US10223387B2
An approach to managing a relational database. The relational database comprises a first table defining a primary key, and at least one other table with a foreign key constraint referencing the primary key. The data of the first table and at least one other table is divided into a plurality of partitions, each containing data associated with a subset of primary key values. Receiving a partition management policy, defining one or more conditions for the first table and at least one other table and an operation performed on the partitions of the first table and at least one other table. Determining if the first table and at least one other table satisfy the one or more conditions of the partition management policy, if not, performing the operation.
US10223386B2
A computer-implemented method for improving database management includes selecting one or more database records that are requested based on a query statement. The one or more database records may are read from a first database file. The one or more database records are copied from the first database file and stored to a memory. The one or more database records are deleted from the first database file at substantially the same time as the reading the one or more database records. The reading and the deleting occur through a single read and delete input/output (I/O) operation.
US10223383B2
Provided are user equipment, a control method thereof and a non-transitory computer readable storage medium having a computer program recorded thereon. That is, according to the present invention, an image at a specific time is searched by identifying and tracking a person included in a corresponding reference image among a plurality of images photographed at a predetermined time different than a photographing time of the corresponding reference image by using the reference image, and a search result is provided or the images are classified according to the search result to conveniently acquire a desired image search result through the reference image, thereby improving convenience of a user.
US10223371B2
Exemplary methods, apparatuses, and systems include a host computer detecting a request to utilize data stored at a storage address in an external storage device. The host computer, in response to the detected request, transmits a request to the storage device for a tag that uniquely identifies the data. The tag for the data is received from the storage device. In response to determining that the received tag matches a local mapping of tags stored in the host computer, the host computer utilizes the local mapping of tags to process the detected request.
US10223366B2
To prevent conflicts of interest, an information management system is used to make sure two or more groups are kept apart so that information does not circulate freely between these groups. The system has policies to implement an “ethical wall” to separate users or groups of users. The user or groups of user may be organized in any arbitrary way, and may be in the same organization or different organizations. The two groups (or two or more users) will not be able to access information belonging to the other, and users in one group may not be able to pass information to the other group. The system may manage access to documents, e-mail, files, and other forms of information.
US10223364B2
A method for managing a binary object in a database system is provided. The method may include receiving a request to store the binary object and determining if a size of the binary object is above a first threshold. If the size is less than the first threshold, the method may include storing the binary object in a database of the database system using a database communication protocol. If the size is above the first threshold, the method may include determining if the size is above a second threshold. To this end, if the size is less than the second threshold, the method may include storing the binary object in a file system of the database system using the database communication protocol. Furthermore, if the size is above the second threshold, the method may include storing the binary object in the file system using a file system communication protocol.
US10223361B2
Methods and systems for an object based storage are provided. As an example, a method for generating a metadata object for an archive data container having a plurality of data containers is disclosed. The method includes generating a first metadata signature for the archive data container using an archive data container identifier, a number of data containers within the archive data container, and placement information of each data container within the archive data container; assigning a plurality of blocks for storing data for the plurality of data containers at an object based storage to an intermediate logical object; updating a payload signature with placement information of the plurality of blocks within the intermediate logical object; and placing the first metadata signature and the updated payload signature within the metadata object, wherein the metadata object is used to retrieve location information for a specific data container within the archive data container.
US10223357B2
A filtering method and system. The method includes receiving by a computer processor an audio/video data file and filtering data. The computer processor analyzes the filtering data with respect to the audio/video data file and retrieves specified audio/video data portions comprising data objects within frames of the audio/video data file. The computer processor removes gaps existing in the audio/video data file and receives tags comprising instructions for presenting video data of the audio/video data file, audio data of the audio/video data file, and the specified audio/video data portions. The computer processor stores the video data in a first layer of a multimedia file, the audio data in a second layer of the multimedia file, and the specified audio/video data portions in additional layers of the multimedia file. Each of the first layer, the second layer, and the additional layers comprises a tag layer comprising the tags.
US10223355B2
A computer-implemented method for knowledge based ontology editing, is provided. The method receives a language instance to update a knowledge base, using a computer. The method semantically parses the language instance to detect an ontology for editing. The method maps one or more nodes for the ontology for editing based on an ontology database and the knowledge base. The method determines whether the mapped nodes are defined or undefined within the knowledge base. The method calculates a first confidence score based on a number of the defined and undefined mapped nodes. Furthermore, the method updates the knowledge base when the first confidence score meets a pre-defined threshold.
US10223354B2
Methods, systems, and computer-readable storage media for receiving a vocabulary that includes text data that is provided as at least a portion of raw data, the raw data being provided in a computer-readable file, providing word embeddings based on the vocabulary, the word embeddings including word vectors for words included in the vocabulary, clustering word embeddings to provide a plurality of clusters, each cluster representing an aspect inferred from the vocabulary, determining a respective association score between each word in the vocabulary and a respective aspect, and providing a word ranking for each aspect based on the respective association scores.
US10223353B1
Disclosed are various embodiments for identifying safety concerns by employing dynamic semantic analysis on natural language provided in free-text reviews of products. A computing environment may encode user interface data that causes an event listener to monitor a free-text description provided in a text field in a user interface. A semantic analysis may be performed on the free-text description in real-time as the free-text description is generated. Remedial actions may be performed based on the semantics identified in the free-text description or severity levels associated with identified safety concerns.
US10223348B2
A probabilistic content layout model generates pages. Each of a number of compositions flows over multiple of the pages, and one or more of the pages each has multiple breakpoints. Each breakpoint is defined in relation to a given composition, such that the breakpoint breaks the given composition on the page that includes the breakpoint and such that the given composition continues on, a subsequent page.
US10223347B2
In various embodiments, methods, systems, and non-transitory computer-readable media are disclosed that allow developers to place date pickers on columns, rows, and cells using a desktop integration framework. The date picker can be tied to components, forms, or model metadata. In one aspect, date picker metadata is provided separately from the document to which one or more date pickers will eventually be added.
US10223337B2
A system, method, and computer program product are provided for use in connection with at least one computer-readable Extensible Markup Language (XML)-compliant data document capable of including: a plurality offline items with a plurality of data values, and a plurality of computer-readable semantic tags that describe a semantic meaning of the data values.
US10223334B1
A native tensor processor calculates tensor contractions using a sum of outer products. In one implementation, the native tensor processor preferably is implemented as a single integrated circuit and includes an input buffer and a contraction engine. The input buffer buffers tensor elements retrieved from off-chip and transmits the elements to the contraction engine as needed. The contraction engine calculates the tensor contraction by executing calculations from an equivalent matrix multiplications, as if the tensors were unfolded into matrices, but avoiding the overhead of expressly unfolding the tensors. The contraction engine includes a plurality of outer product units that calculate matrix multiplications by a sum of outer products. By using outer products, the equivalent matrix multiplications can be partitioned into smaller matrix multiplications, each of which is localized with respect to which tensor elements are required.
US10223333B2
In one embodiment of the present invention a convolution engine configures a parallel processing pipeline to perform multi-convolution operations. More specifically, the convolution engine configures the parallel processing pipeline to independently generate and process individual image tiles. In operation, for each image tile, the pipeline calculates source locations included in an input image batch. Notably, the source locations reflect the contribution of the image tile to an output tile of an output matrix—the result of the multi-convolution operation. Subsequently, the pipeline copies data from the source locations to the image tile. Similarly, the pipeline copies data from a filter stack to a filter tile. The pipeline then performs matrix multiplication operations between the image tile and the filter tile to generate data included in the corresponding output tile. To optimize both on-chip memory usage and execution time, the pipeline creates each image tile in on-chip memory as-needed.
US10223332B2
Methods and systems for processing data are disclosed. An example method can comprise receiving first data. The method can comprise applying a first transform to the first data. The first transform can be evolved from a second transform. The first transform can be based on first coefficients and the second transform can be based on second coefficients. The first transform can be evolved without constraining a count of the first coefficients to be equal to a count of the second coefficients. The method can comprise providing the transformed first data.
US10223326B2
Techniques are described for providing one or more remote nodes with direct access to persistent random access memory (PRAM). In an embodiment, registration information is generated for a remote direct access enabled network interface controller (RNIC). The registration information associates an access key with a target region in PRAM. The access key is sent to a remote node of the one or more nodes. The RNIC may subsequently receive a remote direct memory access (RDMA) message from the remote node that includes the access key. In response to the RDMA message, the RNIC performs a direct memory access within the target region of PRAM.
US10223322B2
Embodiments are related to systems and methods for data transfer, and more particularly to systems and methods for providing non-standard bus information.
US10223307B2
Embodiments include a technique for management of data transactions, where the technique includes receiving, at a link interface, a packet from an I/O device, wherein the packet includes address information, and performing, by a host bridge, an address translation for the address information included in the packet. The technique also includes responsive to performing the address translation, determining a target page associated with a translated address of the packet is for at least one of a payload target page or a signaling target page, and appending a flag to a command based at least in part on the target page being associated with the translated address of the packet. The technique includes transmitting the command to an ordering controller for ordering the packet.
US10223305B2
A computing system includes a processor and a memory unit that stores program instructions. The system purges an entry from an address translation cache in response to the processor executing the program instructions to perform issuing, via an operating system running on the computing system, a command indicating a request to perform an I/O transaction requiring a translation entry. A host bridge monitors a total data length of the address translation entry to be transferred during the I/O transaction. An address translation entry is selected from an address translation table, loaded into the address translation cache, and data corresponding to the I/O transaction is transferred using the selected address translation entry. The host bridge automatically purges the selected address translation entry from the address translation cache in response to determining the transferred amount of data matches the total data length for the address translation entry.
US10223304B2
A microcomputer includes a central processing unit (CPU) and a data transfer controller (DTC). The data transfer controller (DTC) reads out data transfer information including transfer mode information from a storage device (RAM) or the like. The data transfer controller (DTC) analyzes the transfer mode information to change at least one of a transfer source address, a transfer destination address, the number of transfer operations, and data transfer information that is used next.
US10223302B2
Systems and methods for implementing a user mode virtual serial communications port emulator are disclosed herein. According to an aspect, a method for a virtual serial communications port emulator includes using at least one processor and memory for creating a virtual serial communication port (VCP) driver in a user mode of an operating system. The method further includes emulating a physical serial communication port using the VCP driver. In addition, the method includes converting outgoing data from an application executed on the at least one processor and memory via the VCP driver into a format complying with a protocol associated with a VCP device server. The method also includes converting incoming data from the VCP device server complying with the protocol into a second format understood by the application, wherein the VCP driver is communicated with using an unpublished universally unique identifier (UUID).
US10223295B2
A data processing machine is configured to automatically keep track of hypervisor given pointers pointing to respective and newly allocated areas of memory and to automatically keep track of corresponding copies or derivatives of the given pointers. A unique allocation identifier is generated for each newly allocated area. The allocation identifier is appended to a valid ID's holding list. All pointers pointing to the allocated area are tracked by a protected pointers tracking table. Additionally, a multi-input associative cache stores entries for recently used ones of the protected pointers where the entries include the respective allocation identifiers of the pointers. All pointers to a given, de-allocated area can be invalidated by deleting their entries form the multi-input associative cache and by deleting the corresponding unique allocation identifier from the valid ID's holding list.
US10223292B2
Described are examples for securing stream data received from a stream source. A secure mode can be enabled, based on a request from an application, for storing the stream data captured from the stream source in a secured buffer. The secured buffer can be allocated in a secure memory based at least in part on enabling the secure mode. A secured buffer identifier of the secured buffer can be provided to a driver of a device providing the stream source for storing the stream data captured from the stream source in the secured buffer. The secured buffer identifier of the secured buffer can also be provided to the application for accessing the stream data stored in the secured buffer.
US10223291B2
A computing device comprises: a memory; a processor; an interpreter; and a Memory Management Unit. The interpreter is for controlling the processor to execute a program comprising at least one first instruction in a format that is not native to the processor and at least one second instruction in machine code that is native to the processor. The Memory Management Unit is adapted to control access by the processor to the memory and possibly also to peripherals when the at least one second instruction is executed.
US10223289B2
In an aspect, a cache memory device receives a request to read an instruction or data associated with a memory device. The request includes a first realm identifier and a realm indicator bit, where the first realm identifier enables identification of a realm that includes one or more selected regions in the memory device. The cache memory device determines whether the first realm identifier matches a second realm identifier in a cache tag when the instruction or data is stored in the cache memory device, where the instruction or data stored in the cache memory device has been decrypted based on an ephemeral encryption key associated with the second realm identifier when the first realm identifier indicates the realm and when the realm indicator bit is enabled. The cache memory device transmits the instruction or data when the first realm identifier matches the second realm identifier.
US10223285B2
A data storage device utilized for storing at least one data includes a memory and a controller. The memory includes a plurality of blocks, and each of the blocks has a different respective physical address. The controller is coupled to the memory for mapping the physical addresses to a plurality of logical addresses. After the controller receives a conversion-requesting instruction, it converts a specific logical address from being mapped to a first physical address to being mapped to a second physical address.
US10223282B2
Disclosed aspects relate to memory affinity management in a shared pool of configurable computing resources that utilizes non-uniform memory access (NUMA). An access relationship is monitored between a set of hardware memory components and a set of software assets. A set of memory affinity data is stored. The set of memory affinity data indicates the access relationship between the set of software assets and the set of hardware memory components. Using the set of memory affinity data, a NUMA utilization configuration with respect to the set of software assets is determined. Based on the NUMA utilization configuration, a set of accesses pertaining to the set of software assets and the set of hardware memory components is executed.
US10223281B2
Increasing the scope of local purges of structures associated with address translation. A hardware thread of a physical core of a machine configuration issues a purge request. A determination is made as to whether the purge request is a local request. Based on the purge request being a local request, entries of a structure associated with address translation are purged on at least multiple hardware threads of a set of hardware threads of the the machine configuration.
US10223278B2
Systems and methods are directed to selectively bypassing allocation of cache lines in a cache. A bypass predictor table is provided with reuse counters to track reuse characteristics of cache lines, based on memory regions to which the cache lines belong in memory. A contender reuse counter provides an indication of a likelihood of reuse of a contender cache line in the cache pursuant to a miss in the cache for the contender cache line, and a victim reuse counter provides an indication of a likelihood of reuse for a victim cache line that will be evicted if the contender cache line is allocated in the cache. A decision whether to allocate the contender cache line in the cache or bypass allocation of the contender cache line in the cache is based on the contender reuse counter value and the victim reuse counter value.
US10223262B2
Apparatuses, systems, methods, and computer program products are disclosed for managing a journal. A method may include reordering storage commands based on different storage volumes associated with the storage commands. A method may include reordering storage commands based on different snapshots associated with the storage commands. A method may include adjusting a frequency of writing data from a write buffer based on a rate of write requests. A method may include adjusting a ratio of storage capacity for storing mirrored write data to storage capacity for storing non-mirrored read data.
US10223256B1
A distributed parallel processing database that processes data in a Java environment allocates memory both on a Java heap and off a Java heap. The distributed parallel processing database includes multiple servers. Each server executes a Java virtual machine (JVM) in which data allocated to the server is processed. When a JVM of a server starts, the JVM can specify an off-heap memory size, based on a JVM start parameter. The server can designate memory of the specified size that is off JVM memory heap as off-heap memory. The off-heap memory is different from heap memory in the Java environment, and is managed by a garbage collector that is outside of the Java environment. The server can process data designated as off-heap memory eligible in the off-heap memory. The off-heap memory can improve database operations that create a large number of similar-sized objects in memory by reducing Java memory management overhead.
US10223237B2
A system for performing mid-method instrumentation includes a processor; a memory; and one or more modules stored in the memory and executable by a processor to perform operations including: obtain bytecode representation of an application; identify a method in the bytecode including a beginning and an end of the method; identify lines of bytecode between the beginning and the end of the identified method; identify one or more of the lines of bytecode between the beginning and the end of the method to instrument with one or more interceptors; during runtime of the application, instrument the identified one or more of the lines of bytecode between the beginning and the end of the identified method by apply the one or more interceptors; and during the runtime of the application, receive information associated with the instrumented one or more lines of bytecode between the beginning and the end of the method.
US10223231B1
Exemplary systems, apparatus, and methods may write data to data blocks defining health levels corresponding to the quality-of-service levels of the data. Further, when health levels of the data blocks change over time, the data may be moved in an attempt to maintain the data in data blocks defining health levels that correspond to the quality-of-service levels of the data.
US10223228B2
Systems and methods for resolving application multitasking degradation are disclosed. In aspects, a computer implemented method is used with a user device including a multitasking operating system, shared user device resources, a first application and a second application. The method includes: running, simultaneously, the first application and the second application; measuring performance parameters for one or more application tasks of the first and second applications; and determining that one or more of the performance parameters of the one or more application tasks falls below a performance threshold value of an associated key performance indicator (KPI). The determination indicates degradation in performance of at least one of the first application and second application. The method further includes instructing the operating system to modify an allocation of the shared user device resources to address the degradation in performance of the at least one of the first application and second application.
US10223226B2
Disclosed aspects relate to controlling an electronic circuit having multiple units with at least one signal input each. A set of signal resources is determined by tracing back a dependency tree for each unit signal input until an endpoint representing a signal resource is reached. For each signal resource in the set a resource manager may be provided in dependence of its signal type. That resource manager may be assigned a set of signal inputs comprising each signal input in the circuit which was traced back to its respective signal resource. The resource manager is configured for controlling the signal resource. A control device may be provided to receive technical implementation requirements for one or more of the resource managers, detect conflicting requirements received for the one or more resource managers, and enable or disable one or more of the resource managers in response to the detected conflicting requirements.
US10223217B2
An information processing device includes at least a first storage device and a second storage device each to store a boot program, a first processor to read the boot program from the first storage device to boot the information processing device from the first storage device, and a second processor connected to each of the first storage device and the second storage device and the first processor. The second processor detects a completion or a failure of the boot from the first storage device, and when detecting the failure of the boot, switches a storage device to be used for booting from the first storage device to the second storage device to control the first processor to read the boot program from the second storage device.
US10223208B2
Techniques are disclosed relating to writing data atomically to one or more recording media. In one embodiment, a request is received to perform an atomic write for a set of data. Responsive to the request, the set of data is written across a plurality of storage units including storing metadata at a dedicated location within at least one of the plurality of storage units. The metadata is usable to determine whether the writing completed successfully. In some embodiments, the request is received from an application that has been assigned an address range of the plurality of storage units. In such an embodiment, the address range is accessible to the application for storing data, and the dedicated location resides outside of the address range. In one embodiment, the metadata specifies an address range where the set of data was written and a sequence number.
US10223205B2
Various embodiments for failure recovery in a computing environment following a data restoration are provided. A catalog locate is performed for each of a plurality of data sets on a base catalog structure (BCS), identifying a plurality of BCS entries. If a first BCS entry is cataloged incorrectly, the first BCS entry is designated to be re-cataloged. The plurality of BCS entries is compared with a plurality of volume table of contents and a plurality of VSAM volume data set (VTOC/VVDS) entries. If a second BCS entry found in the plurality of BCS entries is not found in the plurality of VTOC/VVDS entries, and the second BCS entry indicates that a data set associated with the second BCS entry is located on a volume, an attempt is made to vary on the volume. If the volume cannot be varied on, a request is created to restore the volume.
US10223203B2
Aspects of the present disclosure relate to systems and methods for automatic management of digital data volumes logically maintained in a dynamically scalable fault tolerant matrix. The data volumes may be distributed across a cluster of connected server nodes included in a cloud computing architecture. A processing device in communication with the matrix ensure that read/write request may be serviced by the matrix to access the digital data maintained within the data volumes may be continuously accessed, regardless of data volume failure that are missing, offline, or in a failed state.
US10223199B2
A non-volatile memory system receives a request to read data. That request includes a quality of service indication. The memory system performs a read process that satisfies the quality of service indication and identifies a set of data with errors. The memory system returns the set of data with errors in response to the request.
US10223197B2
In accordance with an embodiment of the invention, an integrated circuit (IC) device is disclosed. In the embodiment, the IC device includes an SRAM module, wrapper logic coupled to the SRAM module, a context source, and an ECC profile controller coupled to the context source and to the wrapper logic, the ECC profile controller configured to select an ECC profile in response to context information received from the context source for use by the wrapper logic.
US10223193B2
Embodiments are directed to predicting the health of a computer node using health report data and to proactively handling failures in computer network nodes. In an embodiment, a computer system monitors various health indicators for multiple nodes in a computer network. The computer system accesses stored health indicators that provide a health history for the computer network nodes. The computer system then generates a health status based on the monitored health indicators and the health history. The generated health status indicates the likelihood that the node will be healthy within a specified future time period. The computer system then leverages the generated health status to handle current or predicted failures. The computer system also presents the generated health status to a user or other entity.
US10223191B2
Methods and systems for detecting anomalous behavior include performing a principal component analysis on a plurality of key performance indicators (KPIs) to determine a set of principal axes. The KPIs are clustered in a space defined by the set of principal axes. Local and structural anomalies are determined in the clustered KPIs. The structural and local anomalies are classified based on historical information. A management action is performed based on the classified structural and local anomalies.
US10223183B2
A method for quickly detecting a fault includes: detecting, by a Kernel Black Box KBox set, a fault occurred in an operation system; and generating, by the KBox set, fault information based on the detected fault; and transmitting, by the KBox set, system fault notification information including the fault information to an application high availability HA subsystem via a management unit of an infrastructure layer, to trigger a service fault processing of the application HA subsystem. Thus, the fault or unhealthiness of an OS is detected rapidly and a service application layer is timely notified to process the fault, thus reducing service loss.
US10223180B2
A method and associated system for interfacing between a caller application and a service module. A service module builds a service module data structure pursuant to a previously received request. The request includes at least one caller application attribute describing the request. The service module data structure includes a generic service document and at least one service module attribute. Each service module attribute is stored in a relational table of the service module data structure. The requests serviced within the service module data structure, resulting in instantiating the generic service document. The generic service document is returned to the caller application. Building each service module attribute includes: constructing the generic service document and creating at least one container in the generic service document. Each container is respectively associated with each service module attribute in each mapping of at least one mapping.
US10223177B2
A computer-implemented method modifies a hardware device based on a time series of data. One or more processors standardize a time series of data received from sensors that are monitoring a hardware device. The processor(s) determine a time delta that measures how long a disruption in the time series lingers after an event that is detected by the sensors, and use the time delta to establish time ranges before, during and after each event. The processor(s) determine which events represented by the time series of data are significant, and then reduce a number of significant events described by the time series of data to a predefined level by removing events that have tags not found associated with other events in the time series of data to generate a modified time series of data, which is used to modify the hardware device.
US10223173B2
A method for deterministic locking in a parallel computing environment is provided. The method includes creating a data structure in memory of a computer for a shared resource. The data structure encapsulates a reference to an owner of a lock for the shared resource and a queue of threads able to seek exclusive access to the shared resource. The queue in turn includes different entries, each entry including an identifier for a corresponding one of the threads and a deterministic time computed for the corresponding one of the threads from a count of memory accesses occurring in the corresponding one of the threads. Consequently, a thread can be selected from the queue to receive ownership of the lock and exclusive access to the shared resource based upon a deterministic time for the selected thread as compared to other deterministic times for others of the threads in the queue, for example, a lowest deterministic time.
US10223170B2
Embodiments of the invention provide for methods for the management of logically partitioned computing resources of a data processing system configured with a plurality of hypervisors that each manages one or more logical partitions of the computing resources. A plurality of domains for the data processing system may be determined. For each domain, one or more hypervisors may be allocated to the domain such that one or more logical partitions managed by the hypervisor are allocated to the domain. Usage of the logically partitioned computing resources is based at least in part on the domain of each logically partitioned computing resource, a domain of each hypervisor, and/or a domain of a user.
US10223166B2
Systems and methods are provided for scheduling homogeneous workloads including batch jobs, and heterogeneous workloads including batch and dedicated jobs, with run-time elasticity wherein resource requirements for a given job can change during run-time execution of the job.
US10223161B2
The present disclosure is directed to hardware-based inter-device resource sharing. For example, a remote orchestrator (RO) may provide instructions to cause a device to make at least one hardware resource available to other devices. An RO module in the device may interact with the RO and may configure a configuration module in the device based on instructions received from the RO. The configuration module may set a device configuration when the device transitions from a power off state to a power on state. The device may also comprise a processing module to process data based on the device configuration, interface technology (IT) and at least one hardware resource. The interface technology may allow the processing module and the at least one hardware resource to interact. The RO module may configure the IT to allow the at least one hardware resource to operate locally or remotely based on the instructions.
US10223145B1
A computing resources service provider may provide customers with access to virtual computing resources to execute various applications on behalf of the customer. There may be occasional impairment to the virtual computing resources. These impairments may be detected in log information obtained by an impairment detection service. Furthermore, the impairment detection service may obtain additional information associated with the virtual computing resources. The log information and additional information may be correlated to determine one or more relevant factors in the impairments.
US10223140B2
Systems and methods for network function virtualization (NFV) resource management are disclosed that include receiving, by a network functions virtualization orchestrator (NFVO), a reuse requirement for a first network service (NS) and determining, by the NFVO, that at least one constituent virtual network function (VNF) instance in the first NS is retainable for reuse in a second NS according to the reuse requirement when the first NS is to be terminated. In some embodiments, these systems and methods also include retaining, by the NFVO, the at least one constituent VNF instance in the first NS for reuse in the second NS.
US10223134B1
Methods and systems are provided. One method includes receiving, by a server, data from a vehicle over a wireless network. The data includes information usable to identify a user account. The user account being accessible by the server to identify a profile of a user, and the profile of the user includes preferences of the user and learned behavior of the user. The method further includes receiving, by the server, a geo-location of the vehicle for a time of day. Then, identifying, by the server, supplemental content that is available for sending to the vehicle based on the geo-location of the vehicle. The method includes filtering, by the server, the supplemental content based on a contextual analysis of one or more preferences of the user, the learned behavior of the user, the time of day and the geo-location of the vehicle. Said filtering eliminates sending supplemental content to the vehicle for display that is predicted to have a likelihood of not being used or preferred by the user based on said contextual analysis. The method includes sending, by the server, supplemental content to the vehicle for display to a screen or output via a speaker of the vehicle, the supplemental content that is sent is not filtered out from being sent to the vehicle.
US10223131B1
One embodiment is related to a method for determining an optimal resource configuration combination, comprising: (1) measuring performance of an application with a production resource configuration combination and its associated cost; (2) simulating historical workloads associated with the application with one or more candidate resource configuration combinations using idle resources; (3) selecting one of the candidate resource configuration combinations as a new production resource configuration combination based on cost and performance measurements and comparisons; (4) applying the new production resource configuration combination to a production environment; and (5) monitoring performance of the application with the new production resource configuration combination to confirm that it meets desired performance targets, wherein operations (1) to (5) are performed on a Platform as a Service (PaaS) platform.
US10223130B2
A system to enable a computer to provide output to a display over a general-purpose data transmission medium, such as USB. The system includes provision of a plurality of display interface components, each display interface component adapted to receive display data and transmission of the display data to the display via the general-purpose data transmission medium. Each component is associated with a respective stage of operation of the system. The system is configured to use a respective one of the display interface components during each of a plurality of distinct operational stages.
US10223129B2
Methods and systems for license management using a basic input/output system (BIOS) may involve performing license activation, monitoring, and enforcement. The BIOS may store license information to manage licenses for hardware and/or software components of an information handling system. License management by the BIOS may include monitoring a system clock of the information handling system for changes to avoid tampering with license durations.
US10223126B2
An out-of-order (OOO) processor includes ready logic that provides a signal indicating an instruction is ready when all operands for the instruction are ready, or when all operands are either ready or are marked back-to-back to a current instruction. By marking a second instruction that consumes an operand as ready when it is back-to-back with a first instruction that produces the operand, but the first instruction has not yet produced the operand, latency due to missed cycles in executing back-to-back instructions is minimized.
