into a set of foot pedals.
US07717865B2
A side loading, wire torquing device includes a body portion having a channel in which a wire is fitted. In one embodiment, a slider is movable along the channel to secure the wire between the slider and the fixed surface in the channel such that rotation of the torquing device rotates the wire therein. In another embodiment of the invention, the torquing device includes a bottom and top section folded over a wire. In another embodiment, the channels impart a bend to the wire to increase the effective torque that can be applied to the wire by rotating the device. In yet another embodiment, the torquing device has a tapered shape and includes a ring that is slideable over the device to compress a wire in a channel. In all embodiments, the torquing device may include a clip to secure several looped coils of wire when not in use.
US07717860B2
An elliptical biopsy guide comprises a platform and a pair of wings extending from the platform. Each of the wings terminates in a respective curved member. The platform defines a plane, and comprises beveled aperture edges defining an aperture. Each of the aperture edges has a generally elliptical curvature. Each of the wings is angled relative to the plane defined by the platform. A user may exert outward forces with first and second fingers against the insides of respective curved members to hold the elliptical biopsy guide. The elliptical biopsy guide may be positioned over a biopsy site, and a downward force may be applied with the elliptical biopsy guide to provide skin tension or hemostasis. The aperture may be used as a template for excising tissue at the biopsy site.
US07717859B2
A combination electronic communication and medical diagnostic apparatus includes a first component for transmitting or receiving a remote communication signal and a second component for generating vibration to be used in a medical diagnosis. The apparatus functions as a beeper/pager or cellular phone, as well as a medical diagnostic tool to detect and/or monitor neuropathy.
US07717858B2
Apparatus for improving health of a user is provided, including a first sensor, adapted to measure a first physiological variable, which is indicative of a voluntary action of the user. A second sensor is adapted to measure a second physiological variable, which is substantially governed by an autonomic nervous system of the user. Circuitry is adapted to receive respective first and second sensor signals from the first and second sensors, and, responsive thereto, to generate an output signal which directs the user to modify a parameter of the voluntary action.
US07717853B2
A method for delivering ultrasound energy to a patient's intracranial space involves forming at least one hole in the patient's skull, advancing at least one ultrasound delivery device at least partway through the hole(s), and transmitting ultrasound energy from the ultrasound delivery device(s). According to various embodiments, ultrasound delivery devices may be advanced into the epidural space, one or both ventricles and/or an intracerebral space of the patient's brain. In alternative embodiments, one or multiple holes may be formed in the skull, and any number of ultrasound delivery devices may be used. Intracranial ultrasound delivery may be used in diagnostic or therapeutic treatment of ischemic stroke, head trauma, atherosclerosis, perfusion disorders and other acute or chronic neurological conditions.
US07717850B2
The visibility of features in ultrasound images that include at least two types of tissue can be improved by processing the images using a variety of algorithms. In one such algorithm, the ratio of power in a first spatial frequency band to power in a second spatial frequency band is computed for a plurality of samples of a received ultrasound return signal that are associated with a given pixel. In another such algorithm, the ratio of power in a first spatial frequency band to total power is computed. With both algorithms, the computed ratio is then mapped to a gain for the given pixel, the raw intensity of the given pixel is modified in accordance with the gain, and the pixel is displayed with the modified intensity.
US07717840B2
The present invention relates to a soft roll material-translating device for the mechanical apparatus of machining and cutting after severing. The existing pillow type of automatic packing machine can only pack produces using one single roll of film, so the work efficiency is low. Consequently, the present invention aims at improving the work efficiency and it adopts following technical solutions: the soft roll material-translating device includes a frame (1), a right rotating unit (3) with right folding rod pair (5) and a left rotating unit (2) with left folding rod pair (4) are mounted on the frame (1), the right rotating unit (3) and the left rotating unit (2) can both rotate around a rotating center. By adding a few of mechanisms, the work efficiency of the device can be multiplied one times.
US07717837B2
Facilitating exercise using easy to transport and easy to assemble components and, when assembled, providing a portable apparatus on which a human can engage in a wide variety of exercises. Support elements including vertical components are supported on bases. Collars slideably insert over the support elements and further include bar supports for receiving one or more stabilizers. The stabilizers join the support elements and the bases forming a system base.
US07717836B1
Exercise apparatus is provided with a system for collapsing a user seat to a stow-away position. A user-engaged locking device releasably locks a bearing assembly and a seat frame at each of a user-exercise position and a stow-away position.