US10223122B2
One embodiment of the present invention sets forth a graphics processing system configured to track event counts in a tile-based architecture. The graphics processing system includes a screen-space pipeline and a tiling unit. The screen-space pipeline includes a first unit, a count memory associated with the first unit, and an accumulating memory associated with the first unit. The first unit is configured to detect an event type and increment the count memory. The tiling unit is configured to cause the screen-space pipeline to update an external memory address to reflect a first value stored in the count memory when the first unit completes processing of a first set of primitives. The tiling unit is also configured to cause the screen-space pipeline to update the accumulating memory to reflect a second value stored in the count memory when the first unit completes processing of a second set of primitives.
US10223114B1
Embodiments of instructions and methods of execution of said instructions and resources to execute said instructions are detailed. For example, in an embodiment, a processor comprising: decode circuitry to decode an instruction having fields for an opcode, a packed data source operand identifier, and a packed data destination operand identifier; and execution circuitry to execute the decoded instruction to convert a data element from a least significant packed data element position of the identified packed data source operand from a fixed-point representation to a floating point representation, store the floating point representation into a 32-bit least significant packed data element position of the identified packed data destination operand, and zero all remaining packed data elements of the identified packed data destination operand is described.
US10223112B2
A method of an aspect includes receiving an instruction. The instruction indicates an integer stride, indicates an integer offset, and indicates a destination storage location. A result is stored in the destination storage location in response to the instruction. The result includes a sequence of at least four integers in numerical order with a smallest one of the at least four integers differing from zero by the integer offset and with all integers of the sequence in consecutive positions differing by the integer stride. Other methods, apparatus, systems, and instructions are disclosed.
US10223086B2
Disclosed embodiments provide systems, methods, and techniques for code parsing and lineage detection. According to disclosed embodiments, a code parser acquires one or more parameters, which at least include a first parameter that identifies source code. The code parser also acquires the source code from the first parameter. After acquiring the source code, the code parser parses the source code and generates an output of the parsed source code. The code parser may then generate and display an output of the parsed source code.
US10223085B2
A computer-implemented method for transforming implicit data structures expressed by assembler code into high-level language structures includes analyzing a section of assembler code to identify a plurality of data items. The computer-implemented method further includes storing the plurality of data items in a plurality of groups. The computer-implemented method further includes modifying one or more groups in the plurality of groups based, at least in part, on a pair of adjacent groups having a non-identical overlap. The computer-implemented method further includes creating an overlap list for each group. The computer-implemented method further includes generating data modeling language for the section based, at least in part, on each overlap list. A corresponding computer system and computer program product are also disclosed.
US10223076B1
A method may include displaying an output, e.g., a figure, a data set, a symbolic expression or equation, a model, or any object with a representation that can be manipulated, e.g., a tree, a list, or a control loop, from executing program code. The method may include receiving an indication that the output has been modified through one or more manipulations, and generating code that represents modifications to the output, such that executing the code with the program code generates the output that has been modified.
US10223074B2
One or more processors scan a first software container template for one or more identities of software present on a first software container associated with the first software container template. One or more processors generate a map of the one or more identities of software present on the first software container. The one or more identities of software present on the first software container are mapped with one or both of: an identifier of the first software container template and an identifier of the first software container associated with the first software container template.
US10223073B2
Apparatuses and methods of manufacturing same, systems, and methods for performing recursive operations using a partial remainder-divisor (PD) table are described. In one aspect, it is determined whether a current cell in the PD table indicated by a current partial remainder/radicand row value and a current divisor/root column value is outside a primary region of the PD table. If the current cell is outside the primary region of the PD table, at least one of the current partial remainder/radicand row value and the current divisor/root column value are adjusted so that the indicated current cell falls within the primary region of the PD table.
US10223068B2
Hardware logic arranged to normalize (or renormalize) an n-bit input number is described in which at least a proportion of a left shifting operation is performed in parallel with a leading zero count operation. In various embodiments the left shifting and the leading zero count are performed independently. In various other embodiments, a subset of the bits output by a leading zero counter are input to a left shifter and the output from the left shifter is input to a renormalization block which completes the remainder of the left shifting operation independently of any further input from the leading zero counter.
US10223064B2
In at least one embodiment of this disclosure, footfalls are output at intervals of a time Ta in accordance with input for movement of a user A in the virtual space. Footfalls are output at intervals of a time Tb in accordance with input for movement of the user B in the virtual space. The computer updates the field-of-view image displayed on a head-mounted device, and further, outputs footfalls at intervals of time that is based on setting of the physical size of the user of the head-mounted device.
US10223063B2
An electronic device is associated with a media-providing service. The electronic has one or more processors and memory storing instructions for execution by the one or more processors. For each track of a plurality of tracks consumed by a user of the media-providing service, the electronic device determines, based on a listening history of the user with the media-providing service, whether the track has previously been consumed by the user. The electronic device determines, for the user, a discovery score based on a number of the plurality of tracks determined to not have been previously consumed by the user. The electronic device provides personalized content to the user based on the discovery score.
US10223042B2
A system includes a terminal and an information processing device including a first specification unit configured to specify a second computer program based on terminal information on the terminal received from the terminal; a first provision unit configured to provide the second computer program to the terminal; and a second specification unit configured to specify a first computer program based on device information received from the terminal; and a second provision unit configured to provide the first computer program to the terminal. The terminal including a transmission unit configured to transmit the terminal information; a first processing unit configured to perform processing of acquiring device information and transmitting the acquired device information, by execution of the second computer program; and a second processing unit configured to perform processing of installing the first computer program on the terminal, by execution of the second computer program.
US10223036B2
A computing device includes an interface configured to interface and communicate with a dispersed storage network (DSN), a memory that stores operational instructions, and a processing module that is configured to perform various operations. The computing device monitors for condition(s) that triggers expansion of a private DSN memory that stores encoded data slices (EDSs), and when that condition occurs, the computing device generates a modified copy of the EDSs that includes a read and/or write threshold number of EDSs of the EDSs. The computing device transmits the modified copy of EDSs to a public DSN memory for storage within the public DSN memory. The computing device then services first read request and/or write request based on the private DSN memory that stores the plurality of EDSs and services second read request and/or write request based on public DSN memory that stores the modified copy of the plurality of EDSs.
US10223032B2
A memory controller is provided for accessing shared memory objects by read and write requests made to a memory. The memory controller includes a list for registering address locations of the shared objects in the memory, and having slots for a lock bit. The memory controller includes a read wait queue and a write wait queue for selectively inputting, outputting, holding, and purging requests. The memory controller includes a read initiated queue and a write initiated queue for selectively inputting and purging requests transferred from the read wait queue and the write wait queue, respectively, upon memory access initiation and completion. The memory controller includes a controller for controlling the wait queues using policies by determining which requests to output, hold, and purge, based on a list entry, a lock bit and TTL information set to each request upon a hold being applied thereto and decremented in each cycle.
US10223028B2
A memory system or flash card may include a mechanism for memory cell measurement and analysis that independently measures/predicts memory wear/endurance, data retention (DR), read disturb, and/or remaining margin. These effects may be independently quantified by analyzing the state distributions of the individual voltage levels of the cells. In particular, a histogram of cell voltage distributions of the memory cells can be analyzed to identify signatures for certain effects (e.g. wear, DR, read disturb, margin, etc.). Those measurements may be used for block cycling, data loss prediction, or adjustments to memory parameters. Pre-emptive action at the appropriate time based on the measurements may lead to improved memory management and data management. That action may include calculating the remaining useful life of data stored in memory, cycling blocks, predicting data loss, trade-off or dynamic adjustments of memory parameters.
US10223024B2
An infrastructure is described that enables an application's storage-related requirements to be declaratively specified and storage services to be provided for that application in accordance with the specified storage requirements. A centralized storage controller system is provided that receives application storage profile information for an application, where the application storage profile information identifies that application's storage-related requirements. The storage controller system then selects one or more virtual machines for servicing that application's storage needs. The selected one or more storage virtual machines are those that can support, i.e., can provide or satisfy, the application's storage requirements. During runtime, a storage request generated by the application is communicated to the one or more storage virtual machines, which then service the storage request in accordance with the application's specified storage-related requirements.
US10223013B2
Examples of techniques for processing I/O operations in a channel are disclosed. In one example implementation according to aspects of the present disclosure, a computer-implemented method may include: copying, by a system assist processor, a subchannel of the channel into a lower portion of a channel communication area responsive to receiving the I/O operation; copying, by the system assist processor, channel program information from a designated starting location in a customer memory into a control block; building, by the system assist processor, a starting channel communication area into a top portion of the control block; queuing, by the system assist processor, the control block to a queue for the channel; processing, by the channel, the I/O operation responsive to retrieving the control block from the queue.
US10223009B2
A system and method for efficient cache buffering are provided. The disclosed method includes receiving an Input/Output (I/O) command from a host system at a storage controller, parsing the I/O command at the storage controller with a host I/O manager to extract command instructions therefrom. The host I/O manager is able to generate at least one local message that includes the command instructions extracted from the I/O command and transmit the at least one local message to a cache manager. The cache manager is enabled to work in local memory to execute the command instructions contained in the at least one message. The cache manager is also configured to chain multiple buffer segments together on-demand to support multiple stripe sizes that are specific to the I/O command received from the host system.
US10223008B1
A computer program product, system, and method for determining compression performance data, an expected I/O operations per second (IOPS) value, an expected data set size, and skew data for each of the logical data sets; determining resource requirements for each of the logical data sets using the corresponding skew data, compression performance data, expected data set size, and expected IOPS value; and determining, based on the resource requirements determined for each of the logical data sets, a set of resources for a storage array that can handle the workload.
US10223001B2
When receiving a write command from a host, a memory system according to one embodiment updates first correspondence information indicating the correspondence relationship between a logical address corresponding to user data and a position in a first memory and transmits the user data which has been stored in a second memory to the first memory. When the transmission is completed, the memory system writes the user data to the first memory. When the update and the transmission are completed, the memory system releases a memory area which stores the user data such that the memory area can be used as a memory area for other data.
US10222998B2
In one embodiment, a computer program product includes a computer readable storage medium having program instructions embodied therewith. The program instructions are executable by a processing circuit to cause the processing circuit to perform a method that includes determining, after writing data to a non-volatile memory block, one or more delta threshold voltage shift (TVSΔ) values. One or more overall threshold voltage shift values is calculated for the data written to the non-volatile memory block. The one or more overall threshold voltage shift values are stored. The method also includes reading one or more TVS values from a non-volatile controller memory, and resetting a program/erase cycle count since last calibration after calibrating the one or more overall threshold voltage shift values. The one or more TVSΔ values and the program/erase cycle count since last calibration are stored to the non-volatile controller memory.
US10222997B2
A computer program product according to one embodiment includes a computer readable storage medium having program instructions embodied therewith. The program instructions are executable by a processing circuit to cause the circuitry to perform a method including determining, after writing data to a non-volatile memory block, one or more delta threshold voltage shift (TVSΔ) values. One or more overall threshold voltage shift values for the data written to the non-volatile memory block are calculated, the values being a function of the one or more TVSΔ values to be used when writing data to the non-volatile memory block. The overall threshold voltage shift values are stored. A base threshold voltage shift (TVSBASE) value, the one or more TVSΔ values, or both the TVSBASE value and the one or more TVSΔ values are re-calibrated during a background health check after a predetermined number of background health checks without calibration are performed.
US10222992B2
Embodiments of the present disclosure generally relate to a cloud computing network, or datacenter network, and a method of transferring information among processing nodes in a cloud computing network or datacenter. The network may include a hub that is coupled to a plurality of nodes so that data is transferred between nodes through the hub. Data from different nodes may be written into a slot within the hub, read, and then written into a slot within the destination node. Due to the proximity of the nodes to the hub, or even due to the amount of data to be written, the data may be written at different clock phases. The read may occur one or more clock cycles after the data has been written into the hub.
US10222980B2
The method for manipulating a cursor is performed at a portable multifunction device with one or more processors, memory, and a touch screen display. Initially, content of an electronic document is displayed on the display, where a cursor is displayed within the electronic document. Two substantially simultaneous touch inputs are then detected on the touch screen display, and preferably anywhere on the touch screen display. In response to detecting the two substantially simultaneous touch inputs, a portion of the content in the document closest to the cursor is selected, and the portion of the content is displayed as selected content.
US10222976B2
A system includes receiving a start of a path gesture and determining, via a processor, a decision point along the path gesture. At the decision point, a first command associated with a first dimension is displayed. In addition, at the decision point, a second command associated with a second dimension is displayed.
US10222967B2
In one embodiment, a computer-implemented method includes displaying a segment on a touch panel, the segment having a starting point and an end point corresponding to a first page and a last page, respectively, of a document, in response to a predetermined manipulation by a user. An indication is received that the user has performed at least one of touching a point on the segment and sliding a point on the segment. The document is scrolled to reach a page corresponding to the position of the point on the segment, in response to the indication. The document is scrolled, by a computer processor, on a page-by-page basis, in response to the user sliding the point in a direction perpendicular to the segment.
US10222963B2
A display apparatus which is capable of performing an initial setting and a controlling control method thereof are provided. The display apparatus includes an output unit configured to output a user interface (UI) which is controllable by a plurality of input modes, and a controller configured to set an input mode according to a user feedback type regarding the UI, and configured to output another UI which corresponds to the set input mode.
US10222961B2
Systems and methods for real-time collaborative computing and collective intelligence are disclosed. A collaborative application runs on a collaborative server connected to a plurality of computing devices. Collaborative sessions are run wherein a group of independent users, networked over the internet, collaboratively answer questions in real-time, thereby harnessing their collective intelligence. Methods are disclosed for assigning users to factions during a collaborative decision process, wherein the collaborative server repeatedly checks the input of each user with respect to a plurality of proposed answers and assigns the user to the faction associated with the answer the user is trying to select. Furthermore, user assessments are made based on a stored time-history of faction associations for that user during a decision period. Such assessments include, but are not limited to, determining which users were entrenched, which were flexible, and which were fickle, during the collective intelligence decision making process.
US10222959B2
A method includes formatting for display, on a visual screen, an image comprising: (1) a coordinate system, (2) a plurality of distinguishable areas within the coordinate system, each distinguishable area graphically representing a respective formula, and (3) a plurality of data points. The method also includes receiving user input comprising a modification to a particular distinguishable area. In response to receiving the user input, the method includes modifying one or more respective formulas based on the modification to the distinguishable area. For each data point, the method further includes associating the data point with one of the distinguishable areas by determining which of the modified formulas the data point falls within. The method further includes formatting for display a graphical representation of each modified formula. The method additionally includes storing the graphical representation of each modified formula for use as a modified image in future operations.
US10222950B2
A control unit, method and computer program product cooperate to provide a controllable depth of display of at least a part of a graphical user interface. Moreover, the control unit includes a control circuit that controls a depth display of an icon, which may be a user-selectable icon, as part of the graphical user interface. The control circuit increases the depth of display of the icon when an object is detected as approaching the display. In this way, a user is provided with visual feedback when the user is interacting with the graphical user interface.
US10222944B1
A device may provide a user interface element for display in association with a displayed document that contains code. The user interface element may be associated with at least one adjustable state. The device may determine, based on a user interaction with the user interface element, a selected state of the at least one adjustable state of the user interface element. The device may generate information based on the selected state of the user interface element. The device may store the user interface element, the selected state of the user interface element, and the information in association with the document.
US10222936B2
Systems and methods for dispensing compositions, such as beverages, are provided. A beverage dispenser may be configured to receive input corresponding to a selection of a beverage, and in response, a graphical representation of the beverage at a display device. The beverage dispenser may receive additional input corresponding to an adjustment of an amount of an ingredient of the selected beverage, and in response, the graphical representation of the beverage may be updated. The graphical representation of the beverage may include graphics depicting the beverage container, the volume of liquid in the beverage container, and the adjusted ingredient.
US10222935B2
In one embodiment, a user interface system based on a treemap-type presentation includes a processor and a memory. The processor is operative to store data for items which can be invoked, generate data for a user interface screen having regions arranged according to an arrangement, at least some of the regions being different sizes and being arranged according to size order, assign at least some of the items to the regions, receive user selections from an input device, determine which item is being selected for each user selection, refresh an assignment of the items among the regions of the user interface screen so that even though the assignment of the items among the regions is changed as a result of the refreshment, the arrangement and sizes of the regions in the user interface screen remain unchanged. Related apparatus and methods are also described.
US10222920B2
Provided is a touch panel device configured to execute touch panel drive processing while appropriately preventing discoloration of a semi in-cell touch panel. A touch panel-equipped display device 1000 includes a touch panel TP and a touch panel controller 1. The touch panel TP is configured as a semi in-cell touch panel, and includes a color filter layer, a sense electrode layer provided with sense electrodes Rx11 Rx38, and a drive electrode layer provided with drive electrodes Tx11 to Tx38. The sense electrode layer and the drive electrode layer oppose each other with the color filter layer interposed therebetween. The touch panel controller 1 generates a drive signal such that an integrated value of a potential difference between the drive electrode and the sense electrode is less than a first value in a predetermined period of driving the touch panel.
US10222918B2
The present application discloses a self-capacitive touch substrate. The self-capacitive touch substrate includes a base substrate; a plurality gate lines crossing over a plurality of data lines; a plurality of touch electrodes; and a plurality of touch signal lines, each of which is electrically connected to one of the plurality of touch electrodes. The plurality of touch signal lines cross over the plurality of data lines.
US10222905B2
In a liquid crystal display device, a second substrate includes a detection electrode of a touch panel, pixels include pixel electrodes and counter electrodes, the counter electrodes are divided into a plurality of blocks, the counter electrodes of the divided blocks are provided in common to the pixels on a plurality of display lines being side by side, the counter electrodes of the divided blocks are used as scanning electrodes of the touch panel as well, the liquid crystal display device includes a semiconductor chip configured to supply a counter voltage and a touch panel scanning voltage to the counter electrodes of the divided blocks, the semiconductor chip includes a first terminal group formed on a side of a display area side configured by the plurality of pixels.
US10222900B2
An electronic device capable of touch event processing is provided. The electronic device includes first and second surfaces oriented in different directions, the second surface being narrower than the first surface, a touchscreen display including a touch panel, and having a first section exposed through the first surface and a second section exposed through the second surface, a processor electrically connected with the touchscreen display, and a memory that stores instructions that cause, when executed, the processor to activate the touch panel, to detect a first touch event on one of the first section and the second section, to detect a second touch event on the other section after detection of the first touch event, to remove one of the first touch event and the second touch event, and to perform a function according at least partly to the remaining touch event.
US10222899B2
The present disclosure provides a touch substrate, a touch display panel and a display device which belong to a field of touch display. The touch substrate includes a plurality of photo-sensing thin film transistor arranged on the substrate, the touch substrate further includes a piezoelectric sensing structure arranged above at least one of the photo-sensing thin film transistors, and a breakover current between a source and a drain of the photo-sensing thin film transistor corresponding to the piezoelectric sensing structure is changed, when the at least one piezoelectric sensing structure is pressed.
US10222898B2
According to an aspect, a display device with a touch detection function includes a display panel and a touch panel. The touch panel includes first electrodes extending in one direction. The display panel includes second electrodes interesting with the first electrodes in planar view and serving as common electrodes that supply a common potential to pixels in a display area. The display panel also includes pixel signal lines and scanning signal lines interesting with each other in planar view. The pixel signal lines and the scanning signal lines are made into a floating state in a touch detection period in which a first drive signal is applied to the first electrodes, and a second drive signal is applied to the second electrodes at predetermined intervals to perform touch detection based on change in voltage of the first electrodes and change in voltage of the second electrodes.
US10222890B2
The present invention provides a pressure sensing panel, which includes a carrying substrate, a gas cell layer formed on the carrying substrate and a gas pressure sensor, wherein the gas cell layer includes at least one gas cell, a predetermined amount of gas is sealed in each gas cell, and at least one gas pressure sensor is provided inside each gas cell. The present invention further provides a display device, a method for fabricating the pressure sensing panel and a force touch method using the display device. In the present invention, deformation of the gas cell is physical deformation, which is hardly affected by the surroundings, so the level of force applied to the display device can be determined accurately by using the pressure sensing panel provided by the present invention, and further, operation can be performed accurately.
US10222888B2
A mirror display is described. The mirror display includes a plurality of first electrodes disposed on a first substrate, a plurality of sensor lines disposed on the first substrate, the plurality of sensor lines connected to the plurality of first electrodes, a plurality of second electrodes disposed on a second substrate, the plurality of second electrodes facing the first substrate, a liquid crystal layer interposed between the plurality of first electrodes and the plurality of second electrodes, a plurality of mirror driving lines on the second substrate, the plurality of mirror driving lines connected to the plurality of second electrodes, and a reflective polarizing film attached to the second substrate.
US10222879B2
The disclosed technology provides for a device and method related to powering an electronic stylus with a removable, integrated battery that acts as a structural segment and external casing along the long axis of the stylus body. The integrated battery incorporates interlocking features, which removes the need for an external tube around a battery cell. As a result, the electronic stylus has one structural component performing multiple functions (e.g., providing power, functioning as the stylus casing), which achieves a more lightweight and compact electronic stylus. The placement of the battery along the long axis can vary to provide comfortable weight distribution for writing, which can involve an interlocking interface at one end of the battery or at both ends of the battery (e.g., to interlock with one or both ends of the electronic stylus).
US10222874B2
A foot-controlled device is presented herein that allows a user to control mouse movement on a computing device with their foot. The foot-controlled device includes a foot pad that the user can move in an X-Y plane. The pad can also can be pressed downward along the Z-axis, causing the foot-controlled device to issue a command. The command can be based on the mode of the foot-controlled device, such as a mouse mode or a directional pad mode. The command can also cause the foot-controlled device to switch modes. Additionally, rotation of the foot-controlled device can be used to determine which command to issue to the computing device.
US10222870B2
A wearable reminder device is provided using two different types of gestures obtained from two different types of sensors. The device outputs audio to a user but does not have a display, a keypad, or speech recognition software, therewith significantly reducing size, storage requirements and power consumption. Hence the device is suitable for use by the blind, persons with a speech impediment, visually impaired persons, and others who are unable to read small fonts.
US10222866B2
The present disclosure provides an information processing method and an electronic device, capable of solving the problem with the conventional solution that the user may not activate the interaction interface conveniently without knowing the position of the triggering control. The method comprises: obtaining at least one sensed parameter of an operator using the sensing unit; determining a parameter change of the operator based on the at least one sensed parameter; judging, based on the parameter change, whether an input action of the operator satisfies a first predetermined condition, so as to obtain a first judgment result, the first predetermined condition being satisfied when the operator changes from a first attitude to a second attitude different from the first attitude; determining the input action of the operator as a first input action and determining a mapped position of the operator on the display unit based on the parameter change, when the first judgment result indicates that the input action satisfies the first predetermined condition; determining a first control instruction associated with the first input action; and displaying a first graphic interaction interface at the mapped position in response to the first control instruction.
US10222859B2
A human-computer interface system having an exoskeleton including a plurality of structural members coupled to one another by at least one articulation configured to apply a force to a body segment of a user, the exoskeleton comprising a body-borne portion and a point-of-use portion; the body-borne portion configured to be operatively coupled to the point-of-use portion; and at least one locomotor module including at least one actuator configured to actuate the at least one articulation, the at least one actuator being in operative communication with the exoskeleton.
US10222854B2
Power management for a touch controller is disclosed. The touch controller can include a transmit section for transmitting stimulation signals to an associated touch sensor panel to drive the panel, where the touch controller can selectively adjust the transmit section to reduce power during the transmission. The touch controller can also include a receive section for receiving touch signals resulting from the driving of the panel, where the touch controller can selectively adjust the receive section to reduce power during the receipt of the touch signals. The touch controller can also include a demodulation section for demodulating the received touch signals to obtain touch event results, where the touch controller can selectively adjust the demodulation section to reduce power during the demodulation of the touch signals. The touch controller can also selectively reduce power below present low levels during idle periods. The touch controller can be incorporated into a touch sensitive device.
US10222852B2
In an approach for determining voltage and frequency pairs, the computer identifies an integrated circuit design. The computer identifies a timing model associated with the identified integrated circuit design. The computer identifies at least a nominal voltage, a nominal clock signal, and a voltage range associated with the integrated circuit design. The computer receives a number n that defines the number of at least one alternate voltage within the voltage range. The computer analyzes the identified integrated circuit based on the received number n for each number n for at least one alternate voltage within the voltage range. The computer calculates a nominal slack. The computer calculates one or more clock periods based on the calculated nominal slack. The computer provides a report based on the calculated one or more clock periods.
US10222848B2
The power consumption of an analog arithmetic circuit is reduced. The analog arithmetic circuit includes a plurality of first circuits. An output terminal of the k-th (k is a natural number) first circuit is connected to an input terminal of the k+1-th first circuit. Each of the first circuits includes a memory circuit which holds an analog signal, a second circuit which performs arithmetic processing using the analog signal, a switch which controls power supply to the second circuit, and a controller. The conduction state of the switch included in the k-th first circuit is controlled by the controller included in the k+1-th first circuit. The arithmetic processing performed by the second circuit included in the k+1-th first circuit is started by the controller included in the k+1-th first circuit.
US10222844B1
The disclosed apparatus may include (1) a cage that houses at least one field-replaceable electronic module that, when operational, emits heat within a computing device, wherein the cage comprises (A) a front entry side that facilitates installation of the field-replaceable electronic module and (B) a back side that is located opposite the front entry side, (2) a heatsink that removably interfaces with the field-replaceable electronic module when the field-replaceable electronic module is installed in the cage and (3) a spring mechanism that (A) is coupled to the back side of the cage and (B) applies force to the heatsink such that the heatsink (I) is pressed against the field-replaceable electronic module and (II) establishes thermal contact with the field-replaceable electronic module to facilitate heat transfer from the field-replaceable electronic module to the heatsink. Various other apparatuses, systems and methods are also disclosed.
US10222838B2
Provided is an electric shock protection device disposed between a human body contactable conductor and an internal circuit unit of an electronic device, wherein in order to pass static electricity without causing dielectric breakdown when the static electricity flows from the conductor, block a leakage current of an external power source flowing from a ground of the circuit unit, and pass communication signals flowing from the conductor, the following equation is satisfied: Vbr>Vin where Vbr is a breakdown voltage of the electric shock protection device and Vin is a rated voltage of an external power source of the electronic device.
US10222837B1
The present disclosure provides a display module having a removably fixed retention member that allows disassembly of a computer device, for example, to improve the ease of field repair. The computer device includes a chassis frame forming an outer edge of the device. The chassis frame including a first slot defining a first portion of a keyway, and the display module having a retention member including a second slot forming a second portion of the keyway between the chassis frame and the retention member. The retention element is moveable within the keyway to contact both the retention member and the chassis frame. The computer device may include a compression gasket located between the chassis frame and the retention member. When the compression gasket is held in a compressed state, the first portion and the second portion of the keyway are aligned to allow movement of the retention element.
US10222835B2
Disclosed is a mobile terminal comprising a flexible display unit, which includes a deformation area that may be deformed to a folded state and an unfolded state by an external force; a body portion supporting one area of the flexible display unit on a front surface; a deformation support unit supporting the display unit, having a first living hinge unit corresponding to the deformation area; and a folding unit built in the body portion, guiding deformation of the display unit by means of the external force.
US10222834B2
A flexible display device includes a bending area including a display panel, an optical member, a polarization member, and a window member, and a non-bending area. A bending part of the optical member includes a plurality of optical patterns corresponding to the bending area, and the plurality of optical patterns are provided to have different widths at a face adjacent to the display panel and a face adjacent to the polarization member. Light leakage phenomenon and color shift phenomenon induced by the modification of the optical member in the bending area during bending of the display device may be improved.
US10222832B2
A method for adhering a film to a touch pad includes adhering a fixing bracket to a back surface of a touch pad, and aligning a plurality of screw holes of the fixing bracket with a plurality of the screw holes of a front cover of a system body, respectively, and connecting the fixing bracket and the front cover of the system body using screws or bolts that engage the screw holes. A positioning wall of a positioning frame is inserted into a gap between the touch pad and the front cover of the system body from a front surface of the touch pad. A film is aligned with an opening of the positioning frame, and the film is adhered to the front surface of the touch pad. The positioning frame is removed from the front surface of the touch pad.
US10222829B2
In one aspect, a device includes a processor and storage accessible to the processor. The storage bears instructions executable by the processor to determine that a trigger regarding an apparatus has been satisfied and, in response to the determination, activate a thermoelectric cooling element (TCE) accessible to the processor.
US10222826B2
A display device includes a cradle and a display module. The cradle includes a signal transmission unit configured to transmit an image signal, a housing exposing the signal transmission unit. The display module has a curved shape along a radius of a curvature and includes a signal reception unit configured to receive the image signal, an image display unit configured to display an image based on the image signal, and a second coupling member. The display device is configured to operate in any one of a first state and a second state, in which during the first state, the cradle and the display module are decoupled from each other, and in which during the second state, the first coupling member and the second coupling member are slide-coupled to each other, such that the display module moves along the circumference of a circle of the curvature of the display module.
US10222825B2
An automotive display device on which an image may be displayed, the automotive display device being for a vehicle interior, the automotive display device including an automotive frame, at least part of the automotive frame being bendable; and a bending controller to control bending of the automotive frame.
US10222824B2
The subject innovation relates to an apparatus that includes an integrated case with all parts disposed within. The apparatus includes a processor, at least two displays, at least two cameras, and a storage system. The storage system comprises code to direct the processor to obtain input from the at least two cameras, and provide display information to the at least two displays.
US10222823B2
The present disclosure describes embodiments of apparatuses and methods related to a computing apparatus with a real time clock (RTC) coupled to a bus, where the RTC does not have a backup power source to maintain time and date of the RTC. The computing apparatus may have firmware coupled to the bus, and the firmware may contain boot logic with network time protocol (NTP) logic. The computing apparatus may have persistent memory coupled to the bus with configuration parameters. The computing apparatus may have a controller coupled to the bus, where the controller is to retrieve the configuration parameters from the persistent memory and processes the boot logic with the NTP logic using the configuration parameters to transmit an NTP request over the bus and receives a coordinated universal time (UTC) over the bus and stores the UTC in the RTC.
US10222822B2
A photonic quantum memory is provided. The photonic quantum memory includes entanglement basis conversion module configured to receive a first polarization-entangled photon pair and to produce a second entangled photon pair. The second polarization-entangled photon pair can be a time-bin entangled or a propagation direction-entangled photon pair. The photonic quantum memory further includes a photonic storage configured to receive the second entangled photon pair from the basis conversion module and to store the second entangled photon pair.
US10222816B1
An electronic circuit for current generation includes a source-follower based current source and a voltage compensation semiconductor device. The source-follower based current source is configured to output a reference current, the current source including a main transistor which is configured to derive the reference current from a reference voltage, wherein the main transistor has a voltage drop that varies with temperature and process variations. The voltage compensation semiconductor device is configured to be biased with bias currents that increase the reference voltage provided to the main transistor by an offset voltage that matches the voltage drop of the main transistor across at least part of the temperature and process variations, thereby pre-compensating for the voltage drop of the main transistor.
US10222813B2
A four-way hall valve includes a linear gear for operating the ball element in the valve and a temperature responsive wax element connected to the linear gear for moving the linear gear and rotating the ball in response to temperature change.
US10222811B2
A lever assembly for a flow regulator includes a damper to reduce unwanted movement of the lever in an opening and closing direction. The damper includes one or more resilient spring members that squeeze the lever with an amount of force sufficient to reduce unwanted pivoting of the lever without preventing the lever from pivoting in response to control movements of an actuator adapted to actuate the lever.
US10222808B2
An inspection system for a storage facility including an automatic guided vehicle with a bidimensional positioning system, an unmanned aerial vehicle with a measurement sensor, a position control system to maintain the unmanned aerial vehicle above the automatic guided vehicle, an altitude sensor to acquire a relative vertical distance between the unmanned aerial vehicle and the automatic guided vehicle, and a communication system to transmit the measurement data to a remote server. The inspection system transmits to the remote server a set of tridimensional coordinates associated with the measurement data comprising horizontal coordinates function of the bidimensional location of the automatic guided vehicle on the floor of the storage facility and a vertical coordinate function of the relative vertical distance of the unmanned aerial vehicle with respect to the automatic guided vehicle.
US10222796B2
An autonomous driving control apparatus executes an autonomous driving control of a vehicle. The autonomous driving control apparatus includes: a first determination unit configured to determine whether the autonomous driving control can be engaged or not; an autonomous driving control engage trigger input unit; a triggered engage mode configured to engage the autonomous driving control when an autonomous driving control engage trigger is input by a driver to the autonomous driving control engage trigger input unit after the first determination unit determines that the autonomous driving control can be engaged; an automatic engage mode configured to automatically engage the autonomous driving control when the first determination unit determines that the autonomous driving control can be engaged; and a switching unit configured to switch between the triggered engage mode and the automatic engage mode.
US10222794B2
A remote controller comprises a gripping member, a control stick arranged on the gripping member, and a retaining device installed on the gripping member. The retaining device comprises a support mechanism, a clamping mechanism rotatably installed on the support mechanism, and a communication mechanism rotatably connected to the clamping mechanism. The clamping mechanism comprises a first clamping part and a second clamping part opposite to the first clamping part. The communication mechanism comprises a receiving member, a connecting shaft arranged on the receiving member and pivotably connecting the receiving member with the second clamping part, and an antenna arranged on the receiving member and configured to transfer data. The connecting shaft is configured to allow the receiving member to rotate relative to the second clamping part and to be received between the first clamping part and the second clamping part.
US10222791B2
An operator of a nuclear plant is provided with an action margin time up to the execution of a next action to be performed in response to a detected accident based on sensor signals received from sensors for the plant. The operator is provided with a displayed graph showing the received sensor signals, estimated sensor signals for the future, the action margin time and an action threshold value corresponding to the next action. Accordingly, the operator can readily grasp how much time is available to perform the next action before the received sensor signals are predicted to exceed the action threshold value.
US10222786B2
A master unit that controls a master axis and a slave unit that controls a slave axis are connected via a communication path to construct a numerical control system. The slave unit acquires a reception time of synchronization information received from the master unit and records a history of the reception time of the synchronization information. Then, when retransmission of transfer of the synchronization information is detected, the slave unit corrects the reception time of the synchronization information based on history data of the reception time and corrects asynchronous position of the slave axis based on a corrected reception time.
US10222783B2
A numerical control device includes an NC-machining-program reading unit to read an NC machining program, a machining-removal-shape generation unit to generate a machining removal shape by a block of the NC machining program, a tool-data search unit to search for tool data to be used in the NC machining program, and a machining-finished-shape generation unit to generate a machining finished shape from the machining removal shape generated by the machining-removal-shape generation unit. During editing of the NC machining program, the machining removal shape and the machining finished shape can be confirmed sequentially by the block.
US10222780B2
A control device for a machine tool, said control device being provided with a display unit that displays machining information and a display control unit that generates an image to display on said display unit. The display control unit is designed so as to divide up the display region of the display unit, generating a plurality of subregions. Via input from an operator, the sizes of said subregions can be changed. The display control unit changes the display format of the machining information in accordance with the machining information to be displayed and the sizes of the subregions.
US10222769B2
A process characteristic parameter determination system uses a process model and a tuning module to accurately determine a value for a process characteristic parameter within a plant without measuring the process characteristic parameter directly, and may operate on-line or while the process is running to automatically determine a correct value of the process characteristic parameter at any time during on-going operation of the process. The process characteristic parameter value, which may be a heat transfer coefficient value for a heat exchanger, can then be used to enable the determination of a more accurate simulation result and/or to make other on-line process decisions, such as process control decisions, process operational mode decisions, process maintenance decisions such as implementing a soot blowing operation, etc.
US10222763B2
A remote isolation system (10) for a plant comprising equipment (20,21) energizable by an energy source (30) and a control system (50,260) enabling automated isolation of the equipment (20,21) from said energy source (30) to an isolated state when authorized by the control system (50,260), wherein said control system (50,260) enables remote isolation of the equipment (20,21) by one or more mobile isolation device(s) (120) provided as part of the remote isolation system (10) and configured to request the control system (50,260) to authorize equipment (20,21) isolation.
US10222757B2
Regulating members for a mechanical timepiece, specifically a system based on magnetic interaction between a resonator, in a form of a tuning fork for example, and an escape wheel, as a magnetic escapement. In the system plural areas of magnetic interaction between the resonator and the escape wheel are arranged such that torques produced at the escape wheel by the interactions compensate each other if the escape wheel is not synchronized at the frequency of the resonator. This results in negligible torque in the escape wheel when the escape wheel rotates slowly in a direction of an arrow or opposite direction. This allows the timepiece to start with a low mainspring torque and without any start procedure or device and provides better resistance of the timepiece against a loss of synchronization in event of a shock.
US10222756B2
A watch crown assembly has a body configured to receive rotary input. The body defines a recess and a retention feature. The watch crown assembly further comprises a ceramic member positioned at least partially in the recess and a mounting arm attached to the ceramic member. The mounting arm is engaged with the retention feature of the body, thereby retaining the ceramic member to the body.
US10222733B2
An image forming apparatus includes: a first conveyance roller pair configured to convey a sheet by rotating while tightly sandwiching the sheet; a rotation blade pair disposed on a downstream side of the first conveyance roller pair in a conveyance path of the sheet and configured to cut the sheet in a direction parallel to the conveyance direction by rotating while sandwiching the sheet; and a second conveyance roller pair configured to convey a cut waste sheet cut by the rotation blade pair in the sheet conveyance direction by rotating while tightly sandwiching the cut waste sheet. A rotational speed of the second conveyance roller pair is controlled at a rotational speed higher than a rotational speed of the first conveyance roller pair.
US10222728B2
A fixing device includes a heating body, a pressuring body, a lateral plate supporting the heating or pressuring body, a first supporting body supporting the heating or pressuring body, a second supporting body including a roller, a tensile spring between the first and second supporting bodies, an eccentric cam, a rotating shaft, a protrusion, a driving part, and a pressing member. The cam is supported between the first and second supporting bodies swingable in the lateral plate and has a depression gradually inclined from an upstream side to a downstream side in a rotation direction. The protrusion is protruded from the rotating shaft and meets the depression. The pressing member presses the cam opposite the protrusion. The cam rotates and meets the roller to shift the second supporting body and to extend and contract the spring, and changes a nip pressure from a first pressure to a lower second pressure.
US10222727B2
An image forming apparatus includes: an image former that forms on a recording material a toner image based on input image information; a fixer that fixes a toner image formed on the recording material; and a hardware processor that controls the image former and the fixer in which the hardware processor controls the image former to supply, to a region where no toner is provided between toner images based on the input image information, complementing toner having a thermal conductivity higher than a thermal conductivity of toner for forming the toner image based on input image information.
US10222726B2
A developing device includes a development roller, a layer-thickness limiting member, and a first screw. The development roller includes a fixed magnet and a sleeve. The first screw supplies developer to the development roller while conveying the developer in a first conveyance direction. The sleeve includes a plurality of recesses. Each of the recesses has an elongated shape, and a downstream end and an upstream end in the first conveyance direction. The downstream end is located farther downstream in a rotational direction of the sleeve than the upstream end. When the developer in each of the recesses passes the layer-thickness limiting member, the developer moves upstream in the first conveyance direction.
US10222724B2
A developing cartridge may include: a casing; a developing roller extending in a first direction; a developing-roller gear; a coupling including a coupling gear; a first idle gear; a second idle gear; an agitator; a first agitator gear; and a protrusion. The developing-roller gear, the coupling, the first idle gear, the second idle gear, the first agitator gear, and the protrusion may be positioned at an outer surface of the casing. The protrusion may be positioned between a first axis of the coupling and a third axis of the first agitator gear in a second direction connecting the first and third axes. The protrusion may be positioned outside an addendum circle of the developing-roller gear, an addendum circle of the coupling gear, an addendum circle of the first idle gear, and an addendum circle of the second idle gear. The first agitator gear may be spaced apart from the protrusion in the first direction.
US10222722B2
A toner storing container stores toner and is provided attachable to and detachable from an image forming apparatus. The toner storing container includes: a container body that includes an opening, and an inner circumferential surface extending toward the opening around a center line extending in one direction; and a toner conveyer that is attached onto the inner circumferential surface of the container body. The toner conveyer projects inward from the inner circumferential surface as well as spirally extends in the one direction around the center line.
US10222720B2
In an image forming apparatus, a seal member is a non-conductive, flexible member supported by a developing device. The seal member is formed to project from an edge part of the developing device that faces an image carrying member, along a longitudinal direction of the image carrying member. The seal member fills a part of a gap between the developing device and an outer circumferential surface of the image carrying member. An electrode film is adhered to a surface of the seal member. The electrode film is a conductive film. A potential detecting device detects a potential of the electrode film. A charging controller controls a charging voltage based on a result of comparison between a predetermined reference potential and the potential detected by the potential detecting device.
US10222718B2
In a configuration in which a voltage of polarity opposite to charging polarity of toner is applied to a conveyance guide, controlling deposition of toner on the conveyance guide has been difficult. When performing duplex image formation, a potential difference between a surface potential of a photoconductive drum charged by a charging roller and a potential of the conveyance guide is smaller during printing on the second surface than during printing on the first surface.
US10222717B2
The invention relates to a hydrophobic silica powder which is unprecedentedly insensitive to environmental humidity with which electrophotographic toner can possess stable electro static charge that leads to stable quality of printed image.The hydrophobic silica powder has the following physicochemical properties; average primary particle size (D) is 30-2000 nm, B*D<430 nm, while B stands for weight % of adsorbed water vapor on silica (100 weight %) when the partial pressure of water to the equilibrium vapor pressure of water at 25° C. is 80% and D stands for average primary particle size (nm) of the silica powder, B/C<2.7, while C stands for weight % of adsorbed water vapor on silica (100 weight %) when the partial pressure of water to the equilibrium vapor pressure of water at 25° C. is 20%, and carbon content>0.30 wt.-%.
US10222711B2
A lithographic apparatus with a cover plate formed separately from a substrate table, the cover plate configured to be to a side of the substrate during exposure, the cover plate being removable from the substrate table and supported on the substrate table by a protrusion. The lithographic apparatus further includes a linear encoder system configured to measure at least translation of the substrate table, a part of the linear encoder system being on the substrate table and located outward of the cover plate.
US10222709B2
A pattern is applied to a substrate by a lithographic apparatus as part of a lithographic manufacturing system. Structures are produced with feature sizes less than 10 nm. A target includes one or more gratings with a direction of periodicity. A detector captures one or more diffraction spectra, to implement small angle X-ray scattering metrology. One or more properties, such as linewidth (CD), are calculated from the captured spectra for example by reconstruction. The irradiation direction defines a non-zero polar angle relative to a direction normal to the substrate and defines a non-zero azimuthal angle relative to the direction of periodicity, when projected onto a plane of the substrate. By selecting a suitable azimuthal angle, the diffraction efficiency of the target can be enhanced by a large factor. This allows measurement time to be reduced significantly compared with known techniques.
US10222703B2
A device manufacturing method includes conditioning a beam of radiation using an illumination system. The conditioning includes controlling an array of individually controllable elements and associated optical components of the illumination system to convert the radiation beam into a desired illumination mode, the controlling including allocating different individually controllable elements to different parts of the illumination mode in accordance with an allocation scheme, the allocation scheme selected to provide a desired modification of one or more properties of the illumination mode, the radiation beam or both. The method also includes patterning the radiation beam having the desired illumination mode with a pattern in its cross-section to form a patterned beam of radiation, and projecting the patterned radiation beam onto a target portion of a substrate.
US10222689B2
A mask blank includes a glass substrate including a first main surface and a second main surface, an absorbing film formed above the first main surface, and a conductive film formed on the second main surface. A reflective film is provided between the absorbing film and the glass substrate. In a surface of the conductive film on an opposite side to the glass substrate, when a surface shape of a square central area having a length of 142 mm and a width of 142 mm excluding a four-sided frame-shaped peripheral area thereof is expressed by the specific formula, flatness of a component obtained by summing all aklPk(x)Pl(y) with the sum of k and l being 3 or more and 25 or less is 20 nm or less.
US10222685B2
A projection image display device includes: a light source that emits a blue illumination light; a phosphor that produces, in a region irradiated by the blue illumination light, a yellow illumination light including a component in a red band and a component in a green band from a portion of the blue illumination light and that reflects the blue illumination light and the yellow illumination light; and a filter that reflects a portion of the blue illumination light reflected by the phosphor toward the phosphor. The filter reflects the portion of the blue illumination light so as to be imaged at a position displaced from a region on a phosphor surface irradiated by the blue illumination light, and the phosphor produces a yellow illumination light also from the blue illumination light reflected by the filter.
US10222672B2
A color filter comprises a substrate (1), color filter layers, and a black matrix (3). A first transparent conductive layer (2) is provided on a side of the black matrix (3) close to the substrate (1). A second transparent conductive layer (4) is provided on a side of the black matrix (3) facing away from the substrate (1). The black matrix (3) is made of an electrochromic material. A display device including the color filter and a manufacturing method of the color filter are provided. The color filter allows the display device with good outdoor readability and excellent indoor display effect.
US10222663B2
The present disclosure provides an array substrate and a method of manufacturing the same, and a display panel. In an embodiment, an array substrate includes: gate lines and data lines on a base substrate; and sub-pixels defined by the gate lines and the data lines and each including a pixel electrode and a common electrode. One of the pixel electrode and the common electrode, which is away from the base substrate, includes a plurality of electrically connected electrode strips, and there is a pitch between any adjacent two of the electrode strips in a horizontal direction. The array substrate further comprises a metal wire in the sub-pixel, and the metal wire is located in a region between the pixel electrode and the data line.
US10222659B2
A liquid crystal display includes a substrate, and a pixel electrode disposed on the substrate. The pixel electrode includes a plurality of micro-branches which are spaced apart from each other and extend side by side with each other, where a micro-slit is defined between the micro-branches, and a stem part which is connected to each of the micro-branches, where an indentation pattern is defined by a cutout portion extending into the stem part, and at least one of two points connecting the indentation pattern and the micro-slit is located on a slit boundary line at which the micro-slit and the stem part meet each other.
US10222648B2
The embodiments of the present invention provide a liquid crystal display panel and a display device. The liquid crystal display panel includes a first substrate, a second substrate and a liquid crystal layer. A first grating layer is arranged on a side of a first basal substrate departing from the second substrate, a scattering layer is arranged on a side of the first grating layer departing from the second substrate, the first grating layer includes a plurality of first light shielding walls and first transparent columns arranged alternately. The liquid crystal in the liquid crystal layer is doped with a polymerizable liquid crystal monomer with a predetermined volume ratio. Normal display of bright and dark states can be realized without a polarizer, and the transmittance is improved. The phase retardation can also be achieved without the cooperation of polarizer and liquid crystal, eliminating the issue of viewing angle.
US10222646B2
The present invention provides a display substrate and a manufacturing method thereof, and a driving method of a display substrate. In the display substrate, a plurality of pixel groups are repeatedly arranged on a substrate base, each of the pixel groups comprises four first subpixels, four second subpixels, four third subpixels and four fourth subpixels, the subpixels in each of the pixel groups are arranged in a 4×4 matrix, each row of subpixels in each of the pixel groups include one first subpixel, one second subpixel, one third subpixel and one fourth subpixel, the first subpixel, the second subpixel, the third subpixel and the fourth subpixel in different rows of subpixels in each of the pixel groups are arranged successively in different orders, and subpixels with the same color are not located in the same column so that the subpixels are distributed uniformly.
US10222645B2
A display device may include a first layer, a passivation layer, and a pixel. The passivation layer may overlap the first layer and may include a first passivation portion and a second passivation portion. The pixel may include a first-color filter, a first-color-corresponding electrode, a second-color filter, and a second-color-corresponding electrode. The first-color-corresponding electrode may overlap the first-color filter and may be positioned between the first layer and the first passivation portion. The second-color-corresponding electrode may overlap the second-color filter. The second passivation portion may be positioned between the first layer and the second-color-corresponding electrode.
US10222644B2
Disclosed is a liquid crystal display device that may include a first substrate; a first electrode on the first substrate, the first electrode including a plurality of first inclined planes; a nanocapsule liquid crystal layer on the first electrode, the nanocapsule liquid crystal layer including a plurality of nano-sized capsules dispersed in a buffer layer, each of the plurality of nano-sized capsules including nematic liquid crystal molecules having a negative dielectric constant anisotropy; and a second electrode on the nanocapsule liquid crystal layer, the second electrode including a plurality of second inclined planes facing the plurality of first inclined planes, wherein the nanocapsule liquid crystal layer is substantially, optically isotropic in a normal state, and is optically anisotropic when a voltage is applied to the first and second electrodes.
US10222635B2
Systems and methods for creating fully custom products from scratch without exclusive use of off-the-shelf or pre-specified components. A system for creating custom products includes an image capture device for capturing image data and/or measurement data of a user. A computer is communicatively coupled with the image capture device and configured to construct an anatomic model of the user based on the captured image data and/or measurement data. The computer provides a configurable product model and enables preview and automatic or user-guided customization of the product model. A display is communicatively coupled with the computer and displays the custom product model superimposed on the anatomic model or image data of the user. The computer is further configured to provide the customized product model to a manufacturer for manufacturing eyewear for the user in accordance with the customized product model. The manufacturing system is configured to interpret the product model and prepare instructions and control equipment for the manufacturing of the customized product.
US10222624B2
Provided is a multi-channel optical module device. The optical module device includes: a light source unit configured to include a plurality of laser diodes that are capable of wavelength modulation according to current; a beam splitter unit configured to include a plurality of beam splitters that have different reflectivity and transmissivity and reflect or transmit light output from each laser diode of the light source unit to output them in a first direction or a second direction; and an optical coupler configured to couple and output the light from the beam splitter unit. Center wavelengths of the laser diodes of the light source unit are different from each other, and the number of output channels varies according to the number of laser diodes.
US10222623B2
A fiber-based composite graded-index (GRIN) mode field adaptor configured to receive a circular Gaussian beam and to reformat the circular Gaussian beam into an elliptical Gaussian beam. Certain examples provide a fiber laser system including an input fiber configured to produce a circular Gaussian input beam, a semi-guiding high aspect ratio (SHARC) fiber, and the composite GRIN mode field adaptor coupled between the input fiber and the SHARC fiber, the composite GRIN mode field adaptor including a pair of GRIN lens fibers and being configured to receive the circular Gaussian input beam from the input fiber and to reformat the circular Gaussian input beam into an elliptical Gaussian beam to be coupled into the SHARC fiber.
US10222611B2
An optical system comprises a light source and a light integration module, which comprises a light integration rod, an optical assembly and an anti-reflection coating. The light integration rod has an entrance, which is covered by the optical assembly. The optical assembly has a transparent surface, and a surface area of the transparent surface is greater than a cross-sectional area of the entrance of the light integration rod. The anti-reflection coating is formed on the transparent surface. After an incident light is transmitted through the anti-reflection coating, it is transmitted through the optical assembly along a light path, and then outputted to the entrance of the light integration rod.
US10222608B2
Provided is a micro drive unit, which is capable of performing multi-axis drive, the micro drive unit including: a movable object; and at least one pair of beams configured to pivotally support the movable object and formed only in one direction, the movable object being configured to rotate or translate in an x-axis direction, a y-axis direction, and a z-axis direction when the at least one pair of beams is twisted or bent at one or a plurality of resonant frequencies of the at least one pair of beams, thereby being capable of simultaneously avoiding upsizing and complication of the structure. And by incorporating the micro drive unit, a micro device capable of achieving multi-axis drive can be manufactured.
US10222607B2
A three-dimensional (3D) endoscope is provided. The 3D endoscope comprises a probe; a positioning device to locate a tip of the probe at a first position O and a second position O′; a light guide extending through the probe and configured to guide a light propagating through the probe configured to project on a surface a first light beam from the tip at the first position and a second light beam from the tip at the second position; a detector configured to detect the first light beam reflected from the surface and the second light beam reflected from the surface; and an image processor configured to determine a first distance R between the first position and the surface based on a position difference between the first and second positions, a first deflection angle θ of the first light beam deflected from the probe at the first position and a second deflection angle θ′ of the second light beam deflected from the probe; obtain image data carried by the first and second light beams detected by the detector; and obtain a 3D image based, the first distance R, the first deflection angle θ, and the first rotation angle φ associated with each pixel on the image.
US10222605B2
In one aspect an imaging system includes: an illumination system including an array of light sources; an optical system including one or more lens arrays, each of the lens arrays including an array of lenses, each of the lenses in each of the one or more lens arrays in alignment with a corresponding set of light sources of the array of light sources; an imaging system including an array of image sensors, each of the image sensors in alignment with a corresponding lens or set of lenses of the one or more lens arrays, each of the image sensors configured to acquire image data based on the light received from the corresponding lens or set of lenses; a plate receiver system capable of receiving a multi-well plate including an array of wells, the plate receiver system configured to align each of the wells with a corresponding one of the image sensors; and a controller configured to control the illumination of the light sources and the acquisition of image data by the image sensors, the controller further configured to perform: an image acquisition process including a plurality of scans, each scan associated with a unique pattern of illumination, each of the image sensors configured to generate an image for a respective one of the wells during each scan; and an image reconstruction process during which the controller performs a fourier ptychographic operation to generate a reconstructed image for each of the wells based on the image data captured for the respective well during each of the scans.
US10222596B2
At least one lens element defines a cylindrical void that encloses a conical element having a conical mirror surface defined about a common vertical axis upward from a tip on a generally 45-degree angle to the vertical axis. The lens element(s) have cross-sectional shapes defined relative to a plane passing through the lens element and including the vertical axis, the cross-sectional shape constant in rotation about the vertical axis and imparting a generally toroid shape to the lens element(s) for capturing image information from a surrounding scene and translating the captured light into a horizontal projection is oriented toward the conical mirror surface, which reflects the projection 90 degrees vertically downward toward an image plane of a light sensitive sensor for generating a photographic representation of the surrounding scene.
US10222595B2
An optical multipass system is configured to include, in addition an end-mirror configuration of reflective surfaces, a multipass pattern folding assembly. The end-mirror configuration includes at least two reflective surfaces arranged to provide for establishing cell stability of an optical multipass cell comprising all or part of the optical multipass system, or further provide for directing and/or focusing light within the optical multipass cell. The multipass pattern folding assembly includes at least two inner reflective surfaces configured to provide for folding an optical pattern intra-cavity at least twice off one of the inner reflective surfaces of the multipass pattern folding assembly.
US10222590B1
The present disclosure discloses a camera optical lens. The camera optical lens including, in an order from an object side to an image side, a first lens, a second lens, a third lens, a fourth lens, a fifth lens, a sixth lens and a seventh lens. The camera optical lens further satisfies specific conditions.
US10222586B2
An imaging lens module includes an imaging lens assembly and a first optical component. The imaging lens assembly has an optical axis and includes a lens element. The lens element includes an effective optical portion, which is non-circular and disposed on a center of the lens element. The first optical component has a non-circular opening hole. The effective optical portion of the lens element of the imaging lens assembly is corresponded to the non-circular opening hole of the first optical component.
US10222580B2
An improved mount for, and method of mounting, an optical structure having a grooved/relieved protruding member with a damping ring therein or on is provided. The grooved/relieved protruding member may extend from the optical structure, and an upper element having a first opening extending therethrough may receive at least a portion of the grooved/relieved member in the first opening. The upper element may include second and third openings therein that operate along with the first opening and a tightening mechanism. Tightening of the tightening mechanism into at least one of the third opening and the second opening causes the ends of the head portions to draw toward each other so that the first opening of the upper element tightens around the at least a portion of the grooved/relieved protruding member.
US10222578B2
In a linear driving apparatus including a vibration wave motor, a driving target body movable in a moving direction, a transmission member which is held by the driving target body and abuts against an abutment part of a moving member to synchronously move the vibration wave motor and the driving target body, and a biasing member which gives a biasing force between the transmission member and the abutment part, the direction of a pressure contact force which a vibrator receives from a friction member and the direction of a biasing contact force which the abutment part receives from the biasing member are parallel and opposite to each other, and the load center of the distribution load of the biasing contact force falls within the range of the vibrator.
US10222576B2
In order to provide a projection lens barrel and a projection display device that are capable of correcting the optical characteristics of a plurality of lens groups, a projection lens barrel, comprising a lens optical system causing light from an image display element to be formed as a projected image on a screen, also comprises correction mechanisms that move each of at least two lens groups along an optical axis and correct the optical characteristics to be corrected, said lens groups each having different optical characteristics for correction in order to suppress reduction in image quality of a projected image caused by changes in optical characteristics caused by temperature changes in the projection lens barrel.
US10222570B2
Fiber optic equipment that supports independently translatable fiber optic modules and/or fiber optic equipment trays containing one or more fiber optic modules is disclosed. In some embodiments, one or more fiber optic modules are disposed in a plurality of independently translatable fiber optic equipment trays which are received in a tray guide system. In this manner, each fiber optic equipment tray is independently translatable within the guide system. One or more fiber optic modules may also be disposed in one or more module guides disposed in the fiber optic equipment trays to allow each fiber optic module to translate independently of other fiber optic modules in the same fiber optic equipment tray. In other embodiments, a plurality of fiber optic modules are disposed in a module guide system disposed in the fiber optic equipment that translate independently of other fiber optic modules disposed within the module guide system.
US10222567B2
There is provided an electronic device including: a receptacle comprising at least two electrical contacts and a plurality of a light-emitting parts configured to emit laser light for performing communication by light to a sink device; and a light emission control part configured to control emission of laser light from the plurality of light-emitting parts, wherein the light emission control parts starts control of the emission of the laser light from the plurality of light-emitting parts by a current when a cable is connected to the receptacle and the current flow to the electrical contacts from the sink device.
US10222564B2
A three dimensional optical interconnect device having one input and multiple output ports mounted on the same surface of a SOI wafer is disclosed. The first Si surface has a silicon waveguide with a straight portion, a first and a second 45 degree end reflectors and multiple optical splitters arranged in a sequence along the straight portion. The second silicon surface has an insulating layer and an active optical input device (VCSEL laser) and multiple receiver ports mounted on the insulating layer. The first end reflector is aligned to the input optical device, the optical splitters and the second end reflector are sequentially aligned to the photodetectors respectively. Multiple optical paths are formed from the input optical device to each of photodetectors by a reflection from each aligned optical splitter and a reflection from the second end reflector through the silicon substrate.
US10222561B2
A light launch device for transmitting light into a traceable fiber optic cable assembly with tracing optical fibers is disclosed herein. The traceable fiber optic cable assembly and light launch device provide easy tracing of the traceable fiber optic cable assembly using fiber optic tracing signals. Further, the launch connector is easily attached to and removed from the fiber optic connector with repeatable and reliable alignment of optic fibers, even when the fiber optic connector is mechanically and/or optically engaged with a network component. The fiber optic connectors are configured to efficiently illuminate an exterior of the connector for effective visibility for a user to quickly locate the fiber optic connector.
US10222560B2
A cable tracing system includes a fiber optic connector with a connector fiber guide. The connector fiber guide includes a planar surface, a launch opening defined in the planar surface, and at least one alignment surface proximate the planar surface. The connector also includes a tracing optical fiber with a first launch end positioned within the launch opening of the fiber guide. The tracing optical fiber is accessible from an exterior of the housing for receiving an optical tracing signal from a launch optical fiber. The alignment surface is configured to axially align the launch optical fiber with the first tracing optical fiber.
US10222558B2
A ferrule for optical fiber connector includes a first body component, a second body component, and a third body component. The first body component includes at least one first mounting portion and two accommodation portions. The second body component is disposed above the first body component, and includes at least one second mounting portion, where the at least one second mounting portion corresponds to the at least one first mounting portion. The third body component is disposed above the first body component and the second body component, and includes at least one positioning through aperture and two second through apertures, where the two second through apertures correspond to the two accommodation portions, respectively. The first body component, the second body component, and the third body component are adhered integrally together, with adhesive. Also disclosed is a positioning mold for positioning the ferrule. By using the positioning mold, the ferrule for optical fiber connector can be assembled more easily, so as to improve the productivity in manufacturing optical fiber connectors.
US10222545B2
An optical fiber includes a core having a maximum refractive index n1, and cladding provided around the core and having a refractive index n0 that is lower than the maximum refractive index n1. A radial refractive-index profile of the core is expressed with an exponent α that is 1.5 to 10. A relative refractive-index difference Δ1 at a center of the core that is expressed as Δ1=100×(n12−n02)/(2n12) is 0.3% to 0.5%. A diameter 2a of the core is 9 μm to 14 μm. A zero-dispersion wavelength is 1300 nm to 1324 nm. A cable cutoff wavelength λcc is 1260 nm or shorter. A bending loss at a wavelength of 1550 nm in a case where the optical fiber is wound by ten turns with a bend diameter of 30 mm is 0.25 dB or smaller.
US10222531B2
Provided are a backlight and a liquid crystal display device including the same. The backlight unit includes a light source assembly which emits light; a light guide plate which receives at a light incident surface thereof light from the light source assembly; and a bottom chassis having a bottom unit on which the light guide plate is disposed. The bottom unit of the bottom chassis has a first bottom portion which is arranged in the vicinity of the light incident surface and has a first recess, a second bottom portion which is bent diagonally to the cross sectional surface and has a second recess, and a third bottom portion which is bent at the second bottom portion in the direction parallel to the first bottom portion and disposed higher than the first bottom portion. A light absorbing member is disposed in the first and second recesses.
US10222528B2
According to one embodiment, a display device includes an optical element urging incident light to be transmitted or reflected, a first reflective element includes a first retroreflective surface in an uneven state on which the light reflected on the optical element is retroreflected, and a first specular reflection surface on which the light reflected on the optical element is specularly reflected, and a second reflective element includes a second retroreflective surface in an uneven state on which the light reflected on the first specular reflection surface is retroreflected.
US10222526B2
An optical filter having a passband at least partially overlapping with a wavelength range of 800 nm to 1100 nm is provided. The optical filter includes a filter stack formed of hydrogenated silicon layers and lower-refractive index layers stacked in alternation. The hydrogenated silicon layers each have a refractive index of greater than 3 over the wavelength range of 800 nm to 1100 nm and an extinction coefficient of less than 0.0005 over the wavelength range of 800 nm to 1100 nm.
US10222525B2
The optical member of the present invention includes: a substrate; and a dot that is in contact with a surface of the substrate, in which the dot has wavelength selective reflecting properties, the dot is formed of a liquid crystal material having a cholesteric structure, the cholesteric structure has a stripe pattern including bright portions and dark portions in a cross-sectional view of the dot when observed with a scanning electron microscope, the dot includes a portion having a height which continuously increases to a maximum height in a direction moving from an end portion of the dot to the center of the dot, in the portion, an angle between a normal line perpendicular to a line, which is firmed using a first dark portion from a surface of the dot, and the surface is in a range of 70° to 90°, and the liquid crystal material includes a surfactant.
US10222524B2
An optical filter providing selective transmittance of target wavelengths of light and tunable, differential front and back surface reflectance.
US10222517B2
An aperture stop that includes a non-circular region that comprises at least one opaque region and at least one opening region; wherein each point in the at least one opening region is (a) mapped to an angle of illumination and (b) is associated with a corresponding point in the at least one opaque region that. mapped to an angle of specular reflectance from the angle of illumination mapped to the opening point.
US10222515B2
An illumination device includes an optical waveguide having an optical waveguide start and an optical waveguide end. At least one light-emitting diode is assigned to the optical waveguide start. A light-absorbing element is arranged at the optical waveguide end. The light-absorbing element includes an adhesive bed with an adhesive. The adhesive of the adhesive bed has light-absorbing properties.
US10222511B2
The invention relates to an optical article comprising a substrate coated with an abrasion and scratch resistant coating composed of a lower layer and an upper layer that do adhere to each other, the upper layer and the lower layer being layers of cured upper and lower layer compositions, said upper layer composition comprising at least one organosilane, or a hydrolyzate thereof, of formula RnYmSi(X)4-n-m and at least one compound, or a hydrolyzate thereof, of formula M(Z)x, the following ratio being lower than 2.3: Rs = theoretical dry matter weight of compounds I in the upper layer composition theoretical dry matter weight of compounds II in the upper layer composition said lower layer composition comprising at least one organosilane, or a hydrolyzate thereof, of formula R′n′Y′m′Si(X′)4-n′-m′ and, optionally, at least one compound, or a hydrolyzate thereof, of formula M′(Z′)y, the following ratio being higher than 2.3: Ri = theoretical dry matter weight of compounds III in the lower layer composition theoretical dry matter extract of compounds IV in the lower layer composition In the hereabove formulas, M and M′ are metals or metalloids of valences x and y, at least equal to 4, R and R′ groups are monovalent organic groups that are bound to silicon through a carbon atom and that contain at least one epoxy function, X, X′, Z and Z′ groups are hydrolyzable groups, Y and Y′ are monovalent organic groups that are bound to silicon through a carbon atom, n, m, n′ and m′ being integers such that n and n′=1 or 2 with n+m and n′+m′=1 or 2.
US10222509B2
The invention is related to a cost-effective method for making a silicone hydrogel contact lens having a crosslinked hydrophilic coating thereon. A method of the invention involves autoclaving, in a sealed lens package, a silicone hydrogel contact lens having a base coating of polyacrylic acid thereon in an aqueous solution in the presence of a water-soluble, crosslinkable hydrophilic polymeric material having epoxide groups, for a period of time sufficient to covalently attach the crosslinkable hydrophilic polymeric material onto the surface of the silicone hydrogel contact lens through covalent linkages each formed between one epoxide group and one of the carboxyl groups on and/or near the surface of the silicone hydrogel contact lens.
US10222508B2
A method and system for computing and visualizing sedimentary attributes may include receiving, by a processor, paleo-geographic coordinates representing predicted approximate positions of particles of sediment deposited at a time period when a layer was originally formed. The processor may numerically compute or determine a sedimentation rate that varies laterally along the layer. The processor may determine a sedimentary attribute based on the lateral variation of the sedimentation rate along the layer with respect to the paleo-geographic coordinates. A monitor or display may display the sedimentary attribute of the layer in the present-day geological space.
US10222505B2
In some embodiments, an apparatus, system, and method may operate to transmit, using a first transceiver antenna, a common signal into a geological formation, and to receive in response to the transmitting, at the first transceiver antenna, a first corresponding nuclear magnetic resonance (NMR) signal from a first volume of the formation. Additional activity may include receiving, in response to the transmitting, at a second transceiver antenna spaced apart from the first transceiver antenna, the common signal transformed by the formation into a received resistivity signal, as well as transmitting, using the second transceiver antenna, a second corresponding NMR signal into a second volume of the formation different from the first volume of the formation. Additional apparatus, systems, and methods are disclosed.
US10222470B2
A method for processing radar signals, wherein said radar signals comprise digitized data received by at least one radar antenna, the method comprising (i) determining FFT results based on the digitized data received; and (ii) storing a first group of the FFT results, wherein the first group of FFT results comprises at least two portions, wherein a first portion of FFT results is stored with a first accuracy and a second portion of FFT results is stored with a second accuracy.
US10222469B1
This document describes apparatuses and techniques for radar-based contextual sensing. In some aspects, a radar sensor of a device is activated to obtain radar data for a space of interest. Three-dimensional (3D) radar features are extracted from the radar data and positional data is received from sensors. Based on the positional data, spatial relation of the 3D radar features is determined to generate a set of 3D landmarks for the space. This set of 3D landmarks is then compared with known 3D context models to identify a 3D context model that matches the 3D landmarks. Based on a matching 3D context model, a context for the space is retrieved and used to configure contextual settings of the device. By so doing, contextual settings of the device be dynamically configured to address changes in context or for different device environments.
US10222468B2
A radar system may comprise a trigger, driver, switching circuit, and antenna for generating an ultra-short impulse without utilizing an oscillator. A radar imaging system for imaging a formation or a cross section of a pipeline may include at least one radar sensor. The system may transmit a high-frequency, short impulse signal to a formation or pipeline and measure a reflected signal. A high speed impulse generator may allow the short impulse signals to be generated. This impulse generator may utilize a switching circuit and digital driver to provide the short impulse signals. The images provide useful information about complex permittivity of the formation, the geometry of the pipeline, deposition thickness of asphaltenes and wax, velocity of the fluid, as well as size, type, concentration of gas bubbles, water, or solid particles in the flow, or combinations thereof.
US10222466B2
The present disclosure relates to a method for the registration of a 3-dimensional all-round view of a moving human or animal body surface. The method accordingly comprises the steps: determination (A) of a movement velocity of at least one region of the body surface and registration (B) at least of the region of the body surface at a timing point at which the value of the movement velocity of this region falls below a defined threshold value.
US10222464B2
Systems and methods for monitoring a vehicle location and orientation use initial location and orientation data in combination with one or more past calculated vehicle speeds and steering angles. A near field radio frequency (RF) transmission is periodically emitted and is receivable by one or more antennas embedded in one or more tires of the vehicle. One or more responsive RF transmissions are periodically received from respective ones of the one or more antennas embedded in the tires, and the vehicle speed and steering angle are periodically calculated based on the received RF transmissions. The current vehicle location and orientation are periodically calculated based on the initial location and orientation data and one or more past calculated vehicle speeds and steering angles.
US10222462B2
A radar system in an autonomous vehicle may be operated in various modes and with various configurations. In one example, the radar system determines a target range for further interrogation. The target range may be determined based on the radar system transmitting a first electromagnetic radiation signal and receiving a first reflected electromagnetic signal radiation signal. After the radar system determines a target range, it transmits a second electromagnetic radiation signal. Additionally, the radar system receives a reflected electromagnetic signal radiation based on the transmission. After receiving the reflected signal, the radar system can process the reflected signal to only have components associated with the target range. The processing of the reflected signal may create a processed signal. Finally, the radar system may determine at least one parameter of a target object based on the processed signal.
US10222457B2
A proximity sensor includes a transmitter unit, a receiver unit, and a housing. The transmitter unit transmits a light signal. The receiver unit receives the light signal reflected by an object to determine a proximity status of the object. The housing defines a first enclosed accommodation space for accommodating the receiver unit, wherein the portion of the housing defining the first enclosed accommodation space has a sealed light passage made of a light-transmissible material such that the receiver unit is capable of receiving the light signal reflected by the object through the light passage. The housing can further include a second enclosed accommodation space for accommodating the transmitter unit.
US10222454B2
A system, computer-readable medium, and method for receiving reflected signals. In one implementation, the system includes a receiver, a pulse compressor, a framer, and a frame generator. The receiver receives the reflected signals. The pulse compressor compresses the reflected signals and the framer interprets the reflected signals. The frame generator combines one or more modified frames associated with the reflected signals.
US10222444B2
A magnetic resonance imaging (“MRI”) system that can be operated while a subject performs, experiences, or otherwise undergoes naturalistic motion. This movable MRI (“mMRI”) system includes a magnet whose position and orientation can be changed while the subject is moving, such that the magnet and subject maintain a substantially fixed spatial relationship relative to each other.
US10222439B2
A magnetic resonance imaging (MRI) system and method for controlling the MRI system is provided. The method includes directing the MRI system to perform a pulse sequence that includes generating a RF excitation pulse to excite spins in slice locations within a selected slab to produce an echo train from the slab that is formed by a plurality of echoes. The sequence also includes applying a slice-encoding gradient to spatially encode echoes associated with a different slice in the slab, and applying readout gradients during the echo train to acquire MR data from the slab, the readout gradients including a first sampling strategy defining a spiral-in k-space trajectory and a second sampling strategy defining a spiral-out k-space trajectory, wherein the MRI system is directed to repeat the sequence such that a plurality of subsequent selected slabs are excited and MR data is acquired therefrom.
US10222429B2
A diagnostic system for a DC-DC voltage converter is provided. The DC-DC voltage converter has a high voltage bi-directional MOSFET switch. The high voltage bi-directional MOSFET switch has a first node and a second node. The microcontroller samples a first voltage at the first node at a first sampling rate utilizing a first common channel in a first bank of channels to obtain a first predetermined number of voltage samples. The microcontroller determines a first number of voltage samples in the first predetermined number of voltage samples in which the first voltage is less than a first threshold voltage. The microcontroller sets a first voltage diagnostic flag equal to a first fault value if the first number of voltage samples is greater than a first threshold number of voltage samples indicating a voltage out of range low fault condition for the analog-to-digital converter.
US10222428B2
A method for managing an authorized operating range of a battery, the authorized operating range being limited between a minimum level and a maximum level of state of charge of the battery. The method includes estimating a state of health in power of the battery, the state of health in power characterizing capacity of the battery to supply a minimum required power level across an entirety of the operating range; and determining the minimum level of state of charge of the battery in accordance with the estimated state of health in power, the minimum level of state of charge being increased when the state of health in power decreases.
US10222423B2
An electrical storage system includes an electrical storage device, a load, a line, a relay, a capacitor, a voltage sensor, a first insulation resistor, a second insulation resistor, a first current path, a second current path, and a controller. The capacitor has one end connected to the electrical storage device and the other end connected to a ground. The voltage sensor is configured to detect a voltage value of the capacitor. The first insulation resistor is provided between the electrical storage device and the ground. The second insulation resistor is disposed between the load and the ground. The first current path includes the first insulation resistor. The second current path includes the line and the second insulation resistor. The controller is configured to control ON and OFF of the relay.
US10222420B2
Aspects of the disclosed technology relate to techniques of test pattern generation based on the cell transition fault model. An assignment for two consecutive clock cycles at inputs of a complex cell in a circuit design is determined based on a gate-level representation of the circuit design. The assignment includes a first transition at one of the inputs which is sensitized by remaining part of the assignment to cause a second transition at an output of the complex cell. A test pattern that generates the assignment at the inputs and propagates a value at the output corresponding to the second clock cycle of the two consecutive clock cycles from the output to an observation point is then derived based on the gate-level representation.
US10222413B2
An IC handler (4) of the present invention transfers an IC device (D) to a test head (2). The test head (2) is provided with a socket (3), which has a placing surface (3a) having the IC device (D) placed thereon, and which attaches the IC device (D) placed on the placing surface (3a) to the test head (2). The IC handler (4) is provided with a non-contact displacement meter (71) that is disposed by being spaced apart from the socket (3) in the direction perpendicular to the placing surface (3a). The non-contact displacement meter (71) measures a distance from the non-contact displacement meter (71) to the IC device (D) placed on the placing surface (3a) by emitting a laser beam toward the placing surface (3a) of the socket (3).
US10222412B2
An IC degradation sensor is disclosed. The IC degradation management sensor includes an odd number of first logic gates electrically connected in a ring oscillator configuration, each first logic gate having an input and an output. Each first logic gate further includes a first PMOS transistor, a first NMOS transistor and a second logic gate having an input and an output. The input of the second logic gate is the input of the first logic gate, and the drains of the first PMOS transistor and the first NMOS transistor are electrically connected to the output of the second logic gate, and the output of the second logic gate is the output of the first logic gate.
US10222411B2
The invention provides grounding safety control point monitoring method, measuring circuit and equipment grounding measuring system, wherein, The grounding safety control point monitoring method comprises the following steps: A safety monitoring level signal corresponding to each circuit is output according to the comparison result of the voltage between the grounding safety control points of at least one circuit and the preset grounding safety standard voltage; one circuit of safety action level signal is adjusted and output according to at least one circuit of input safety monitoring level signal; grounding safety protection is done according to the safety action level signal. All grounding points are monitored in real time by comparing the voltage between grounding safety control points with preset grounding safety standard voltage, so as to guarantee the product safety, equipment safety and personal safety.
US10222405B2
A solid state analog device resistant to cyber security hacking is described herein. In one example, the device may include a signal input circuit, a comparator and driver circuit, and a display. The signal input circuit may be configured to detect loss of the input signal and the comparator and driver circuit may be configured to generate a voltage output and a reference power supply voltage from the input signal, wherein the comparator and driver circuit provides for a hardware-only design of the solid state analog device without digital assets, thus reducing cyber security hacking risks of the solid state analog device.
US10222404B2
A general load flow calculation method for power systems with unified power flow controller (UPFC). On the premise of satisfying the control objectives of UPFC, the calculation method combines the power injection model with the Newton-Raphson algorithm to solve the load flow of the power systems by iteration. It is applicable not only to a conventional UPFC structure, but also to a novel UPFC structure wherein the series and shunt transformers of a UPFC are connected to different AC buses or there are more than one series branch connected to a UPFC. The present invention provides the detailed process for performing a load flow evaluation, and it shows that it is unnecessary to add new state variables when solving the load flow by this method, the dimension of the Jacobian matrix will not increase during the iteration.
US10222398B2
An active probe adapter adapts an active probe to a PXI instrumentation module. The active probe adapter includes a first module interface (MI) connector on a first side of the active probe adapter. The first MI connector is configured to connect to a corresponding interface connector of the PXI instrumentation module. The active probe adapter further includes a plurality of probe pads on a second side of the active probe adapter opposite to the first side. The plurality of probe pads is configured to interface with an active probe employed with the PXI instrumentation module. The active probe adapter may include a second MI connector on the active probe first side configured to connect to a PXI power module and provide power to the active probe.
US10222396B2
An electronic device for visually representing an impact event is provided. The electronic device includes an accelerometer, a gyroscope, and a magnetometer for measuring its acceleration, angular rotation, and magnetic field intensity relative to its motion. Using any suitable filter, a normalization process is used to standardize readings from the accelerometer, gyroscope, and magnetometer. The electronic device also includes impact location and impact severity determination procedures executable by its processor from its memory module to provide an impact indicator or a visual representation of the impact which may indicate possible damage, shock or fracture incurred on the device. The impact indicator serves as a preview of impacts by displaying gradients of green, yellow and red depicted in increasing severity, i.e., from “no impact” event to “severe impact” event.
US10222392B2
A continuous throughput microfluidic system includes an input system configured to provide a sequential stream of sample plugs; a droplet generator arranged in fluid connection with the input system to receive the sequential stream of sample plugs and configured to provide an output stream of droplets; a droplet treatment system arranged in fluid connection with the droplet generator to receive the output stream of droplets in a sequential order and configured to provide a stream of treated droplets in the sequential order; a detection system arranged to obtain detection signals from the treated droplets in the sequential order; a control system configured to communicate with the input system, the droplet generator, and the droplet treatment system; and a data processing and storage system configured to communicate with the control system and the detection system.
US10222391B2
A continuous throughput microfluidic system includes an input system configured to provide a sequential stream of sample plugs; a droplet generator arranged in fluid connection with the input system to receive the sequential stream of sample plugs and configured to provide an output stream of droplets; a droplet treatment system arranged in fluid connection with the droplet generator to receive the output stream of droplets in a sequential order and configured to provide a stream of treated droplets in the sequential order; a detection system arranged to obtain detection signals from the treated droplets in the sequential order; a control system configured to communicate with the input system, the droplet generator, and the droplet treatment system; and a data processing and storage system configured to communicate with the control system and the detection system.
US10222386B2
The present invention relates to the field of cognitive function. More specifically, the present invention provides compositions and methods useful for assessing cognitive dysfunction/function in Alzheimer's disease and other diseases of cognition. In one embodiment, the method comprises the steps of (a) reducing heterocomplexes comprising NPTX1 and NPTX2 present in a biological sample obtained from the patient into NPTX1 and NPTX2 monomers; (b) covalently modifying the thiol groups of the NPTX1 and NPTX2 monomers to prevent re-formation of NPTX1/NPTX2 heterocomplexes; (c) detecting NPTX2 in the sample; and (d) assessing cognitive function in the patient by comparing NPTX2 detected in the sample to a control.
US10222380B2
A compound of formula (I) as described herein and methods and uses thereof as probes in the mass tagging of biosensors or biologically active materials for use in mass cytometry analysis of tissue samples such as in the detection, labelling and quantification of oxygen-deprived cells by using, for example, tellurophene-tagged 2-nitroimidazole.
US10222379B2
The present invention provides a flexible format for diagnostic tests that is applicable to measuring a wide range of properties of fluids, particularly physiological fluids, by creating a concentration gradient of an indicator in the sample under analysis and measuring a flux of the indicator through the sample which is used to determine a property of the sample. Aspects of the invention include a method of testing a property of a physiological fluid in a portable test device, a portable test device and a kit including a portable test device and a processor.
US10222374B2
Disclosed herein are methods for diagnosing or predicting B-cell rejection in a subject. In one example, for assessing transplant rejection, the method includes determining an antigen presenting index by comparing uptake of a donor antigen to uptake of a reference antigen in a biological sample obtained from the subject. In another example, for assessing GVHD, the method includes determining an antigen presenting index by comparing uptake of a recipient antigen to uptake of a reference antigen in a biological sample obtained from the subject.
US10222372B2
A rapid antibiotic susceptibility test (AST) based on the detection and quantification of the movement of single bacterial cells with a plasmonic imaging and tracking (PIT) technology. The PIT-based AST detects changes in the metabolic activity of the bacterial cells long before cell replication, and allows rapid AST for both cultivable and non-cultivable strains. PIT tracks 3D movement with sub-nanometer resolution and millisecond temporal resolution. PIT also allows simultaneous measurement of the binding kinetic constants of antibiotics and bacterial metabolic state after the introduction of antibiotics.
US10222358B2
A gas detection sheet wherein a porous coordination polymer represented by formula (1) is supported on a supporter and the air permeability of the gas detection sheet is 0.8 seconds or more and 60 seconds or less. Fex(pz)[Ni1-yMy(CN)4] (1) (wherein, pz=pyrazine, 0.95≤x<1.05, M=Pd or Pt, 0≤y<0.15).
US10222354B2
A non-contact durability diagnosis apparatus includes: (a) applying non-contactly and sequentially at least two excitation ultrasonic waves to an object and storing frequency signals generated from the object; (b) applying non-contactly and simultaneously the at least two excitation ultrasonic waves to the object and storing frequency signals generated from the object; (c) storing derived frequency signals remaining after removing an overlapping portion of the frequency signals of step (a) and the frequency signals of step (b); and (d) determining that the object is damaged when at least one of the generated frequency signals of step (c) is larger than a predetermined value.
US10222353B2
A method and assembly are provided in order to inspect a partially cured repair patch prior to installation. For example, an assembly for inspecting a repair patch is provided that includes a partially cured repair patch comprised of a composite material. The assembly also includes an acoustic facilitation layer disposed proximate of the surface of the repair patch through which ultrasonic signals will be introduced. The assembly further includes a vacuum bag surrounding the repair patch and the acoustic facilitation layer. The acoustic facilitation layer has an acoustic impedance that is closer to the respective acoustic impedances of the repair patch and the vacuum bag than the acoustic impedance of air is to the respective acoustic impedances of the repair patch and the vacuum bag.
US10222349B2
The invention provides methods and compositions, including, without limitation, algorithms, computer readable media, computer programs, apparatus, and systems for determining the identity of nucleic acids in nucleotide sequences using, for example, data obtained from sequencing by synthesis methods. A plurality of smaller flow cells is employed, each with a relatively small area to be imaged, in order to provide greater flexibility and efficiency.
US10222325B2
A portable spectrometer device includes an illumination source for directing at a sample, and a tapered light pipe (TLP) for capturing light interacting with the sample at a first focal ratio and for delivering the light at a second focal ratio lower than the first focal ratio. A linearly variable filter (LVF) separates the captured light into a spectrum of constituent wavelength signals; and a detector array, including a plurality of pixels, each of the plurality of pixels disposed to receive at least a portion of a plurality of the constituent wavelength signals provides a power reading for each constituent wavelength. Preferably, the TLP is lensed at one end, and recessed in a protective boot with stepped inner walls. The gap between the TLP and LVF is minimized to further enhance resolution and robustness.
US10222323B2
An inline concentration measurement device comprises: a measurement cell main body with a gas flow path formed; a light incident part with a window member connected to the main body; and a light receiving part with a window member connected to the main body, wherein the gas flow path includes a gas flow path for an optical path extending straight between the window members of the light incident part and the light receiving part, a first communication part making a gas inlet formed in the main body communicate with the gas flow path part for the optical path, and a second communication part making a gas outlet formed in the main body communicate with the gas flow path part for the optical path, and the first communication part obliquely extends from the gas inlet towards the window member of the light incident part.
US10222318B2
There is provided a particle detection apparatus (30) comprising: a channel (32) including an inlet and at least one channel wall, the inlet permitting light to be introduced into the channel (32), the or each channel wall being arranged to define a channel path through which light may propagate; a light source (34) configured to introduce light into the channel (32) via the inlet, the channel (32) being shaped to guide the light to propagate along the channel path for illuminating a particle or a plurality of particles located in the channel path; and a monitoring device (36) configured to detect scattered light that is created by the illumination of the or each particle by the guided light and that leaves the channel (32) by passing through the or each channel wall.
US10222316B2
An imaging flow cytometry apparatus and method which allows registering multiple locations across a cell, and/or across multiple flow channels, in parallel using radio-frequency-tagged emission (FIRE) coupled with a parallel optical detection scheme toward increasing analysis throughput. An optical source is modulated by multiple RF frequencies to produce an optical interrogation beam having a spatially distributed beat frequency. This beam is directed to one or more focused streams of cells whose responsive fluorescence, in different frequencies, is registered in parallel by an optical detector.
US10222307B2
A mixing device for operating biological, chemical or biochemical materials used in an assay includes a mixing member formed with a plurality of chambers, each having a sealable port provided along an edge of the mixing member. The mixing device also includes one or more compartments that are movable along the edge of the mixing member between selected ones of the sealed chambers. This compartment is operable to receive materials from and transfer materials between the chambers. Selected ones of the chambers include associated processing elements, for example, including heating and cooling elements, magnetic elements, membranes and lateral flow devices. The mixing device is also pivotable, for example, to facilitate the application of gravity force in the transfer of materials between the chambers and one or more compartments. The mixing device may operate manually by hand-held unit. Also, this mixing device may operate automatically with at least one driving unit.
US10222303B1
A dual spray chamber apparatus is described. In one or more implementations, the dual spray chamber apparatus includes a first cyclonic spray chamber for receiving an aerosol and conditioning the aerosol to separate a first conditioned portion of the aerosol from a second portion of the aerosol. The first cyclonic spray chamber defines a first chamber interior and comprises an input port in fluid communication with the first chamber interior. The dual spray chamber apparatus also includes a second spray chamber coupled with the first cyclonic spray chamber for receiving the first conditioned portion of the aerosol and further conditioning the first conditioned portion of the aerosol. The second spray chamber defines a second chamber interior and comprises an output port for expelling a first further conditioned portion of the first conditioned portion of the aerosol from the second chamber interior.
US10222297B2
The present invention includes an apparatus and method for measuring hysteretic heating or stress of one or more bearings of a craft comprising: one or more non-contact temperature sensors attached to the craft and directed toward the one or more bearings; and a computer connected to the one or more non-contact temperature sensors that measure the temperature, the stress, or both of the one or more bearings before, during, or after operation of the craft, wherein the one or more non-contact temperature sensors measure a change in temperature in the one or more bearings to monitor for heating or stress of the bearings.
US10222296B2
A device for monitoring a bearing, wherein the device comprises at least one sensor configured to obtain data concerning at least one of the factors that influences the residual life of the bearing. The device is a portable device and comprises a non-permanent attachment feature configured to non-permanently attach the device to a surface of the bearing so that at least a part of the at least one sensor is pressed against the surface of the bearing.
US10222293B2
There is provided an optical characteristic measuring method for measuring an optical characteristic of an optical system which forms, on a second plane, an image of an object arranged on a first plane, the optical characteristic measuring method including: arranging, on the first plane, a first area through which a measuring light passes or by which the measuring light is reflected; arranging a second area, through which the measuring light passes or by which the measuring light is reflected, on the second plane at a position corresponding to the first area; and detecting, via one of the first area and the second area, a light amount of the measuring light via the optical system and the other of the first area and the second area; wherein at least one of the first area and the second area has a shape such that a light amount, of the measuring light which passes or which is reflected via the optical system, is changed depending on the optical characteristic.
US10222282B2
A flywheel torsion measuring device with internal power, applied to a shaft and a flywheel of sports equipment, has a wheel connector, a power unit, a torsion measuring element and circuit boards. The wheel connector, for fastening the flywheel and connecting the shaft through a bearing, has an assembly space and an annular plate. The power unit provides a power. The torsion measuring elements are disposed on the annular plate of the wheel connector, and the circuit board, which is disposed in the assembly space of the wheel connector and electrically connects the power unit and the torsion measuring elements, converts the power into a working power for the torsion measuring element. The wireless transmission module of the circuit board transmits the measurement information generated by the torsion measurement component to the outside.
US10222271B2
A mechanism for indicating ambient temperature of an enclosure from temperatures determined within the enclosure. The temperatures may be obtained from two or more sensors at each of two or more locations within the enclosure. The enclosure may include heat generating components such as electronics. The enclosure may also incorporate one or more dynamic components that emanate sudden amounts of heat. The present mechanism compensates for such heat sources with a compensating scheme.
US10222270B2
Provided is a system for monitoring temperature of one or more subject bodies, the system including a resonant reading circuit adapted to generate resonant wireless power loads; a resonant receiver circuit adapted to be magnetically connected to the resonant reading circuit for receiving the resonant wireless power loads and for generating power based on the power loads received; one or more temperature sensors adapted to be operatively connected to the resonant receiver circuit for deriving power and for measuring the temperatures of the one or more subject bodies respectively based on the resonant wireless power loads received; and a relay circuit adapted to be operatively connected to the one or more temperature sensors and to the resonant receiver circuit for relaying the measured temperatures to the resonant reading circuit via the resonant receiver circuit using wireless resonant energy transfer. There is further provided a temperature-sensing device and a storage apparatus.
US10222268B2
A method for measuring the delay between N pulses having a duration less than 100 picoseconds comprises the steps: collimated emission of the pulses having the same repetition frequency, emission of a reference pulse having the same repetition frequency capable of producing interference fringes with each of the pulses, for each of the pulses, detection, by a detector, of the coherent sum of this pulse with the reference pulse, this sum producing the interference fringes, the fringes originating from each of the pulses being distinguishable from one another. The reference pulse is emitted with an adjustable delay, and the method further comprises: for each delay, simultaneous measurement for the pulses of N contrasts of the interference fringes, for each of the pulses, a delay value between this pulse and the reference pulse is determined by the delay corresponding to the maximum contrast.
US10222267B2
The detection device comprises a cold finger which performs the thermal connection between a detector and a cooling system. The cold finger comprises at least one side wall at least partially formed by an area made from the amorphous metal alloy. Advantageously, the whole of the cold finger is made from the amorphous metal alloy.
US10222252B2
Embodiments of a portable verification system can move from one in-field gas flow meter location to another and temporarily connect downstream of a main pipeline's meter run or station. A control valve of the portable verification system allows volume measurement at different flow velocities to be verified. In some embodiments, the portable verification system is connected to the meter run and the main pipeline by a corresponding slip or linearly adjustable pipeline section. This section can extend horizontally and vertically, as well as swivel to provide versatility when connecting in the field. Adaptor fittings having one flange sized for and fitted to the inlet and outlet ends of the portable verification system and another flange sized for the meter run or main pipeline connection provide additional versatility. Downtime is limited to the time required to complete a circuit between the meter run, portable verification system, and main pipeline.
US10222251B2
An electro-optic liquid sensor may include a light source, an light detector, a prism, and a reflective optical member. The optical member may be arranged to reflect light emitted by the light source to the light detector when a liquid is disposed between the light source and the optical member. The electro-optic sensor may enable assessment of its operational state in the presence of liquid, thus improving on known electro-optic liquid sensors.
US10222246B2
Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for metering water are disclosed. In one aspect, a method includes the actions of receiving, from a first meter that is connected to a first pipe, first audio data collected during a time period and first temperature data collected during the time period. The actions further include receiving, from a second meter that is connected to a second pipe, second audio data collected during the time period and second temperature data collected during the time period. The actions further include, based on the first audio data, the first temperature data, the second audio data, and the second temperature data, determining a first amount of material that has flowed through the first pipe during the time period relative to a second amount of material that has flowed through the second pipe.
US10222241B2
A capacitance measurement circuit for determining a capacitance of a guard-sense capacitive sensor includes a microcontroller that uses a combination of several synchronized PWM outputs for generating a low distortion sine wave. The sine wave is used as a guard voltage for the guard electrode of the capacitive sensor. The capacitance value of an unknown capacitor is measured by impinging the guard voltage on the sense electrode of the capacitive sensor by a modified sigma-delta modulator unit. The digital output of the sigma-delta modulator unit is first multiplied by an XOR gate before being routed into a decimator/low pass filter. The second input of the XOR gate is driven by a square wave from a square wave generator with the same frequency as the guard voltage, but with a substantially 90° phase shift. The output of the decimator/low pass filter is indicative of the capacitance value of the unknown capacitor.
US10222232B2
A sensor data collection system includes a plurality of sensors operatively coupled to a corresponding set of endpoints, the endpoints configured to communicate sensor data to a central data collection point via a data communication protocol. A proxy service-enabled endpoint facilitates interoperability with the data collection system for the benefit of endpoints that are otherwise incompatible with the data communication protocol. The endpoint includes a remote endpoint interface module configured to receive communications from at least one of the incompatible endpoints containing incompatible endpoint sensor data. A remote endpoint virtualization module operatively coupled to the remote endpoint interface module and associated with the at least one of the incompatible endpoints. The remote endpoint virtualization module is uniquely addressable according to a corresponding virtual endpoint address, and configured to store the incompatible endpoint sensor data and to communicate that data to the central data collection point via the data communication protocol.
US10222223B2
There is provided a traffic information output system capable of reducing or eliminating the burden on a user when the searched route and the traffic information on the route are outputted. The traffic information output system comprises a moving cost prediction unit 213 which predicts a moving cost of the route according to a reference time point indicated in a change pattern, and a moving cost output control unit 214 which outputs, to the output device, the prediction moving cost and change time point interfaces P27 and P28 for outputting a prediction moving cost which is a moving cost predicted according to a post-change reference time point.
US10222222B2
An automated method that determines a roundtrip range of a vehicle includes: retrieving a set of parameters associated with the vehicle; retrieving map information regarding a geographic area including multiple links associated with available roadways in the geographic area and each link includes a cost value; determining a set of roundtrip range projection links by evaluating the links to identify multiple roundtrip paths extending radially outward from the vehicle by: determining a total cost of an outbound path and a return path, where the paths meet at a common node; and including the common node in a range projection polygon if a summed cost for a set of links included in the outbound path and the return path is less than a target cost; and generating and displaying a map of at least a portion of the geographic area and a set of range projection polygons overlaid onto the map.
US10222221B2
One embodiment provides a system that facilitates optimization of passenger pick-up. During operation, the system generates, by a first mobile computing device associated with a passenger at a first location, a request for a target location at which to meet with a vehicle. The system receives the target location and a planned passenger route for the passenger to the target location, which are calculated based on a location, facing direction, and direction of movement, if any, of the vehicle, and wherein the target location is different from the first location, thereby facilitating optimization of a time duration and route the passenger takes to meet the vehicle.
US10222219B2
Technologies for sharing route navigation data in a community cloud include a mobile navigation device of a vehicle and a remote mobile navigation device of a remote vehicle. The mobile navigation device generates sensor data associated with a current route of the vehicle and determines whether a reference traffic event occurs within a segment of the current route of the vehicle. In response to a determination that a reference traffic event occurs, the mobile navigation devices transmits route update data to the remote mobile navigation device. Based on the route update data, the remote mobile navigation device updates a current route of the remote vehicle to avoid the reference traffic event within a corresponding segment of the current route of the remote vehicle. The mobile navigation device may also transmit the sensor data to a community compute device, which may transmit route update data to the remote mobile navigation device.
US10222213B2
This disclosure provides a vertical position and velocity determination system for inertial measurement unit (IMU) integrated with a barometric altimeter in the same device (IMU-baro). The system includes a rate of turn input connected to receive a measured IMU-baro rate of turn; an acceleration input connected to receive a measured IMU-baro acceleration; a barometric pressure input connected to receive a measured IMU-baro altitude; a first Kalman filter connected to the rate of turn input and to the acceleration input to estimate a roll and pitch of the IMU-baro based on the measured IMU-baro rate of turn and the measured IMU-baro acceleration; and a second Kalman filter connected to the acceleration input, to the barometric pressure input, and to the first Kalman filter.
US10222210B2
Image matching on a pair of image data about images which are shot at different shooting positions is performed, and a point corresponding to the coordinates of a distance measurement point on the image shown by one image data of the pair is searched through the image shown by the other image data of the pair. The value of a parameter showing the attitude of an airplane (2) is corrected in such a way that the difference between the coordinates of the distance measurement point on the image shown by the other image data of the pair and the coordinates of the corresponding point which is searched for via the image matching becomes small, to estimate the attitude of the airplane (2).
US10222177B2
A system comprising an unmanned aerial vehicle (UAV) configured to transition from a terminal homing mode to a target search mode, responsive to an uplink signal and/or an autonomous determination of scene change.
US10222169B2
A launching system for launching light weight articles into air comprising an elongated hollow tube or cannon filled with at least one light weight article such as confetti, a female quick disconnect member, a ball valve, a male extrusion, a reservoir and a source of compressed gas. The female quick disconnect member having at least one cam lock lever at proximal end facilitates quick connection and disconnection of the elongated hollow tube and the distal end of the female quick disconnect member is connected to one end of the ball valve via a male extrusion, further the ball valve having one handle which acts as a trigger. Further top end of the reservoir is connected to other end of the ball valve and a source of compressed gas such as compressed CO2 gas cartridge which is connected to bottom end of the reservoir, wherein the source supplies compressed gas that is stored in the reservoir until the trigger of the ball valve is turned to open position allowing the compressed gas to escape from the reservoir into the elongated hollow tube, thereby launching the light weight articles into the air. The device provides single shot or multiple shots of confetti from the cannon with a single cartridge in a more safe and controlled manner.
US10222166B1
A breakdown adapter having a retainer. The retainer has a left retainer and a right retainer. The left retainer has a left engaging means and a left retaining means. The right retainer has a right engaging means and a right retaining means. The left engaging means has two or more left protrusions. The right engaging means has two or more right protrusions. The fastener is configured to secure left engaging means to the right engaging means.
US10222164B2
An extension device (1) of a firearm (500) mounts in an operating configuration, to a muzzle (555) of a barrel (550) of the firearm (500). The extension device (1) includes a main body (10) which has an inner element (11) housable inside the barrel (550) and suitable to firmly engage with an inner barrel wall (550′) and an outer element (12) which extends axially adjacent to the inner element (11) and is suitable to be arranged outside the barrel (550) with the inner element (11) housed in the barrel (550). The extension device further includes a secondary body (20) fitted axially on the main body (10) and an attachment body (30) fitted axially on the outer element (12) and fixable thereto performing an axial thrust action on the secondary body (20) until the secondary body presses against the muzzle (555) of the firearm (500).
US10222159B1
In one general aspect, the subject matter described in this specification can be embodied in a firearm safety device including a trigger, a pin, and a safety deactuation device. The trigger has a channel therein with an opening at an end of the channel. The pin is disposed within the channel such that a portion of the pin extends through the opening. The safety deactuation device is configured to engage with the pin and move the pin within the channel of the trigger as the safety deactuation device is moved relative to the trigger.
US10222134B2
Methods and systems are provided for a dual loop coolant system used to control an engine temperature. In one example, cooling capacity is transferred from a low temperature loop to a heat exchanger, and cooling capacity stored in the heat exchanger is transferred to a high temperature loop (e.g., an engine coolant loop). The flow of coolant from the dual loop coolant system to the heat exchanger may be regulated responsive to a temperature of the coolant in each of the low temperature loop and the high temperature loop.
US10222132B2
Apparatus comprises: a panel (100) having first and second main faces (101, 102); and a sealed system internal within the panel and comprising plural passages (103) each extending from a first manifold cavity (107) at a first end of the panel to a second manifold cavity (107) at a second end of the panel and containing a fluid in both gas and liquid states, wherein each of the passages includes one or more protruding features (122, 123, 124) on a side of the passages that is closer to the first main face.
US10222127B2
A guide plate having depressed portions is provided between an array of heat exchanger tubes, herein after “tubes”, arranged horizontally side-by-side and a next lower array of tubes arranged horizontally side-by-side, and is positioned with the lowest parts of the depressed portions near crest portions of respective lower tubes. The guide plate conveys a liquid D on outer surfaces of respective upper tubes onto similarly positioned lower tubes even when the tubes move in a right-and-left direction. A falling film heat exchanger installed in a ship, an offshore structure or the like can avoid reduction in heat exchange performance, even when the ship or the like inclines and swings, by substantially evenly distributing and dropping a liquid onto the crests of the tubes and causing the liquid dropped from the tubes located in an upper array to fall onto the tubes located in the next lower array.
US10222125B2
An apparatus for cooling an electronic component has a planar top member of a thermal energy conductive material and a parallel planar bottom member of the material, the planar bottom member including a surface having regions configured for heat exchange contact with the electronic component. The planar top member has a plurality of stamped indent formations at a plurality of locations, each indent formation providing a contact surface such that the planar top member is affixed to the bottom member by braze or solder at each contact surface. Alternatively, the planar bottom member also has a plurality of stamped indent formations in alignment with indent formations of the top member. The planar top member is affixed to the bottom member by brazing or soldering each respective contact surface of an indent formation of the planar top member to an opposing contact surface of a corresponding indent formation of the parallel planar bottom member.
US10222120B2
The invention relates to a method and device for generating two purified partial air streams under different pressures. A total air stream (1) is compressed to a first total air pressure. The compressed total air stream (5) is cooled with cooling water under the first total air pressure by way of heat exchange (4, 6). The heat exchange with cooling water for cooling the total air stream (5) is carried out as a direct heat exchange in a first direct contact cooler (6), at least in part. The cooled total air stream (9) is divided into a first partial air stream (10) and a second partial air stream (11). The first partial air stream (10) is purified in a first purification device (18) under the first total air pressure, generating the first purified partial air stream (19). The second partial air stream (11) is re-compressed to a higher pressure (12), which is higher than the first total air pressure. The re-compressed second partial air stream (14) is cooled with cooling water in a second direct contact cooler (15) by way of direct heat exchange (13, 15). The cooled second partial air stream (17) is purified under the higher pressure in a second purification device (30), thus generating the second purified partial air stream (31).
US10222107B2
In a throttle device, a guide section including a small-diameter hole which slidably guides a guide stem of a needle member is formed upstream side portion from a communicating hole-in a guide tube.
US10222103B2
A heat pump includes an evaporator with an evaporator inlet and an evaporator outlet; a compressor for compressing operating liquid evaporated in the evaporator; and a condenser for condensing evaporated operating liquid compressed in the compressor, wherein the condenser includes a condenser inlet and a condenser outlet, wherein the evaporator inlet is connected to a return from a region to be heated, and wherein the condenser inlet is connected to a return from a region to be cooled.
US10222098B2
The inside of a casing constituting an indoor unit of an air-conditioning apparatus is laterally divided by an air passage partition so that an air passage chamber housing an indoor fan and an indoor heat exchanger is defined close to a casing side panel. A space in the casing close to the casing side panel is further vertically divided by a partition having through holes so that a pipe connection chamber housing parts of the extension pipes, flare joints, and indoor pipes is defined in an upper portion and a pipe draw-out chamber in which the extension pipes are arranged is defined in a lower portion. Gaps between outer peripheries of the extension pipes and inner peripheries of the through holes are filled with insulations.
US10222097B2
A cooling device comprises a cooling tube containing a working gas, a pressure oscillator connected to a first end of the cooling tube to generate a pressure oscillation and displacement of the working gas, and means for phase shifting the pressure oscillation relative to displacement of the working gas, connected to a second end of the cooling tube. The device further comprises a first sealed pressure transmission element to separate the working gas from a fluid contained in the phase shifting means. The fluid and the working gas are of different natures.
US10222096B2
An isothermal turbo-compressor-condenser-expander (ITCCE) includes heat-transferring fan blades that are mounted on, or surround, individual conduits to promote air exchange and heat transfer. In operation, the open framework rotates in free air to promote heat exchange. An ITCCE bladed assembly includes a driven central hub assembly with a first fluid coupling. A first inner plenum is in fluid communication with the fluid coupling. A plurality of compressor multiport conduits extend radially, and pass fluid from, the first inner plenum to an outer plenum that acts as an equalizing line. A return path is provided to the fluid coupling from the outer plenum. The conduits can be formed as metal extrusions, including internal ribs that separate a plurality of ports formed therebetween along an entire length of the conduits. The conduits can define an airfoil shape and/or are axially twisted, generating axial airflow. The return path can include return multiport conduits.
US10222094B2
The present invention relates to a solar cooking apparatus, comprising: a first solar reflector; a second solar reflector; a solar collection element; and a solar collection element holder, wherein the first solar reflector and the second solar reflector are concave, and symmetrically arranged and aligned with a solar collection element axis, the reflectors having a up to a 360° range of motion around a plane perpendicular to the solar collection element axis, and focusing radiation at the solar collection element, which rapidly heats when the first and/or second solar reflectors are in an opened position, the first and second solar reflectors shield the solar collector when in a closed position. The solar cooking apparatus is adjustable and, in some embodiments, portable.
US10222092B1
Embodiments of the inventive concept provide a high-capacity, sparkless, mobile, double-insulated wood pellet burner unit. The wood pellet burner unit is safely operated on a wood floor or deck. The wood pellet burner unit produces a large radiant flame that enhances the surrounding area, free from dangerous sparks and smoke. The ash and coals from the fire are enclosed within a double-insulated housing. A wind break radiant heat reflector protects the flame from being distorted, enhances the flame so that it remains in a substantially upright column, and reflects some of the heat outwardly toward the users. Casters disposed on the bottom of the wood pellet burner permit easy and convenient movement of the unit. The wood pellet burner unit disclosed herein produces a larger and fuller flame than a pure gas fire pit based on a balanced multi-directional flow of heated combustion air flow through the unit.
US10222090B2
An indoor unit for an air-conditioning apparatus and an air-conditioning apparatus that include levers of a decorative panel operated through insertion hole portions, and then move vertically in the insertion hole portions by the gravity, to thereby be temporarily hung on the hooks. The levers are kept holed on hooks. The indoor unit for an air-conditioning apparatus includes a casing, a decorative panel mounted on a lower surface side of the casing and having an air inlet formed therein, the levers mounted so as to be opposed to each other on opposed two sides among four sides forming edges of the air inlet of the decorative panel, and the hooks mounted at an opening portion of the casing, to allow the levers to be hooked thereon, respectively.
US10222088B2
Provided is an exhaust vent for venting air including a base member configured to be secured to a structure. The base member may define an opening in fluid communication with an exhaust conduit of the structure and a raised flange disposed around the opening. The exhaust vent may also include a removable vent adapter, wherein the adapter is configured to connect to the raised flange and maintain fluid communication between the opening and the exhaust conduit. A substantially hollow housing may be attached to the base member and configured to cover the opening of the base member and maintain fluid communication between the opening and an exterior of the housing. A pivoting damper may also be disposed within the substantially hollow housing configured to rest atop the opening of the base member when in a closed position.
US10222077B2
A dust removing apparatus is provided. An air blower performs air blowing in a space. A processor determines a first period in which a user is absent in the space. An air sucker collects dust by performing air suction from the space during the first period. A sensor measures an amount of dust collected by performing the air suction in the space during the first period. The processor determines whether or not a usage status of the dust removing apparatus in the space is appropriate based on a comparison between the measured amount of dust collected in the first period and an estimated amount of dust, which is estimated to be collected under a usage condition in which the user is absent in the space, and outputs information indicating whether or not a usage status of the dust removing apparatus is appropriate based on a result of the comparison.
US10222072B2
Fan for ovens for cooking foods, which comprises: a support plate arranged substantially orthogonal to the rotation axis of the fan; and multiple blades projectingly fixed on the support plate and radially arranged around the rotation axis. Each blade of the fan is provided with an internal edge, which is shaped with a convex portion that is projectingly extended between a first and a second concavity of the internal edge itself.
US10222069B2
A heating appliance includes a cooktop having a plurality of burners. A burner box defines a burner position for each burner, each burner position having a plurality of slots. An orifice holder is slidably engaged with the plurality of slots in a linear direction. Opposing flanges extend from a bottom portion of the orifice holder that extend through the plurality of slots to be at least partially secured therein, wherein the opposing flanges are adapted to engage the plurality of slots in only one directional orientation.
US10222064B2
A combustor wall is provided for a turbine engine. The combustor wall includes a combustor shell and a combustor heat shield that is attached to the shell. The heat shield includes a first panel and a second panel that sealingly engages the first panel in an overlap joint. A cooling cavity extends between the shell and the heat shield and fluidly couples a plurality of apertures in the shell with a plurality of apertures in the heat shield.
US10222059B2
An apparatus for burning of a gaseous fuel includes a gas manifold comprising a blast tube with an axis of rotation and an outer wall; a center bluff body disposed inside the blast tube; a plurality of aerodynamic blocks circumferentially distributed in the annular space between the blast tube and the center bluff body, creating passage channels for combustion air between the aerodynamic blocks; two injector nozzles located inside the wake zone of each of the aerodynamic block and are fluidically communicating to the gas manifold; an air control mechanism comprising a center hub and a plurality of air control modules. The control modules fit through the passage channels. Each air control module comprises an air deflector located at the outer edge of a passage channel.
US10222058B2
A cooking device is provided. The cooking device includes a frame that forms a cooking chamber; a burner provided inside the frame and having a plurality of gas outlet holes; an ignition unit provided inside the frame to ignite a mixed gas discharged from at least one of the plurality of gas outlet holes; and a fixing device to affix a position of the ignition unit with respect to the burner.
US10222057B2
A heater assembly can be used with a gas appliance. The gas appliance can be a dual fuel appliance for use with one of a first fuel type or a second fuel type different than the first. The heater assembly can include a housing, and an actuation member. The housing has a first fuel hook-up for connecting the first fuel type to the heater assembly, a second fuel hook-up for connecting the second fuel type to the heater assembly, and an internal valve. The actuation member can control the position of the internal valve based on whether the first or the second fuel hook-up is used.
US10222050B2
According to one embodiment, a lighting device includes a hollow main body having thermal conductivity, a light source having at least a semiconductor light-emitting element, an accessory element, and an adiabatic member. The light source is thermally coupled to the main body. The accessory element has an allowable temperature limit different from that of the light source, and is accommodated in the main body. The adiabatic member divides the main body into a first region thermally coupled to the light source, and at least a second region thermally coupled to the accessory element and thermally isolated from the first region.
US10222046B2
An LED light source including a housing having a curved upper wall to resist the intrusion of water into the interior of the light housing and the electronics therein, internal structure defining an air flow path ensuring air flow over the heat sinks coupled to the LED light sources and power supplies, and LED light sources producing broad visible spectrum light having a generally white coloration.
US10222035B1
A system for replacing linear fluorescent lamps with LED modules in a cabinet sign includes an LED module support structure. The LED module support structure may be attached to the raceways of the cabinet sign or to the sockets formerly used for mounting fluorescent lamps between the raceways.
US10222033B2
A lamp includes a substrate, a heat-dissipation member, an optical member, and a heat-transfer member. The optical member, the substrate and the heat-dissipation member are arranged in this order. In two members of the heat-dissipation member and the optical member or two members of the heat-dissipation member and the substrate, one end sides thereof are fixed to each other by a fixing mechanism, and the other end sides thereof are hooked and fixed such that the two members are prevented from being displaced in a direction away from each other with the heat-transfer member located between the one end side and the other end side being a support point and the one end side being a force point.
US10222028B2
In the case of a lighting fixture (100) with lighting means having LEDs (5) arranged one behind the other in the longitudinal direction (I) of the lighting fixture (100) and a reflector (10) which is concave in a plane perpendicular to the longitudinal direction (I) of the lighting fixture (100), the lighting means are arranged in the upper region (11) of the reflector (10) such that they emit light onto the reflector (10) in essentially the opposite direction from a light emission direction (A) of the light fitting (100), wherein a diffuser (20) is arranged below the lighting means and extends as far as the reflector (10).
US10222023B2
A module comprising an electronic component and an electrical connector that are interconnected by a printed circuit board that is fastened to a heat sink, the connector includes a housing, connection contacts and a bundle of wires, which are secured to the housing and respectively interconnected electrically. The housing is arranged on one side of the board such that the contacts pass through the board so as to emerge onto the other side and to be connected electrically there. The board is fastened to the heat sink by the side thereof bearing the contacts. The surface of the heat sink receives the board having a boss at least level with the contacts, so as to avoid electrical contact between the contacts and the heat sink.
US10222021B2
A vehicular lamp includes a lamp housing; a base substrate disposed in the lamp housing; and a plurality of planar light sources. The plurality of planar light sources are disposed spaced apart from each other on the base substrate. Each of the plurality of planar light sources has a light emitting surface that protrudes from the base substrate and that forms a respective acute angle with the base substrate relative to a forward direction of the vehicular lamp.
US10222015B2
An LED night light having different power sources including a battery, outlet plug-in power source, or interchangeable power source incorporates geometric shape optics means having more than one reflective means situated at different positions, distances, and/or orientations so that light beams will be reflected multiple times by more than one reflector means before passing through the reflectors' optics means and being projected to an external surface(s) such as a ceiling, wall, or floor.
US10222009B2
An illumination apparatus includes a semiconductor laser device to generate a plurality of laser beams, a light wavelength conversion element configured to convert at least a portion of the light of the laser beams into light having a different wavelength, and an optical unit configured to direct the laser beams onto a surface of the light wavelength conversion element. The optical unit includes a mirror element able to be panned about an axis and is configured to guide the laser beams over at least one surface section of the surface of the at least one light wavelength conversion element. The optical unit includes a structure configured to adjust a divergence or expansion of the laser beams along at least one of a slow axis or a fast axis of the laser beams on the surface section of the surface of the at least one light wavelength conversion element.
US10222008B2
A variety of illumination devices for general illumination utilizing solid state light sources (e.g., light-emitting diodes) are disclosed. In general, an illumination device can include multiple light sources that are disposed on a substrate, where at least some of the light sources include a light-emitting diode (LED) and a corresponding inelastic scattering element surrounding, at least in part, the LED. The inelastic scattering elements can have different light emission spectra. The illumination device can further include a light-mixing element adapted to receive light that is output by the light sources, where, during operation of the illumination device, each inelastic scattering element inelastically scatters light emitted from its corresponding LED, and the light-mixing element mixes the light received from the inelastic scattering elements to provide the output light.
US10222006B2
A tubular light emitting diode lamp includes a lamp body, a plurality of light emitting diodes disposed on the lamp body, and a first lamp base and a second lamp base that are disposed at opposite ends of the lamp body. At least one of the first lamp base and the second lamp base includes at least one primary pin and at least one secondary pin. The tubular light emitting diode lamp also includes a driver electrically connected to the plurality of light emitting diodes, the at least one primary pin, and the at least one secondary pin. The least one primary pin provides power to the driver to cause the plurality of light emitting diodes to emit light and the at least one secondary pin provides a signal to the driver that is distinct from the power.
US10222003B2
A light bulb apparatus has a plurality of LED modules, a substrate, a driver circuit board, a plastic piece, a radiator and a lamp cap. The substrate has aluminum material for mounting the plurality of LED modules, a first connection end and a second connection end. The first connection end and the second connection end is electrically connected to the plurality of LED modules. The plastic piece with a guiding groove is used for inserting the driver circuit board. The radiator has a top plate and a side wall. The substrate is fixed on the top plate, and the side wall are connected to the plastic piece.
US10222000B2
Embodiments of vessels include personnel access provisions having welded or otherwise permanent connections that substantially reduce the potential for leakage into or out of the vessels by way of the personnel access provisions.
US10221999B2
A pressure vessel fluid manifold assembly includes a pressure vessel having a plurality of lobes joined to each other, each of the plurality of lobes having a wall disposed in contact with an adjacent wall of an adjacent lobe, and wherein the manifold can be external or internal to the lobes.
US10221995B1
A quick-release structure for a grease gun includes: a cylinder including a peripheral wall and a fixing groove formed in an insertion section of the peripheral wall; the grease gun including an outer surface, an insertion hole, a slot formed in the outer surface and in communication with the insertion hole, the cylinder is inserted in the insertion hole and the fixing groove is aligned to the slot; a locking member inserted through the slot and into the fixing groove; a base fixed to the outer surface; an elastic member disposed between the base and the locking member; a press member including a press section and a drive section, the drive section is drivingly connected to the driven portion and to be pressed by a user; and a restricting member mounted on the base, and the press section of the press member leans against the restricting member.
US10221993B2
A bi-directional spring member is mounted to a support platform, the bi-directional spring member being coupled to a payload. The bi-directional spring member includes a non-linear spring component having a rigid member enclosing at least a portion of a compliant planar member and a linear spring component. The compliant planar member flexes in a direction opposite a direction of low amplitude vibrational forces acting on the compliant planar member to reduce vibrational forces acting on the support platform and the linear spring member flexes to reduce high amplitude vibrational forces acting on the support platform.
US10221985B2
A pipe cap assembly for a normally-sealed system includes a pipe cap having a base portion including two opposing, substantially parallel flat surfaces. The pipe cap includes a connector portion extending from the base portion. A fluid passage extends through both the base portion and connector portion. A transition cap may be releasably coupled to the connector portion for sealing the fluid passage during normal operation. A transition fitting provides periodic access to the sealed system and includes an access port at one end, and a tubular port and fastener at the other end. The tubular port and fastener releasably couple to the connector portion of the pipe cap to provide access. A drain hose, vent hose, or the like, may be easily coupled to the access port of the transition fitting. A test instrument may be coupled either to the access port or directly to the connector portion.
US10221984B2
High-pressure cryogenic fluid conduits that deliver high-pressure cryogenic fluids from a first point to a second point. This high-pressure fluid conduit has a safety feature that is activated when the high-pressure cryogenic fluid conduit fails due to exposure to a predetermined force. The safety feature is activated by the fracture of an annular ring that is positioned at either end of the high-pressure fluid conduit and is calibrated to fracture when exposed to the predetermined force. Fracture of the annular ring closes valves at each end of the high-pressure fluid conduit, thereby stopping the flow of high-pressure fluid from the high-pressure fluid source as well as the escape of high-pressure fluid from the high-pressure fluid container.
US10221981B1
A universal high-speed rotary union including an input manifold having passageways, an input distributor fixedly coupled to the input manifold and having passageways fluidly connected with the passageways of the input manifold, a valve plate fixedly coupled to the input distributor and having passageways aligned with the passageways of the input distributor, an output manifold rotatably coupled to the input manifold by a first bearing and having passageways and an internal housing; an output receiver slidably coupled to and disposed within the internal housing of the output manifold, and having passageways aligned with the passageways of the output manifold, a bore defined along a common axis of the input manifold, the input distributor, the valve plate, the output manifold, and the output receiver, and a shaft rotatably coupled within the bore by at least a second bearing. The valve plate and the output receiver have a metal to metal interface.
US10221975B2
The disclosed subject matter includes embodiments of fluid couplings that prevent or discourage misconnection of fluid lines. In embodiments, a coupling device may have multiple male connectors, female connectors, open ports, butt connectors, and plugs that close off various ports and connectors. The coupling device is mated to a matching coupling device only when all the multiple male and female connectors are properly joined and/or sealed by plugs. If any of the connectors is not properly mated to a corresponding one or not sealed by a plug on the opposite connector, the coupling will leak, since the connectors are joined to a furcating channel.
US10221971B2
A flexible pipe body and method of producing a flexible pipe body are disclosed. The method includes providing one or more composite filament (302) as a filament bundle (310); applying a braid element (304) around the filament bundle as a braided bundle (310); helically wrapping the braided bundle (310) around a flexible pipe layer (502); and then curing (510) the one or more composite filament (302).
US10221968B2
A pipe or like support is molded as a unitary item having a region of concertinaing, serpentine, or otherwise longitudinally variable nature between end regions, for example having a longitudinally extensile linking region extending between at least a pair of the end regions the linking region can be of a concertina or serpentine type configuration. The end regions can both have passageways extending there through in a direction perpendicular to the axis of the pipe or like member to be supported.
US10221963B2
A ball valve may include a control element including a perforated screen disposed within the control element and spaced apart from an inner surface of the control element to form an annular space and a plurality of chambers disposed within the control element. When fluid flows through the control element, sound waves pass through the perforated screen and are reflected back by the plurality of chambers to disrupt other sound waves, thereby reducing fluid noise in the rotary valve.
US10221950B1
This disclosure is directed to couplers which significantly reduce the production of noise when disconnected from a mating coupler, thus addressing a significant occupational safety problem in the field of compressed air couplings. Accordingly, one aspect of the disclosure provides a coupler which may be used to connect/disconnect an air hose subjected to high air pressure while suppressing or dampening the noise typically produced upon disconnecting the coupler. In some examples, a coupler is provided with a valve having axial passageways that facilitate the relatively free flow of air during normal operation that become partially occluded upon an action disconnecting the coupler to significantly reduce sound levels.
US10221945B2
The present invention addresses the problem of obtaining an electronic control device for a vehicular automatic transmission that suppresses sudden acceleration, sudden deceleration, and gear shift shock that occur when the transmission moves into a fail-safe mode due to the electronic control device stopping during a main CPU abnormality. An electronic control device 100 for a vehicular automatic transmission has: a main CPU 3 that performs gear shift control for the vehicular automatic transmission; and a sub-CPU 4 that detects abnormalities in the main CPU 3. When the sub-CPU 4 detects an abnormality in the main CPU 3 while the vehicle is traveling, the sub-CPU 4 stops the gear shift control executed by the main CPU 3.
US10221943B2
When a power-on downshift via an intermediate shift stage accompanied by input switching control is required and a predetermined shift stage is a shift stage lower than the intermediate shift stage, an electronic control unit performs torque phase control in a torque phase control time shorter than the torque phase control time that is set when the predetermined shift stage is a shift stage higher than the intermediate shift stage. Accordingly, it is possible to complete disengagement of a disengagement-side element early and to suppress a rapid increase of an input shaft rotation speed due to a clutch torque remaining.
US10221941B2
A control device of a continuously variable transmission has at least an automatic shift mode and a temporary manual mode. The control device includes an insufficient drive force determination unit, a first insufficient acceleration determination unit, and a downshift control unit. The insufficient drive force determination unit determines whether drive force insufficiency occurs if acceleration is performed in the current transmission gear. The first insufficient acceleration determination unit determines whether there is an acceleration request made by the driver of the vehicle. The downshift control unit downshifts from the current transmission gear to a transmission gear at a lower speed side in a case where, in the temporary manual mode, the insufficient drive force determination unit determines that a drive force insufficiency occurs and the first acceleration request determination unit determines that there is an acceleration request.
US10221940B2
A controller is provided to, in response to a speed of the vehicle exceeding an allowable speed based on a measured grade while the vehicle is running and in neutral or park, actuating a vehicle holding mechanism to stop the vehicle.
US10221939B2
An apparatus and system for supporting a planetary carrier within an aircraft gearbox includes a retainer for engaging a rotor mast and for supporting the planetary carrier.
US10221938B2
Some embodiments are directed to an apparatus for managing fluid flow in a vehicle, that includes an epicyclic gear set having first, and second inputs configured to receive rotational drive input from a torque output feature of a powertrain and a rotary actuator respectively. A pump driver is provided for driving a fluid pump, the pump driver being configured to receive rotational drive input from an output of the epicyclic gear set. A controller is configured to determine information corresponding to the rotational speed of the torque output feature using information generated by a rotational speed sensor and based on this control the rotary actuator, such that the pump driver is caused to rotate at substantially a pre-specified speed.
US10221925B2
A conical pulley for belt Continuously-Variable-Transmissions allowing a bigger than the width W of the belt maximum axial displacement of the one conical pulley half relative to the other, achieving a bigger than 0.5*W*tan(F) difference between the maximum and the minimum effective radiuses of the belt as it runs on the pulley, wherein F is the angle of the working conical surfaces of the pulley, providing a substantial increase of the transmission gear ratio range that enables faster accelerations at the low gear ratios and better mileage and quieter operation at the high gear ratios.
US10221923B2
A multi-stage transmission that includes a case including an annular support that extends radially inward from an inner peripheral surface of the case; a first planetary gear mechanism that includes a plurality of rotating elements and to which power is transmitted from the input member; a second planetary gear mechanism that is disposed on an opposite side of the support of the case from the first planetary gear mechanism; a clutch that interconnects any one of the rotating elements of the first planetary gear mechanism with an element to be connected which is included in the second planetary gear mechanism and releases this interconnection; and a brake that connects the element to be connected to the case to hold this element stationary and releases this connection.
US10221922B2
An automatic transmission has a first clutch shaft that constantly connects first and fourth planetary gear sets, a second clutch shaft that constantly connects second and third planetary gear sets, and a third clutch shaft that constantly connects the third and first planetary gear sets. A drive shaft is constantly connected to the fourth planetary gear set; an output shaft is constantly connected to the third planetary gear set. The first planetary gear set is directly connected to two shift elements, the second planetary gear set is directly connected to four shift elements, the third planetary gear set is directly connected to two shift elements, the fourth planetary gear set is directly connected to four shift elements. The drive shaft is directly connected to only one shift element. The output shaft is directly connected to only one shift element. A seventh shift element is directly connected to the drive shaft and the second and fourth planetary gear sets.
US10221917B2
A method for storage of excess energy which would otherwise be lost, the regulation of angular velocity, and prevention of excessive velocities is disclosed. The device consists of a bowl shaped container, divided into sections by radially oriented vertical walls, which holds a fluid (any appropriate liquid or set of small solid particles), and spins on its vertically oriented axis at various angular velocities. The floor of the device is formed in successive shapes of bowls and shelves, which allows for a kind of “gearing”. The invention allows more and more energy to be input into the device while the angular velocity is regulated within a particular range. A typical embodiment of the invention would include its attachment by a shaft at the axis to a vertical axis wind turbine.
US10221912B2
A hydraulic damping device includes a first cylinder that houses oil, a piston rod that moves in an axial direction of the first cylinder, and a piston section that generates a damping force by a movement of the piston rod. The piston section includes a piston body formed with an oil channel through which oil flows, a base valve that opens and closes the oil channel of the piston body, a ring-shaped ring valve that is provided on the base valve, and a preload spring that has a positioning section that extends radially and determines a position of the ring valve in the radial direction.
US10221895B2
A method of manufacturing an outer joint member of a constant velocity universal joint includes forming cup and shaft members using medium carbon steel, preparing, as the cup member, a cup member having cylindrical and bottom portions integrally formed, and a joining end surface formed on an outer surface of the bottom portion, preparing, as the shaft member, a shaft member having a joining end surface to be joined to the bottom portion of the cup member, and bringing the joining end surfaces of the cup and shaft members into abutment against each other. The method also includes welding the cup and shaft members from an outer side of the cup member to an abutment portion between the cup and shaft members in a radial direction of the cup member under a state in which a hollow cavity portion is formed inside the abutment portion.
US10221887B2
A bearing preload adjuster for a bicycle crank set and bottom bracket comprises an adjustment ring for coupling with a bicycle crank arm, a movable plunger comprising an external thread for rotatably coupling with the adjustment ring. The adjustment ring is rotated in order to cause the plunger to extend along an axis of the bottom bracket and apply pressure to a bottom bracket bearing inner race. The adjustment ring is rotated until the clearance in the bearing assemblies and the play in the bottom bracket assembly has been eliminated. This allows the crank assembly to rotate freely, while preventing the crank assembly from sliding side to side inside the bearing bores and along the axis of the crank spindle.
US10221883B2
An apparatus for supporting articles. The apparatus may include a stretch-release adhesive tape, a support member having a hook member extending therefrom, and an access member coupled to the support member. The support member may be secured to the wall via the stretch-release adhesive tape. Furthermore, the access member may be pivotably coupled to the support member so that in a closed state the access member covers the stretch-release adhesive tape from view and in an open state the stretch-release adhesive tape is visible and can be gripped by a user to remove the stretch-release adhesive tape and the support member from the wall.
US10221873B2
A fastener assembly may include a pin including a central shaft connected to a distal tip, and a grommet including at least one leg. The pin and the grommet are configured to be positioned in an expanded state in which the fastener assembly securely fastens to the component, and a retracted state in which the leg(s) is drawn toward the central shaft to reduce an axial envelope of the leg(s).
US10221859B2
An airfoil for a compressor blade of a gas turbine engine has a chord between a leading edge and a trailing edge and a span between a root and a tip. The airfoil can further include a reduction in local chord from about 75% span to the tip for about a 5% reduction in local solidity. The airfoil can have decreasing sweep angles for the leading edge and the trailing edge from 50% span to the tip and can have decreasing leading and trailing edge dihedral angles from 50% span to the tip.
US10221853B2
A fluid circulation monitoring system includes a distributed processing system having a first processor located on-premises near a space filled with a circulating fluid and a second processor located off-premises. The first processor and the second processor are in communication with one another. A sensor is operatively connected to the first processor and senses at least one parameter associated with a flow rate of fluid through the circulation system. The distributed processing system is configured to process the at least one parameter and derive a volumetric fluid flow rate through a fluid pump which propels the fluid through the circulation system. Pattern recognition is applied to the at least one parameter to detect maintenance events and predict the need for maintenance events.
US10221852B2
A multi-stage vacuum pump, expander, or compressor, that incorporates one or more stages of a fixed scroll(s) and orbiting scroll(s) that operates simultaneously. The motor drives the orbiting scroll(s) within the structure, and the various fixed and orbiting scrolls are arranged for either parallel generation of a vacuum or high pressure gas, or arranged in series for generating of a significantly high vacuum or gaseous pressure, or a combination of parallel arranged and series arranged fixed and orbiting scrolls may be embodied within the structure, operated by a single motor means, in order to attain the high efficiencies of operation as a vacuum pump, or a gaseous compressor, during its functioning. The various combinations of orbiting and fixed scrolls, when arranged as aforesaid, can be reduced in size, or miniaturized, and used in conjunction with small appliances, or even in hand-held instruments, as for example, for use in conducting mass spectrometry, or for other purposes. The actual structure of the multi-stage devices can include the fixed and orbiting scrolls adjacent the motor, or the singular motor may be located intermediate various stages of the formed vacuum pump/compressor, in its assembly.
US10221846B2
A linear compressor is provided which is capable of reducing noise and fabrication costs. The linear compressor may include a piston that performs a reciprocating motion within a cylinder, a linear motor that supplies a driving force to the piston, a sensor that detects a motor voltage and motor current associated with the motor, a valve plate provided at one end of the cylinder to adjust a discharge of a refrigerant compressed in the cylinder, a pressure changing unit or device that changes a variation rate of pressure applied to the piston before the piston reaches the valve plate during the reciprocating motion, and a controller that determines whether the variation rate of the pressure applied to the piston has changed using the detected motor voltage and motor current, and controls the motor to prevent the piston from colliding with the valve plate on the basis of the determination result.
US10221834B2
To safely operate a wind turbine, a control system may determine a current state of the wind turbine and identify whether the state is within an operational envelope. Based on measured sensor data, the control system may calculate the current state of the turbine in a multi-dimensional space where each axis of the multi-dimensional space correlates to one of the measured parameters. The boundary of the operational envelope may define a region of the multi-dimensional space where the wind turbine is behaving in a safe manner. A safety system may determine if the state determined by the control system is accurate. If so, the safety system determines whether the current state is within the operational envelope. If the state is outside the envelope, the wind turbine may switch to a safe state during which the turbine may be decoupled from the utility grid or the rotor is stopped.
US10221830B2
Systems and methods related to linear turbine systems are presented. Each embodiment described herein may be designed as a single-stage, linear, impulse turbine system. In an embodiment, a linear turbine includes a first shaft extending along a first axis; a second shaft extending along a second axis, the second axis being separated from and substantially parallel to the first axis; a first plurality of buckets to travel a first continuous path around the first shaft and the second shaft along a first plane, the first path including a first substantially linear path segment between the first axis and the second axis; and a nozzle configured to direct a first fluid jet to contact the first plurality of buckets in the first linear path segment.
US10221827B2
An ionization detector that reduces the filtering effects of the ignition coil inductances by shorting an inductance of a primary winding of the ignition coil. The ionization detector includes a bias voltage source and an inductance control switch. The bias voltage source supplies electric voltage across an electric gap of a spark plug for detecting ionization within the combustion chamber. The inductance control switch is electrically parallel with a primary winding of an ignition coil and is operable to short an inductance of the primary winding.
US10221826B2
A method for operating an ignition system for an internal combustion engine, including a first voltage generator and a bypass, is described. The bypass may include, for example, a boost converter for maintaining a spark generated with the aid of the first voltage generator. A speed of an internal combustion engine used with the ignition system is ascertained and the operating mode of the bypass is modified in response to the speed change.
US10221815B1
An exhaust gas recirculation (EGR) valve for a vehicle includes: a valve housing connected to an exhaust line, and provided with an inflow passage in which exhaust gas flows, a first outflow passage connected to an EGR line in communication with the inflow passage, a second outflow passage connected to a bypass line bypassing the EGR line, and a third outflow passage connected to an exhaust line connected to a turbocharger turbine; and a valve body selectively opening and closing the first and second outflow passages to adjust an opening ratio of each of first and second outflow passages, and allowing the third outflow passage to remain in an open state.
US10221803B2
The pressure of the fuel is increased at a constant pressure intensification ratio after operating the pressure reducing device so that the pressure difference between the fuel passage and the control chamber after the operation has a value smaller than the predetermined pressure difference, if the required pressure of the fuel is higher than a reference pressure and lower than a pressure obtained by multiplying the reference pressure by a constant pressure intensification ratio.
US10221796B2
An engine device including an intake manifold (67) configured to supply air into a cylinder (36), a gas injector (98) configured to mix fuel gas with air supplied from the intake manifold (67), and supply mixed gas to the cylinder (36), and an igniter (79) configured to ignite, in the cylinder (36) premixed fuel obtained by pre-mixing the fuel gas with the air, the engine device further including a controlling unit (73) configured to determine an air amount in the premixed fuel in the cylinder (36). The controlling unit (73) performs in multiple steps retard control of ignition timing by the igniter (79), when the air amount is insufficient, and performs in multiple steps advance control of the ignition timing, when the air amount is sufficient.
US10221787B2
Methods and systems are provided for monitoring torque delivery in a variable displacement engine using air flow metered via a throttle body model. During conditions when air flow estimation can be inaccurate, such as at wide open throttle, an induction ratio applied to the engine is constrained to 1.0, even if the operator torque demand is low. VDE degradation is inferred based on the commanded induction ratio relative to an actual induction ratio estimated based on the torque delivery.
US10221786B2
A variety of methods and arrangements for reducing noise, vibration and harshness (NVH) in a skip fire engine control system are described. In one aspect, a firing sequence is used to operate the engine in a skip fire manner. A smoothing torque is determined that is applied to a powertrain by an energy storage/release device. The smoothing torque is arranged to at least partially cancel out variation in torque generated by the skip fire firing sequence. Various methods, powertrain controllers, arrangements and computer software related to the above operations are also described.
US10221784B2
Methods and systems are provided for improving the efficiency of canister purge completion. Based on engine operating conditions, a canister is purged to a compressor inlet or a throttle outlet. During purging conditions, as canister loads change, a purge flow through the canister is varied so that a fixed preselected portion of total engine fueling is delivered as fuel vapors.
US10221781B1
A hybrid electric vehicle includes a combustion engine, electric machine, turbocharger, and turbo lag reduction assembly that includes an auxiliary compressor and pressure tank, which are coupled to a clutch driven by a driveshaft powered by vehicle wheel rotation. A controller engages the clutch in response to a braking signal, until the auxiliary compressor recharges the pressure tank. The controller also disengages the clutch in response to one of termination of the braking signal and the pressure tank being recharged with compressed air. Additionally, the controller responds to an engine torque demand signal and discharges compressed air from the pressure tank to an intake manifold of the engine. Further, the controller may discharge a volume of compressed air from the pressure tank to the intake manifold of the engine, until a turbo charge limit signal is received that indicates the turbocharger reached an operating speed.
US10221767B2
A turbine component includes a main body with an upstream end and a downstream end. A cooling passage network is interior to the main body and has multiple cooling passages. A shared passage wall in the cooling passage network includes a cross passage opening connecting each passage partially defined by the shared passage wall. The cross passage further including a pressure balancing feature operable to reduce a local pressure differential in a fluid pressure in each adjacent passage at the cross passage.
US10221766B2
The present disclosure is directed to a sump housing for a gas turbine engine. The sump housing includes a base portion and a first wall extending outwardly from the base portion. The first wall and the base portion at least partially define an inner chamber. A second wall is positioned outwardly from the first wall and extends outwardly from the base portion. The base portion, the first wall, and the second wall at least partially define an outer chamber positioned outwardly from the inner chamber. A projection extending inwardly from the first wall engages a bearing assembly. The base portion, the first wall, the second wall, and the projection are integrally coupled together.
US10221763B2
A combustor is configured to operate in a rotating detonation mode and a deflagration mode. The combustor includes a housing and at least one initiator. The housing defines at least one combustion chamber and is configured for a deflagration process to occur within the at least one combustion chamber during operation in the deflagration mode and a rotating detonation process to occur within the at least one combustion chamber during operation in the rotating detonation mode. The at least one initiator is configured to initiate the rotating detonation process within the at least one combustion chamber during operation in the rotating detonation mode and to initiate the deflagration process within the at least one combustion chamber during operation in the deflagration mode.
US10221762B2
A system includes a turbine combustor, which includes a head end portion having a head end chamber. The head end portion includes an exhaust gas path, a fuel path, and an oxidant path. The turbine combustor also includes a combustion portion having a combustion chamber disposed downstream from the head end chamber, a cap disposed between the head end chamber and the combustion chamber, and an end plate having at least one port coupled to the exhaust gas path or the oxidant path. The head end chamber is disposed axially between the cap and the end plate.
US10221757B2
Disclosed is an intake joint structure capable of blocking backflow of lubricating oil 18 at a connection position between an air inlet 12 of a turbocharger and a suction pipe 24. A backflow-preventive plate 25 is integrally molded to have a cylindrical portion 25a fitted over the air inlet 12 and a tapered portion 25b curved inward from an upstream end of the cylindrical portion 25a and converged downstream to provide an open end. A downstream end 24a of a suction pipe 24 is molded by soft material over a predetermined range using exchange blow molding. The cylindrical portion 25a of the backflow-preventive plate 25 is fitted over the air inlet 12 through a grommet 26 (first soft layer) and the downstream end 24a of the suction pipe 24 is fitted over the cylindrical portion 25a and is banded by a hose band 27.
US10221756B2
Various systems are provided for an exhaust aftertreatment system that includes a support platform, a plurality of isolated legs coupled to the support platform, a plurality of catalysts arranged in parallel with one another and supported above the support platform by the plurality of isolated legs, and an aftertreatment outlet manifold coupled above the plurality of catalysts.
US10221752B2
The present disclosure provides a split cooling apparatus for an internal combustion engine, the apparatus including: a base inserted into a water jacket of a cylinder block, the base surrounding an outside of a cylinder along a shape of the cylinder; an insertion groove formed on the base by being depressed into an inner surface of the base; and a sealing member inserted into the insertion groove, wherein when a temperature of cooling water supplied into the water jacket reaches a preset temperature or higher, the sealing member expands so as to close a flow passage between the base and the cylinder, thereby increasing flow resistance of the cooling water and thus reducing a heat transfer rate of the cylinder.
US10221751B2
The present disclosure provides an engine cooling system having a coolant temperature sensor to sense the temperature of coolant discharged from an engine; a radiator radiating heat while part of the coolant discharged from the engine is passed through the radiator; a coolant control valve unit to control coolant passing through the radiator and coolant supplied from the engine; and a control unit configured to control the temperature of coolant by controlling the coolant control valve unit according to the coolant temperature sensed by the coolant temperature sensor, wherein the control unit calculates a coolant temperature at an entrance of the engine using the sensed coolant temperature and a heat rejection rate of the engine based on the operation condition, calculates a temperature of coolant discharged from the radiator, and controls the opening degree of the coolant control valve unit using the coolant temperatures.
US10221735B2
A method of real-time oil consumption is disclosed. A method of real-time oil consumption detection may include capturing a raw oil quantity, calculating a corrected oil quantity, calculating a predicted oil quantity, calculating a prediction error, and calculating an estimated oil consumption rate. Raw oil quantity may be captured from an oil quantity sensor in an engine. Corrected oil quantity may be calculated by taking raw oil quantity and applying environmental and engine operational conditions. Prediction error may be calculated by finding the difference between corrected oil quantity and predicted oil quantity. Oil consumption rate may be calculated by applying a regression algorithm to prediction error.
US10221730B2
An arrangement of electrical machines including: a variable reluctance rotor. The arrangement also including an annular array of stators; each stator configured to function, in conjunction with the rotor, as an electrical machine.
US10221728B2
A variable valve mechanism includes an input arm that axially supports a roller pressed by a cam, via a roller pin, an output arm that drives a valve when swinging, a switch device that switches the variable valve mechanism between a coupled state where the both arms are coupled and an uncoupled state where the arms are uncoupled from each other, and a lost motion spring that biases the roller against the cam when in the uncoupled state. The lost motion spring includes an extended portion extending in an inter-arm clearance between the input arm and the output arm. An end of the roller pin projects from the input arm into the inter-arm clearance by such a length that the end is accommodated in the inter-arm clearance and that allows a spring retaining portion to be formed in the end. The spring retaining portion is formed in the end.
US10221723B2
The present invention relates to an assembly comprising a duct, preferably a turbine duct, and at least one segment formed of at least two rigid shells, each shell comprising at least one fixing orifice for fixing to the duct and at least one fixing element at least one boss per shell which boss is fixed to the duct and against which boss the shell rests, such that at least one orifice and one boss face one another, and that the fixing element passes through the orifice facing the boss and is fixed to the boss.
US10221714B2
An assembly is provided for rotational equipment with an axial centerline. This assembly includes a primary seal device, a ring structure and a secondary seal device. The primary seal device is configured as a hydrostatic non-contact seal device. The primary seal device includes a plurality of seal shoes and a seal base. The seal shoes are arranged circumferentially about the axial centerline in an annular array. The seal base circumscribes the annular array of the seal shoes. The ring structure is axially engaged with the seal base. The secondary seal device is mounted with the ring structure. The secondary seal device includes a seal ring body and an alignment tab. The seal ring body is configured to substantially seal an annular gap between the ring structure and the seal base. The alignment tab projects out from the seal ring body and into an aperture in the ring structure. The alignment tab is adapted to substantially rotationally locate and/or fix the secondary seal device to the ring structure.
US10221709B2
The present invention generally relates to a vane for a gas turbine, and more in particular it provides an innovative vane with improved flexibility leading to a reduction of stresses at the transition from the vane trailing edge to the vane platform, without interfering into the cooling scheme of such component. The present invention can increase flexibility of the vane platform by introducing on the vane platform a material cutback confined in the proximity of the trailing edge portion of the vane airfoil.
US10221701B2
A turbine component comprises a platform and an airfoil extending radially away from the platform and extending from a leading edge to a trailing edge. A leading edge portion defines the leading edge of the airfoil and a trailing edge portion including the trailing edge. One of the leading and trailing edge portions also includes the platform. The leading edge portion is formed of a first material distinct from a second material forming the trailing edge portion. The first material has an operating temperature capability at least 100F higher than that of the second material. A gas turbine engine is also disclosed.
US10221700B2
The present disclosure provides methods and systems for the bonding of dissimilar substrates. For example, a first substrate may be coupled to a second substrate by a composite joint between the first substrate and the second substrate. The composite joint may be comprised of a first adhesive material and a second adhesive material. The first adhesive material may be disposed on the first substrate, and the second adhesive material may be disposed to the first adhesive material. The composite joint between the first substrate and the second substrate may provide an isolation layer therebetween, preventing galvanic corrosion.
US10221697B2
A turbine blade (100) having an airfoil (1). In its radially outer region, the turbine blade (100) has at least one shroud (200) or at least one shroud segment, as well as at least one cutting tooth (300) which is intended to engage at least once into portions of a turbine casing during use of the turbine blade (100). The cutting tooth (300) is connected to the shroud (200) or the shroud segment.
US10221695B2
A gas turbine engine airfoil has a hollow airfoil section extending chordwise between a leading edge and a trailing edge. The airfoil has a leading edge cooling passage and a separate serpentine passage for cooling a remaining portion of the airfoil. The serpentine passage has at least three segment serially interconnected in fluid flow communication. The leading edge cooling passage and the serpentine cooling passage have separate coolant inlets. The coolant inlet of the serpentine passage comprises a primary inlet branch connected in fluid flow communication with a first one of the segments of the serpentine passage and a secondary inlet branch connected in flow communication with a last one of the segments, thereby providing for a portion of the flow passing through the coolant inlet of the serpentine passage to be directly fed into the last segment of the serpentine passage.
US10221684B2
A method for determining the volume of core samples disposed within a sealed pressure vessel, the sealed pressure vessel containing a prefill fluid having a density, the method including determining the internal volume of the pressure vessel; determining the density of the prefill fluid; determining, using at least one of one or more computers, the net density of the core samples disposed within the sealed pressure vessel; determining, using at least one of the one or more computers, the density of one or more earth strata proximate the respective in situ locations of the core samples; and calculating, using at least one of the one or more computers, the volume of the core samples disposed within the sealed pressure vessel. In an exemplary embodiment, the core samples are sealed within the pressure vessel when the pressure vessel is disposed within an oil or gas wellbore.
US10221683B2
An in-well type acoustic telemetry system includes an elongate tubular housing, an elongate transmitter in the tubular housing, a receiver in the tubular housing, and a spring between the transmitter and the housing biasing the transmitter into acoustic coupling to the housing. The transmitter is adapted to generate an output acoustic signal by linearly fluctuating in response to an electrical signal. The receiver is adapted to generate another electrical signal by linearly fluctuating in response to an input acoustic signal.
US10221681B2
Methods and apparatus for monitoring steam injection in a steam assisted well are disclosed. The method involves obtaining a first temperature profile of a well by performing distributed temperature sensing on a first fiber optic. The method also obtains a second temperature profile of the well by interrogating a second fiber optic to provide distributed sensing of temperature variations. Interrogating the second fiber optic comprises repeatedly launching interrogations of one or more pulses of coherent radiation into said second fiber optic, detecting any radiation which is Rayleigh backscattered from each interrogation and analyzing the detected backscattered radiation to detect any variation between interrogations due to temperature variation. The method combines said first and second temperature profiles to provide a steam injection profile. The method may also involve determining an acoustic profile of the well through distributed acoustic sensing. Measurements from a small number of downwell point temperature and pressure sensors may also be used to determine the steam injection profile.
US10221676B2
A method and an apparatus are provided for determining an orientation of a tool with respect to a reference direction. The tool is configured to be moved along a wellbore and to generate information usable to determine an orientation of the tool. At least one first signal is indicative of an orientation of a directional reference system with respect to the reference direction. Information regarding a relative orientation of the tool with respect to the directional reference system is used to determine the orientation of the tool with respect to the reference direction in response at least in part to the at least one first signal.
US10221669B2
Wellbore tubulars including a plurality of selective stimulation ports and methods of utilizing the same. The wellbore tubulars include a tubular body including an external surface and an internal surface that defines a tubular conduit. The wellbore tubulars also include a plurality of selective stimulation ports, and each selective stimulation port includes a SSP conduit and an isolation device that is configured to selectively transition from a closed state to an open state responsive to a shockwave having greater than a threshold shockwave intensity. The methods include methods of stimulating a subterranean formation utilizing the wellbore tubulars. The methods also include methods of re-stimulating the subterranean formation utilizing the wellbore tubulars.
US10221656B2
A system and process relating to well fracturing and stimulation operations are provided. The system and process allow for fracturing multiple zones in a wellbore. The system and process provide for introducing a fluid through a plurality of spaced-apart sleeve assemblies wherein each sleeve assembly can be in an operable state which allows the sleeve assembly to be open or closed and can be in a non-operable state which prevents the sleeve assembly from opening or closing.
US10221655B2
Wellbore flow-control assemblies define a flow-controlled fluid conduit that selectively conveys a fluid flow, including fluid outflow and fluid inflow, between a subterranean formation and a casing conduit. The wellbore flow-control assemblies include a sacrificial flow-control device that defines a first portion of the flow-controlled fluid conduit and a directional flow-control device that defines a second portion of the flow-controlled fluid conduit. The sacrificial flow-control device resists the fluid flow prior to a flow-initiation event and permits the fluid flow subsequent to the flow-initiation event. The directional flow-control device permits one of fluid outflow and fluid inflow and resists the other.
US10221652B2
A downhole ball valve includes a housing that includes a tubular member; a ball seat positioned in the tubular member, the ball seat including a sealing surface; and a ball that includes a first hemispherical portion, a second hemispherical portion, and a bore that extends through the ball between the first and second hemispherical portions. The ball is adjustable between a closed position with the first hemispherical portion sealingly engaged with the sealing surface of the ball seat to close the bore to fluid communication with the tubular member, and an open position with the bore at least partially in fluid communication with the tubular member. The first hemispherical portion includes a first material, and at least a portion of the second hemispherical portion that extends from a surface of the ball towards the bore of the ball includes a second material different than the first material.
US10221651B2
A system including a stem guide system, including a stem guide, and a sleeve coupled to the stem guide, wherein the sleeve is configured to rest within a valve stem groove of a valve stem.
US10221645B2
A high-integrity pressure protection system Christmas tree is provided. In one embodiment, an apparatus includes a Christmas tree, a choke coupled to receive fluid from the Christmas tree, and a high-integrity pressure protection system. The high-integrity pressure protection system includes pressure sensors downstream of the choke, valves upstream of the choke, and a logic solver connected to control operation of the valves of the high-integrity pressure protection system that are upstream of the choke. Further, the valves of the high-integrity pressure protection system that are upstream of the choke include at least two valves of the Christmas tree. Additional systems, devices, and methods are also disclosed.
US10221635B2
A slide cartridge having a base member and a channel defined by a pair of opposed walls. The walls extend from the base member and are configured to partially cover the rail of a horizontal directional drilling machine. The slide cartridge is supported on a carriage that is movable between the front and back of the drilling machine along the rail. The cartridge is positioned to engage the rail and to support the carriage for sliding movement along the rail.
US10221631B2
The drilling rig includes a first substructure and a second substructure. The second substructure is positioned generally parallel to and spaced apart from the first substructure and generally the same height as the first substructure. The drilling rig further includes a drill rig floor coupled to the first and second substructures, where the drill rig floor positioned substantially at the top of the first and second substructures.
US10221629B2
A polycrystalline super hard construction has a body of PCD material and a plurality of interstitial regions between inter-bonded diamond grains forming the PCD material. The body also has a first region substantially free of a solvent/catalyzing material which extends a depth from a working surface into the body of PCD material. A second region remote from the working surface includes solvent/catalyzing material in a plurality of the interstitial regions. A chamfer extends between the working surface and a peripheral side surface of the body of PCD material. The chamfer has a height which is the length along a plane perpendicular to the plane along which the working surface extends between the point of intersection of the chamfer with the working surface and the point of intersection of the chamfer and the peripheral side surface of the body of PCD material. The depth of the first region is greater than the height of the chamfer. A first length along a plane extending from the point of intersection of the chamfer and the peripheral side edge of the PCD body at an angle of between around 65 to 75 degrees to the interface between the first and second regions is between around 60% to around 300% of the depth of the first region.
US10221623B2
A shade motor power bracket assembly for a shade system is provided comprising a first electrical and mounting interface adapted to provide electrical power to a shade motor and to provide a quick connect-disconnect mounting surface for a shade system that comprises the shade motor, and wherein the first electrical and mounting interface comprises a first bracket adapted to be mounted on a mounting surface and that comprises a plurality of first electrical contacts, and a shade end cap adapted to enclose a first end of a shade tube, the shade motor disposed within the shade tube, the shade end cap comprising a plurality of second electrical contacts adapted to electrically interface with respective ones of the plurality of first electrical contacts.
US10221620B2
A home-automation equipment includes a concealing device including a screen, a holding device of the screen, a load bar, a motorized drive device and an autonomous electrical energy supply device. The motorized drive device includes an electromechanical actuator making it possible to raise and lower the screen. The supply device includes a battery positioned at the holding device, a first electrical connection element positioned at the load bar and configured to be connected to an external electrical supply source, so as to recharge the battery, and a second electrical connection element positioned at the holding device. The second element cooperates with the first element only when the screen is in a recharging position of the battery, so as to establish an electrical connection between the first element and the battery.
US10221616B2
Disclosed is a magnetically mountable seal, and method of use thereof. The seal is capable of sealing a gap between a door, and either its frame or a second door. The magnetically mountable seal comprises a magnetic portion, magnetically attached to a surface; and a seal portion secured to the magnetic portion. The method of use comprises the steps of: (a) magnetically attaching the magnetic portion to one of the first door, its frame, and the second door; and (b) securing the sealing portion so that the sealing portion covers the gap when the first door is in a closed position and does not interfere with the functionality of the first door when the first door is in an open position. Improved energy efficiency around the gap reduces energy consumption. The sealing portion can be a thermal barrier, acoustic barrier, hermetic, odor barrier, contagion barrier, and fire barrier.
US10221605B2
An abutment element (B1, B2) is described adapted to be arranged on a profile (10) mounted on a furniture item, on the profile being able to slide a shock-absorber that is integral with a door and which is mounted to meet the abutment element to activate. The element has a portion (32, 52) slidably couplable to the profile so that the abutment element can slide on the profile without detaching; and a modifiable structure for creating a constraint to the sliding of the abutment element so as to make it integral with the profile. Thereby easy assembly and lack of screw-hole are assured.
US10221597B2
A furniture hinge for pivotally connecting at least two furniture parts to one another includes at least two fastening portions pivotally connected to one another for fastening to the furniture parts, and the fastening portions can be moved relative to each other between a closed position and an open position. A spring device presses the fastening portions into the closed position and/or into the open position, and a damping device dampens a relative movement of the fastening portions. The spring device is integrated into the damping device, and the damping device and the spring device are accommodated within a first and within a second housing portion. The first and second housing portions are displaceably arranged relative to one another for performing the relative movement.
US10221591B2
A dual locking padlock having a code locking mechanism and an overriding mechanism is disclosed. The housing has a top body as its top portion, a stack of dials and a stack of clutches mounted on a middle portion and a bottom portion having holes to receive screws from the top body for securing the housing. Dials are engagingly mounted on the clutches and only rotatable relative to the clutch when the lock is in the opened mode for changing the combination code. The housing has a spindle having a channel to store the heel of a shackle. The spindle's upward movement allows the shackle to be pulled upward to unlock the padlock. The spindle is allowed to move upward either when a correct combination code is used or when a key activates the overriding mechanism. With the overriding mechanism, the padlock can also be opened with a key.
US10221587B1
A device preventing movement of a lever in an upward and downward direction is disclosed. The device has a first projection and a second projection that are moveable radially to a first position that prevents movement of the lever, and to a second position that permits movement of the lever. The first projection and the second projection may be moved independently by engaging respective buttons on the first projection and the second projection. The device has many uses, included as a safety device to prevent children or others from moving a door lever to open a door.
US10221585B2
The present invention relates to a vehicles parking in multiple levels (1), which comprises a parking box (2); a base structure (3) and a lifting system (4); allowing the storing of vehicles in different levels in relation to the ground level, optimizing the use of the space; and to a method for managing maneuvering consisting of a system for optimizing the parking space and the vehicles parking in multiple levels (1).
US10221583B1
An artificially-lighted waterfall fixture apparatus includes a fixture housing having a lower housing part and an upper housing part overlying and fitted with the lower housing part so as to define a water-distributing channel and a passageway extending forwardly from and in communication with the water-distributing channel to receive a flow of water therefrom and produce an artificial waterfall flowing from an outlet of the passageway. The apparatus also includes an elongated baffle disposed in the fixture housing along a top portion of the water-distributing channel to receive and convert the flow of water to a laminar flow through the passageway, and an artificial light-focusing module supported centrally in the fixture housing proximate the water-distributing channel and aligned with the passageway so as to generate a beam of light through the passageway that produces a predetermined configuration of light in the laminar flow of water.
US10221582B2
A wave pool for generating surfable waves is disclosed. The wave pool includes a pool for containing water. The pool defines a channel having a first side wall, a second side wall, and a bottom with a contour that slopes upward from a deep area proximate the first side wall toward a sill defined by the second side wall. The wave pool further includes at least one foil at least partially submerged in the water near the side wall, and being adapted for movement by a moving mechanism in a direction along the side wall for generating a wave in the channel that forms a breaking wave on the sill. The wave pool further includes one or more passive flow control mechanisms to mitigate a mean flow of the water induced by the movement of the at least one foil in the direction along the side wall.
US10221581B2
A convertible floor panel assembly incorporates a metal wire mesh subfloor and a polymer deck overlying the wire mesh subfloor. A plurality of alignment heads project from an underside of the polymer deck, and are designed to extend through respective mesh openings defined by the wire mesh subfloor. A plurality of panel retainers engage respective alignment heads, and are adapted for removably attaching the wire mesh subfloor and the polymer deck together. The floor panel assembly is thereby convertible between a substantially open-surface sound permeable safety structure and a continuous solid-surface structure for increased floor load capacity.
US10221565B2
A floor-to-ceiling window for a building, the window including insulating glazing units having transparent vertical elements when the glazing units adjoin each other. The joints between the glazing units allow for a slight relative movement between glazing units while ensuring sealing tightness of the window from wind and weather.
US10221557B2
Structural member for a reinforced stud wall including a tie rod. A horizontal longitudinal hollow bearing member having a horizontal longitudinal axis and horizontal and parallel top and bottom walls extending along the horizontal longitudinal axis. The top and bottom walls are configured to support a downward compression force transverse to the top wall from the tie rod when the tie rod is attached to the top wall. First and second web flanges connect the top and bottom walls to form first and second “I”-shaped cross-sections joined together side-by-side, the web flanges extending along the longitudinal axis of the hollow bearing member. The web flanges are configured to transfer downward compression force on the top wall to the bottom wall. Opening through the top and bottom walls allows the tie rod to extend vertically therethrough, the opening being confined within a space between vertical portions of the web flanges.
US10221552B2
A seamless undermount sink system includes a solid countertop having a sink mounting aperture defining an inner periphery disposed therethrough. The system also includes a sink having a sidewall with a rimless upper edge defining an outer periphery therearound. A mounting assembly is attached to a portion of the sink, and an interface is formed between the sink and the solid countertop. A sealing assembly is disposed in the interface between the rimless upper edge of the sink and the solid countertop to prevent water, food, or other debris from getting in between the sink and the solid countertop.
US10221541B1
A system to stabilize a construction vehicle is disclosed having a frame and a pair of stabilizing legs with ground-engaging shoes at the ends of the legs. The stabilizing legs may pivotally connect to the frame on substantially opposing sides, so that the stabilizing legs pivot upwards to a stowed position and pivot downwards to a stabilizing position where the shoe engages the ground. The stabilizing legs may telescope between a retracted and extended position. The retracted position locates the shoe closer to the vehicle and the extended position further from the vehicle. A pair of hydraulic cylinders may be connected to the respective stabilizing legs to power the telescopic movement of the stabilizing legs between the retracted position and extended position. A controller may allow substantially lateral movement of the construction vehicle while the pair of stabilizing legs are engaged with the ground to support the construction vehicle.
US10221537B2
The purpose of the present invention is to provide an artificial ground freezing method having good coolant thermal efficiency without a gas-phase coolant being released into the ground or into the air. For that purpose, the present invention has: a freeze pipe (1: casing) for freezing the ground buried in the ground and a coolant circulation pipe (2) provided on the inside of the freeze pipe (1), wherein the coolant flowing inside the coolant circulation pipe (2) is carbon dioxide; and a coolant apparatus (10) that cools and supplies the carbon dioxide to the coolant circulation pipe (2), the coolant circulation pipe (2) comprising a first coolant circulation pipe (2A) on which a plurality of micro-coolant passages (2A delta) is formed, wherein the tip portion (tip portion in the ground) of the first coolant circulation pipe (2A) is connected to a plugging member (3: bottom socket) that connects the plurality of micro-coolant passages (2A delta) of the first coolant circulation pipe (2A) to a coolant supply side and coolant return side.
US10221533B2
A system for stabilization of a shoreline comprising a sheet having an unfolded state and a folded state, the sheet comprising a first edge and a second opposing edge connected by a first end and a second end, the sheet comprising a first layer formed from a first degradable fabric and a second layer formed from a second degradable fabric, the sheet further comprising channels formed at each of the first edge and the second edge, the channels formed from one or more of the first and the second fabrics, each of the channels comprising an anchor rope threaded therethrough, and each of the channels comprising a plurality of openings, wherein the anchor rope extends through the plurality of openings for securement to a shoreline surface by the anchor rope, and methods of using the same.
US10221531B2
A bollard security system for opening and shutting an entrance or exit to a passageway includes a plurality of bollards activated by a drive system including a counterweight. The system includes vehicle and or personnel recognition and authorization system for lowering the bollards. The system can be operated manually when the drive system is non-operational.
US10221529B1
A barrier wall has a first vertical support and a second vertical support. A first wall panel is disposed between the first vertical support and second vertical support. A second wall panel is disposed between the first vertical support and second vertical support over the first wall panel. An I-beam is disposed between the first wall panel and second wall panel. The I-beam includes a first flange and second flange extending into the first wall panel and second wall panel. A cable is disposed between the first wall panel and second wall panel. The I-beam includes a ridge around the cable. A grounding cable is attached to the I-beam. The first wall panel includes a first channel extending for a length of the first wall panel. A first sound absorbing material strip is disposed in the first channel. A traffic barrier is disposed under the first wall panel.
US10221510B2
A nonwoven fabric includes a plurality of discontinuous fibers, a plurality of natural keratin fibers, and a plurality of meltblown fibers. The discontinuous fibers, the natural keratin fibers, and the meltblown fibers form a continuous bonding web structure.
US10221507B2
A weft yarn measuring and storing device of a loom includes a drive roller, a support shaft, a support lever is turnably mounted to the support shaft, a feed roller that is rotatably mounted to the support lever and pressed to be contacted against the drive roller by a spring force so that the feed roller is rotated by rotation of the drive roller to pinch a weft yarn therebetween for feeding, and a storing drum that takes up and stores the fed weft yarn. The weft yarn measuring and storing device further includes a friction resistance imparting portion that imparts the support lever a friction resistance against turning of the support lever.
US10221504B2
An apparatus for blending a polyethylene terephthalate (PET) and a kapok fiber using static electricity is provided, along with a method for blending the PET fiber and the kapok fiber using the apparatus. The fiber blending apparatus includes a fiber blending chamber having an inlet in which the PET fiber and the kapok fiber are introduced and an outlet from which a nonwoven fabric is discharged. A discharge plate is positioned at an upper side and a lower side based on a center line passing through the center of a cross section of the fiber blending chamber to accumulate the static electricity. The PET fiber and the kapok fiber contacting the discharge plate are electrically charged and are thus uniformly distributed and blended around the center line and stacked around an outlet.
US10221503B2
Disclosed are methods of fiber spinning and polymer fibers that utilize multifunctional thiol and enes compounds. Also, the subject matter disclosed herein relates to uses of polymer fibers and articles prepared from such fibers.
US10221500B2
Systems and methods for forming an ingot from a melt are disclosed. A system includes a crucible defining a cavity for receiving the melt, and a first and second barrier to inhibit movement of the melt. A first passageway and a second passageway are arranged to allow the melt located within an outer zone to move into and through a transition zone and into an inner zone. Conditioning members are placed in at least one of the zones and arranged to contact the melt to reduce the number of micro-voids in the melt.
US10221494B2
A hanging bar for supporting an anode (10) without lugs which is formed by a first lower portion of the body (11) and a second upper hanging portion (12) which comprises: two elongated splints (15) having a width similar to said second upper hanging portion (12); two plastic spacer pieces (33) connecting the ends of said two splints (15) being each one of said two plastic spacer pieces (33) formed by a base (28) from which two pillars (20) emerge, leaving between both pillars (20) a central housing zone (34), wherein on said base (28) and between said pillars (20) there is a planar surface (31) and on the inner portion of said base (28) there is an inclined surface (30), two pivoting supports (17), being each one of them housed in the central housing (34) of said two plastic spacer pieces (33), wherein said pivoting supports (17) are formed by a straight piece (43) which finishes in one of its ends in a bushing (27) in the center of which has a first hole (39) which matches second holes (38) of said pillars (20) and third holes (40) of said elongated splints (15) in such a way that within the holes (38, 39, 40) a short axis (21) is housed wherein said pivoting supports (17) pivot; and a pair of pivoting lugs (16) which are supported by said pivoting supports (17) being each pivoting lug (16) formed by a first elongated portion (36) and a second short portion (37) integrally connected to each other at 90° providing an L shape wherein said first portion (36) has first toothed notches (26) and wherein said second short portion (37) has second toothed notches (25).
US10221493B2
The present invention provides a method of recovering copper and zinc from an aqueous sulfate and chloride containing solution. In the first process step zinc and copper are simultaneous extracting with an extraction solution comprising a liquid chelating cation exchanger and a liquid anion exchanger. The extraction is followed by consecutive stripping stages. First the anionic species are washed from the organic phase with one or more aqueous solutions and finally the copper is stripped with an aqueous acidic solution.
US10221491B2
The present invention relates to an electrochemical process for generating or recovering hydrochloric acid from metal salt solutions such as acidic metal salt solutions and saline solutions. The process is useful for treating acidic salt solutions that are waste products from mineral processing or other industrial processes such as metal finishing, water softening, water treatment, reverse osmosis, electrodialysis, coal seam gas extraction, shale gas extraction and shale oil extraction, to generate high purity hydrochloric acid, metal salts and recycled water that may be re-used in the industrial process. An apparatus for performing the electrochemical process is also described.
US10221484B2
A temperature controlled showerhead for chemical vapor deposition (CVD) chambers enhances heat dissipation to enable accurate temperature control with an electric heater. Heat dissipates by conduction through a showerhead stem and fluid passageway and radiation from a back plate. A temperature control system includes one or more temperature controlled showerheads in a CVD chamber with fluid passageways serially connected to a heat exchanger.
US10221481B2
Metal complexes containing one or more amidoimine ligands, methods of making such metal complexes, and methods of using such metal complexes to prepare metal-containing films are provided.
US10221472B2
A structural aluminum alloy plate includes 7.0% to 12.0% by mass of Zn, 1.5% to 4.5% by mass of Mg, 1.0% to 3.0% by mass of Cu, 0.05% to 0.30% by mass of Zr, 0.005% to 0.5% by mass of Ti, 0.5% or less by mass of Si, 0.5% or less by mass of Fe, 0.3% or less by mass of Mn, 0.3% or less by mass of Cr, and the balance that includes aluminum and inevitable impurities. A method of producing the structural aluminum alloy plate is also provided.
US10221469B2
Provided is an Al—Mg alloy plate for molding, having excellent press formability, little stretcher strain (SS) mark generation, and not generating any new issues such as reduced bending properties as a result of age-hardening at room temperature, while using more accurate and simple structural indicators. As a result, the Al—Mg aluminum alloy plate comprising a specific composition including Cu has a plate structure having an average particle diameter of 0.5-6.0 nm in a minute particle (cluster) particle distribution measured using an X-ray scattering method, controls the volume fraction to at least 0.03%, is unlikely to have serration, and suppresses SS mark generation during press forming.
US10221468B2
Additive manufacturing methods, and articles made using additive manufacturing methods, are described herein. One embodiment is an article that comprises a hafnium-bearing superalloy. The superalloy includes at least about 50 weight percent nickel, from about 0.015 weight percent to about 0.06 weight percent carbon, and up to about 0.8 weight percent hafnium. The article further includes a plurality of primary carbide phase particulates disposed within the superalloy; the plurality has a median size less than about 1 micrometer. A method includes melting and solidifying particulates of a metal powder feedstock to build an intermediate article comprising a series of layers of solidified material. The feedstock includes the above-described superalloy composition. The method further includes heating the intermediate article to a temperature of at least about 950 degrees Celsius to form a processed article. The processed article further includes a plurality of primary carbide phase particulates disposed within the solidified material, the plurality of particulates having a median size less than about 1 micrometer.
US10221458B2
Disclosed in the present invention is a method for screening cancer, comprising the following steps: (1) providing a specimen to be detected; (2) detecting the methylation status of CpG sequence of at least one target gene which is at least one of ADRA1D, AJAP1, HS3ST2, MAGI2, POU4F2, POU4F3, PTGDR, SOX17 and SYT9 in genomic DNA of the specimen; (3) determining whether cancer or precancerous lesions are present in the specimen according to the methylation status of at least one target gene.
US10221453B2
The present invention relates to methods, monitors and systems, useful, for example, for advanced detection of sepsis in a subject.
US10221448B2
The present invention relates to a scalable multiplex PCR method that can simultaneously amplify overlapping amplicons without the drawbacks of conventional multiplex PCR. The method selectively amplifying target nucleic acid fragments having an overlapping region. The method comprises the steps of: obtaining a first nucleic acid sequence comprising a first tag t2 and a first forward primer F1, obtaining a second nucleic acid sequence comprising a second tag t1 and a first reverse primer R1, obtaining a third nucleic acid sequence comprising the second tag t1 and a second forward primer F2, obtaining a fourth nucleic acid sequence comprising a third tag t3 and a second reverse primer R2, wherein each primer is a gene-specific primer; performing initial cycles of PCR; and then performing later cycles of PCR at higher annealing temperatures to obtain amplification products.
US10221438B2
The present invention relates to an antibody-like protein based on the tenth fibronectin type III domain (10Fn3) that binds to serum albumin. The invention further relates to fusion molecules comprising a serum albumin-binding 10Fn3 joined to a heterologous protein for use in diagnostic and therapeutic applications.
US10221427B2
The Applicant has identified a novel DON-responsive orphan gene (ENST1—SEQ ID NO: 1), and its promoter, which features DON-responsive elements, which can be used to drive the expression of FHB resistance genes. The Applicant has isolated two variants of the gene from wheat that share approximately 94% homology with ENST1. The Applicant has shown that this gene has homologs of >62% nucleotide sequence identity exist in Aegilops tauschii, Brachypodium distachyon, Festuca pratensis, Hordeum vulgare and Triticum aestivum.
US10221423B2
The invention discloses a promoter which can be induced to express in acidic conditions, and relates to the field of bioengineering technology. The promoters of the invention are separated from A. niger and can actuate and/or regulate the expression of the effectively connected nucleic acids in A. niger. In the invention the expression of the promoters is studied in A. niger, and it is indicated that some promoters show weak expression, and some show strong activity. The invention provides an effective method and new thought for organic acids production by fungi or other products produced by fermentation under acidic conditions.
US10221418B2
The present invention relates to a composition for preventing or treating diseases associated with human papillomavirus (HPV), and more specifically, cancer associated with HPV, and even more specifically, cervical cancer. The nucleotide sequence of the present invention, the sequence in which the base thereof is modified, and a specific combination thereof can be useful in a composition for effectively treating diseases associated with HPV infection by greatly inhibiting the expression of the E6/E7 gene of HPV type 16 or 18.
US10221415B2
The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
US10221413B2
The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Uncoupling Protein 2 (UCP2), in particular, by targeting natural antisense polynucleotides of Uncoupling Protein 2 (UCP2). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of UCP2.
US10221412B2
The present invention relates to a multiplex microfluidic device for selection of nucleic acid aptamers and a method for high-throughput selection of nucleic acid aptamers using the same, and more particularly to a multiplex microfluidic device (SELEX lap-on-a-chip) that uses an improved multiplex platform in place of the development of an aptamer for a single target and to a method for high throughput selection of aptamers using the same together with high-throughput sequencing. A multiplex microfluidic device according to the present invention can simultaneously detect aptamers for a plurality of targets, and it can greatly increase the screening throughput and greatly shorten the process time compared to conventional multiplex techniques. Particularly, when a process for selecting aptamers is performed using the device of the invention together with a high-throughput sequencing method, the number of target binding/elution/amplification rounds can be greatly reduced, and the process can be performed in an automated manner. Thus, the device of the invention is highly useful.
US10221404B2
The present invention relates to a method for modifying one or more characteristics of a lipase, comprising the step of associating a peptide to the lipase, wherein the peptide has at least 50% sequence identity with the amino acid sequence of at least one major lipase contact zone of the propeptide of said lipase.
US10221403B1
The present invention provides a method of preparing zearalenone hydrolase, including the step of culturing a yeast cell carrying a gene encoding a zearalenone hydrolase in a medium to express a protein of the zearalenone hydrolase, wherein the medium contains 20 to 25% molasses by weight. This method provides a new strategy to efficiently prepare zearalenone hydrolase at low expenses.
US10221402B2
Disclosed herein are methods for the large-scale production of a highly thermally stable acetylcholinesterase (AChE) and butyrylcholinesterase (BChE). Additionally, the expression methods disclosed herein can produce ChE preparations consisting of extract or purified forms that can be produced in high amounts and are highly thermally stable. These ChE products can be used in vitro detection, detoxification and decontamination methods.
US10221394B2
Methods for mimicking a tumor microenvironment in vitro are provided. The methods comprise indirectly applying a shear stress upon at least one tumor cell type plated on a surface within a cell culture container. Methods for mimicking tumor metastasis and methods for testing drugs or compounds in such systems are also provided.
US10221386B2
A method for controlling a fermentation process includes injecting a mash into a fermenter and injecting a liquid ammonia additive into the fermenter. The liquid ammonia additive is injected in a closed-loop manner. The method may be used to control the fermentation processes of one or more fermenters operating in parallel.
US10221384B2
A bioreactor system comprising a base station comprising a control system, a tray arranged to be provided on the base station and arranged to house a bioreactor bag, wherein said base station comprises at least one temperature sensor means and in that said tray comprises at least one opening for receiving said temperature sensor means such that it will contact a surface of a bioreactor provided in the tray.
US10221381B2
Systems, devices, and methods for generating, culturing, and using magnetically-controlled three-dimensional (3D) tissues are described. A magnetically-enabled transwell system for immobilizing and supplying perfusion to a 3D mini-tissue includes a cell culture vessel with at least a first chamber and a second chamber, the mini-tissue being disposed in the first chamber, and a perfusion mechanism defining an elongate perfusion channel with a proximal end in the first chamber and a distal end in fluid communication with the second chamber, with a magnetic element configured to immobilize a magnetically-controlled 3D mini-tissue such that the proximal end is in fluid communication with basolateral space of the immobilized mini-tissue.
US10221366B2
A process for upgrading residuum hydrocarbons and decreasing tendency of the resulting products toward asphaltenic sediment formation in downstream processes is disclosed. The process may include: contacting a residuum hydrocarbon fraction and hydrogen with a hydroconversion catalyst in a hydrocracking reaction zone to convert at least a portion of the residuum hydrocarbon fraction to lighter hydrocarbons; recovering an effluent from the hydrocracking reaction zone; contacting hydrogen and at least a portion of the effluent with a resid hydrotreating catalyst; and separating the effluent to recover two or more hydrocarbon fractions.
US10221365B2
A system is provided integrating a steam pyrolysis zone integrated with a solvent deasphalting zone to permit direct processing of crude oil feedstocks to produce petrochemicals including olefins and aromatics.
US10221357B2
A method of preparing a solution capable of etching a platable plastic. The method comprises the steps of: (a) providing an electrolyte comprising a solution of manganese(II) in a solution of 9 to 15 molar sulfuric acid or phosphoric acid to an electrolytic cell; (b) applying a current to the electrolytic cell, wherein the electrolytic cell comprises an anode and a cathode; and (c) oxidizing the electrolyte to form manganese(III) ions, wherein the manganese(III) ions form a metastable sulfate complex. Thereafter, a platable plastic may be immersed in the metastable sulfate complex for a period of time to etch the platable substrate prior to subsequent plating steps.
US10221341B2
There is provided a method of bonding a first substrate to a second substrate, wherein said method comprises (a) applying a layer of a waterborne adhesive composition to a surface of said first substrate, wherein said waterborne adhesive composition comprises one or more vinyl polymer that comprises (i) 0 to 0.4% polymerized units of carboxyl functional monomer, by weight based on the weight of said vinyl polymer, and (ii) 0.1% to 10% polymerized units of amide monomer, by weight based on the weight of said vinyl polymer, (b) drying said layer of a waterborne adhesive composition to remove water, and (b) contacting a surface of said second substrate to said layer, wherein one or both of said first substrate and said second substrate comprises one or more slip agent Also provided is a bonded article made by such a method.
US10221338B2
Provided is a pressure sensitive adhesive sheet containing a resin layer on a substrate or a release material, at least a surface (α) of the resin layer being opposite to the side thereof on which the substrate or the release material is provided having pressure sensitive adhesiveness, wherein, when a smooth surface of a light transmissive adherend having a smooth surface is attached to the surface (α), one or more concave portion (G) not kept in contact with the smooth surface exist on the surface (α), and the shapes of the one or more concave portions (G) have irregular shapes. The pressure sensitive adhesive sheet has excellent air escape property capable of readily removing air accumulation that may be formed on attaching to an adherend, and has good pressure sensitive adhesion characteristics.
US10221333B2
A compound is provided, having the formula (I), wherein Rs is a soft block polymer; wherein each T is independently a urethane or urea linkage; see formulae (A) and (B); wherein each RD is independently —CH3, —CH2CH3, —CH2CH2CH3, or —CH2CH2CH2CH3; wherein each R′D is independently —CH3, —CH2CH3, —CH2CH2CH3, —CH2CH2CH2CH3, or —ORD; and wherein each p is independently 1, 2, or 3. Compositions containing the compound, and methods of making and using the compound are provided.
US10221331B2
A coating composition may include one or more radiation-curable resins having reactive groups in a hydrophilic region, a reactive surfactant comprising a reactive moiety; and a photoinitiator, wherein, upon the exposure of the photoinitiator to light energy, the one or more radiation-curable resins are cured to form a hydrophilic network with the reactive surfactant being bound to the network by binding of the reactive moiety of the surfactant to the reactive groups of the one or more radiation-curable resins. The cured coatings provide long lasting, washable, anti-fog properties.
US10221329B2
The invention relates to a composition containing a hydrophobic wax, a silicon oil which primarily contains non-polar lateral chains, a hydrophilic binding agent pigment and/or filler, said composition having a pigment volume concentration of 25-60%. The invention also relates to a coating on a substrate surface containing a hydrophobic wax, a silicon oil which primarily contains non-polar lateral chains, a hydrophilic binding agent pigment and/or filler, said composition having a pigment volume concentration of 25-60%.
US10221326B2
The present invention relates to an improved process for producing red iron oxide pigments by the Penniman process with nitrate (also called nitrate process or direct red process) and to apparatus for implementing this process, and also to the use of the plant for producing red iron oxide pigments by the Penniman process with nitrate.
US10221319B2
The present disclosure relates to a method for improving the auto-dispersant characteristic in water of a mineral substance. The method includes the steps of dry-grinding, in the presence of a formulation, a mineral substance selected from a dolomite, talc, titanium dioxide, alumina, kaolin and calcium carbonate, wherein the formulation contains a polyglycerol and no glycerol.
US10221315B2
A coating composition is disclosed comprising a film-forming resin and a catalyst component. The catalyst component comprises a catalyst contained within or encapsulated by a carrier; at least some of the catalyst is capable of being released from the carrier via diffusion through the carrier and into the coating composition. Methods of controlling the rate of cure of a curable film-forming composition and increasing the pot life of the composition by adding such catalyst components are also disclosed.
US10221305B2
Modified heterophasic composition to improve the surface appearance of automobil parts.
US10221303B2
To provide a tread rubber composition permitting improvement in wet performance without causing worsening of performance with respect to reduction in fuel consumption and/or wear-resistance. Relates to a tread rubber composition comprising a rubber component and particle-encapsulating microcapsules. The particle-encapsulating microcapsules comprise particles and capsule-like organic compound that encapsulates the particles.
US10221301B2
The invention relates to flame retardants for plastics such as, for example, synthetic polymers and plastic compositions, as well as corresponding production methods and uses.
US10221293B2
A carbon black pellet comprising a plurality of agglomerates, aggregates, or primary carbon black particles and a binder including a hot-polymerized styrene-butadiene copolymer.
US10221282B2
There is provided a photocurable and thermosetting resin composition which suppresses decrease of adhesive strength in a moisture resistance test of the cured resin composition, and has a sufficiently long pot life. The resin composition includes (A) an acrylic resin, (B) a multifunctional nitrogen-containing heterocyclic compound represented by a specific chemical formula, (C) a latent curing agent, (D) a radical polymerization inhibitor, and (E) an anionic polymerization retarder. The resin composition preferably further includes (F) a compound having a glycidyl group, other than the acrylic resin.
US10221280B2
The invention relates to a monofunctional or multifunctional acrylated or methacrylated urethane oligomer where said urethane bond is obtained without use of isocyanate and by the carbonate-amine reaction between a cyclic carbonate and a monoamine or polyamine, with subsequently the conversion of the hydroxyls in the β position with respect to the urethane bond into ester-acids by reaction with a cyclic anhydride, which reaction is followed by the conversion of said acid functional groups into acrylated or methacrylated end groups by reaction with a polyepoxide compound in the presence of acrylic or methacrylic acid.The invention also relates to a preparation process. Said oligomer is used as crosslinkable binder for a functionality of at least 2 in coating, molding, leaktightness agent or sealing compositions or, if monofunctional, as macromonomer in polymerizable compositions for the production of grafted polymers.
US10221276B2
A self-healing hydrophobic epoxy resin composition is provided. The self-healing epoxy resin composition comprises an epoxy resin component and a hardener component, the hardener component comprises at least 0.1 weight % of a modified epoxy resin hardener. The modified epoxy resin hardener is a reaction product of an amino modified oligomericsiloxane and a carboxylic acid anhydride. A process for preparing the modified epoxy resin hardener is also disclosed.
US10221269B2
An (ethylene, vinyl acetal) copolymer includes (i) a plurality of ethylenic moieties A having a structure according to the formula: wherein R2 and R3 independently represent hydrogen, a halogen, an optionally substituted linear, branched or cyclic alk(en)yl group, or an optionally substituted aromatic or heteroaromatic group; (ii) a plurality of acetal moieties B having a structure according to the formula: wherein L1 represents a divalent linking group; X=0 or 1; and R1 represents an optionally substituted aromatic or heteroaromatic group including at least one hydroxyl group; and (iii) a plurality of acetal moieties C and/or moieties D which are different from the acetal moieties B, and which include at least one nitrogen atom.
US10221263B2
A catalyst system for polymerizing olefin-based polymers and interpolymers is disclosed. The catalyst system may include a supported chromium catalyst and a Ziegler-Natta catalyst comprising a bulking agent, Mg, and Ti. The Ziegler-Natta catalysts in catalyst systems disclosed herein run exceptionally well without addition of excessive amounts of co-catalyst, thus allowing for use of chromium based supported catalysts that would otherwise be overwhelmed by aluminum alkyl. Further, embodiments disclosed herein may be run without an internal electron donor, and the lack of an internal electron donor in the system also prevents poisoning of the chromium catalysts by the internal electron donor. By including or co-feeding a chromium based catalyst with these Ziegler-Natta catalysts, it has been found that the molecular architecture of the resulting polyolefins, such as polyethylenes, may provide for resins with excellent processing properties.
US10221257B2
Provided is a method of forming a polymer, comprising (a) providing a reaction mixture comprising (i) one or more vinyl monomers, (ii) one or more pH-sensitive inhibition systems, (iii) one or more initiators, and (iv) water; (b) establishing conditions in said reaction mixture such that a free radical polymerization of said vinyl monomer occurs at a location, and (c) after steps (a) and (b) and prior to completion of said free radical polymerization, changing the pH of said reaction mixture to increase the rate of generation of said free radical polymerization at the location of said free radical polymerization.
US10221237B2
The invention provides methods of using sequence based analysis and rational strategies to improve the solubility of immunobinders, and in particular of single chain antibodies (scFvs). The invention provides methods of engineering immunobinders, and in particular scFvs, by performing one or more substitutions with hydrophilic residues identified by analysis of a database of selected, stable scFv sequences. The invention also provides immunobinders with optimized solubility prepared according to the engineering methods of the invention.
US10221236B2
This invention pertains to NGF antagonists including antibodies and fragments thereof (including Fab fragments) having binding specificity to human Nerve Growth Factor (hereinafter “NGF”), and methods of using one or more of said antibodies and fragments thereof to treat pain in an individual. More specifically the invention relates to methods of treating pain or eliciting an analgesic effect in an individual, comprising administering an effective amount of an NGF antagonist, e.g., an anti-human NGF antibody or fragment thereof or another moiety, such as a nucleic acid or polypeptide such as a fragment of NGF or TrkA which inhibits the association of NGF with TrkA, without appreciably inhibiting the association of NGF with p75. These methods may optionally further include administering an effective amount of a second anti-human NGF antibody or fragment thereof which inhibits the association of NGF with p75, that may further also inhibit the association of NGF with TrkA. Another specific embodiment of this invention relates to the use of the antibodies described herein, and binding fragments thereof, comprising the sequences of the VH, VL and CDR polypeptides described herein, and the polynucleotides encoding them, in methods of treating pain in an individual. The invention also contemplates the use of conjugates of anti-NGF antibodies and binding fragments thereof conjugated to one or more functional or detectable moieties. The invention also contemplates methods of making said anti-NGF antibodies and binding fragments thereof. Embodiments of the invention also pertain to the use of anti-NGF antibodies, and binding fragments thereof, for the diagnosis, assessment and treatment of diseases and disorders associated with NGF, especially pain associated conditions.
US10221230B2
Provided herein are HER-3, HER-1 and IGF-1R B cell epitopes, peptide mimics, chimeric peptides and multivalent peptides. In some embodiments, the chimeric peptides include one or more HER-3, HER-1 and/or IGF-1R B cell epitopes, a linker, and a T helper cell (Th cell) epitope. Pharmaceutical compositions are also provided that contain one or more HER-3, HER-1 and/or IGF-1R chimeric peptides, and optionally, one or more HER-2 chimeric peptides and/or VEGF peptides. Also included herein are methods of treating a cancer using the HER-3, HER-1 and IGF-1R B cell epitopes, chimeric peptides and multivalent peptides.
US10221224B2
This invention provides WT1 peptides and methods of treating, reducing the incidence of, and inducing immune responses against a WT1-expressing cancer, comprising same.
US10221204B2
A composition which has high 4′-GL purity and can be used as a reference standard for various analyses can be obtained by a more convenient method than one conventionally used. A method for preparing a high-purity 4′-GL composition includes the steps of: (A) subjecting a 4′-GL-containing galacto-oligosaccharide to activated carbon column chromatography, and performing stepwise elution with plural organic solvent aqueous solutions, wherein the organic solvent aqueous solutions are used such that the concentration of the organic solvent in the organic solvent aqueous solution is higher than the concentration of the organic solvent in the immediately preceding organic solvent aqueous solution with respect to a series of elutions; and (B) adding an organic solvent to the final fraction eluted in step (A), and crystallizing the 4′-GL.
US10221202B2
The present invention relates to compounds of formula (I) wherein R1, R2, R3, and Z− have one of the meanings as indicated in the specification or a pharmaceutically acceptable salt thereof, to the use of compounds of formula (I) as a medicament, to pharmaceutical compositions comprising at least one compound of formula (I), as well as to medicament combinations containing one or more compounds of formula (I).
US10221190B2
The present invention relates to biguanide compounds and use thereof, more particularly, to biguanide derivatives exhibiting excellent effects for inhibition of cancer cell proliferation and inhibition of cancer metastasis and recurrence, a method for preparing the same, a pharmaceutical composition containing the same as an active ingredient, and a method of prevention or treatment of cancer comprising the step of administering an effective amount of the composition to a subject in need thereof.
US10221187B2
A method for producing anhydrosugar alcohol according to the present invention can increase the yield of anhydrosugar alcohol even in the absence of a catalyst or in the presence of a small amount of a transition metal salt catalyst by controlling the temperature of a high-temperature reaction, which converts sugar alcohol to anhydrosugar alcohol, in two steps, that is, a first low-temperature reaction step and a second high-temperature reaction step.
US10221182B2
Disclosed are chemical entities of Formula (I): wherein X, Y, Z, R1, R3, R4 and R5 are defined herein, as NR2B subtype selective receptor antagonists. Also disclosed are pharmaceutical compositions comprising a chemical entity of Formula (I), and methods of treating various diseases and disorders associated with NR2B antagonism, e.g., diseases and disorders of the CNS, such as depression, by administering a chemical entity of Formula (I).
US10221175B2
Substituted pyrrolo[3,4-e]indolizines, imidazo[1,2-a]pyrrolo[3,4-e]pyridines, pyrrolo[3,4-e][1,2,4]triazolo[1,5-a]pyridines and pyrrolo[3,4-e][1,2,4]triazolo[4,3-a]pyridines as positive allosteric modulators of muscarinic acetylcholine receptor M1
Substituted pyrrolopyridine, imidazopyridine and triazolopyridine compounds having a formula are positive allosteric modulators of the muscarinic acetylcholine receptor M1 (mAChR M1) and the compounds and their pharmaceutical compositions may be useful in treating neurological and psychiatric disorders associated with muscarinic acetylcholine receptor dysfunction. Compounds of the invention may be prepared in several steps from 2-halo-5,6-dihydro-7H-pyrrolo[3,4-b]pyridin-7-one intermediates.
US10221174B2
The present disclosure provides compounds having Formula I-A: and the pharmaceutically acceptable salts and solvates thereof, wherein A, X1, X2, X3 R1a, R1b, E, and are as defined as set forth in the specification. The present disclosure also provides compounds of Formula I-A for use to treat a disease, disorder, or condition responsive to Bcl-2 protein inhibition such as cancer.
US10221173B2
The specification relates to compounds of Formula (I): and to pharmaceutically acceptable salts thereof, to processes and intermediates used for their preparation, to pharmaceutical compositions containing them and to their use in the treatment of cell proliferative disorders.
US10221163B2
The present invention relates to metallo-beta-lactamase inhibitor compounds of Formula I: and pharmaceutically acceptable salts thereof, wherein Z, RA, X1, X2 and R1 are as defined herein. The present invention also relates to compositions which comprise a metallo-beta-lactamase inhibitor compound of the invention or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, optionally in combination with a beta-lactam antibiotic and/or a beta-lactamase inhibitor. The invention further relates to methods for treating a bacterial infection comprising administering to a patient a therapeutically effective amount of a compound of the invention, in combination with a therapeutically effective amount of one or more β-lactam antibiotics and optionally in combination with one or more beta-lactamase inhibitor compounds. The compounds of the invention are useful in the methods described herein for overcoming antibiotic resistance.
US10221160B2
The instant invention describes compounds having metalloenzyme modulating activity, and methods of treating diseases, disorders or symptoms thereof mediated by such metalloenzymes.
US10221159B2
The invention provides agents that target carbonic anhydrase, which can be used as imaging agents or therapeutic agents. The agents can be used to image tumor hypoxia as well as other physiological processes in a subject.
US10221158B2
A genus of arylsulfonamide derivatives of heterocyclic constrained tricyclic compounds is disclosed. The compounds are of the following genus: The compounds induce FOXO1 transcription factor translocation to the nucleus by modulating PP2A and, as a consequence, exhibit anti-proliferative effects. They are useful in the treatment of a variety of disorders, including as a therapy in cancer treatment, or used in combination with other drugs to restore sensitivity to chemotherapy where resistance has developed.
US10221149B2
The present invention discloses a fast and selective process for the preparation of γ-valerolactone (Gvl) by catalytic hydrogenation of biomass-derived levulinic acid (LA) using recyclable ruthenium (Ru)-based heterogeneous catalysts in aqueous medium in stoichiometric yields (˜100%) under mild reaction conditions using nearly required amount of hydrogen.
US10221148B2
A composition of monoanhydro-hexitol monoalkyl ether isomers bearing an alkyl ether radical (OR) at C-3, C-5 or C-6 of the monoanhydro-hexitol, in which the alkyl group (R) is a linear or branched, cyclic or noncyclic hydrocarbon-based group comprising between 4 to 18 carbon atoms, the process for obtaining such a composition and the use thereof as a nonionic surfactant, emulsifier, lubricant, antimicrobial agent or dispersant.
US10221145B2
The present invention discloses a method for preparing an anti-heart-failure medicine LCZ696. The preparing method comprises the following step (formula (I)): in an organic solvent, a Sacubitril dicyclohexylamine salt reacts with valsartan under the effect of a sodium hydroxide aqueous solution, and the anti-heart-failure medicine LCZ696 is obtained. The preparing method of the present invention is simple in process and omits the procedures of ion exchange from a sodium salt to a calcium salt and hydrochloric acid dissociation in an existing production process, residues of calcium ions are avoided, and the production efficiency is effectively improved.
US10221142B2
The present invention relates to compounds according to Formula (I-1) and pharmaceutically acceptable salts thereof. Such compounds can be used in the treatment of RORgammaT-mediated diseases or conditions.
US10221139B2
The present application discloses compounds capable of modulating the activity of histone demethylases (HDMEs), which are useful for prevention and/or treatment of diseases in which genomic dysregulation is involved in the pathogenesis, such as e.g. cancer. The present application also discloses pharmaceutical compositions comprising said compounds and the use of such compounds as a medicament. The compounds take the form
US10221136B2
A method of providing a cooling effect to a product includes the incorporation into the product of at least one compound of the formula I in which m is a number between 0 and 2, X, Y and Z are selected independently from the group consisting of H, halogen, OH, Me, Et, MeO and EtO, and R1, R2 and R3 together comprise at least 6 carbons, selected such that (a) (i) R1 is selected from the group consisting of H, Me, Et, isopropyl and C4-C5 branched alkyl; and (ii) R2 and R3 are independently selected from the group consisting of Me, Et, isopropyl and Ca-branched alkyl; or (b) any two or all of R1, R2 and R3 together form a monocyclic, bicyclic or tricyclic radical having up to 10 carbons. The compounds confer substantial cooling effects on compositions applied to the skin or taken orally, such as toothpastes, mouthwashes, foodstuffs, beverages, confectionery, tobacco products, skin creams and ointments.
US10221132B2
The present invention relates to a process for the synthesis of cysteamine or a salt thereof.
US10221126B2
This application relates to solabegron zwitterion useful for the treatment of lower urinary tract symptoms such as, for example, overactive bladder and prostate disorders. Additionally, this application relates to pharmaceutical compositions and methods of treatment utilizing the solabegron zwitterion for treating lower urinary tract symptoms. This application also relates to methods of preparing solabegron hydrochloride from the solabegron zwitterion.
US10221123B1
A high-yield process for preparing (4Z,7Z)-4,7-decadien-1-yl acetate, with reduced number of steps, without using a protecting group. A process for preparing (4Z,7Z)-4,7-decadien-1-yl acetate is provided, the process including at least the following steps: reducing a 10-halo-3,6-decadiyne of the general formula (1) to form a (3Z,6Z)-10-halo-3,6-decadiene of the general formula (2); and converting the (3Z,6Z)-10-halo-3,6-decadiene into (4Z,7Z)-4,7-decadien-1-yl acetate of the formula (4) having an acetoxy group in place of the halogen atom of the (3Z,6Z)-10-halo-3,6-decadiene.
US10221121B2
A process for regenerating a silica-supported depleted alkali metal catalyst is described. The level of alkali metal on the depleted catalyst is at least 0.5 mol % and the silica support is a zero-gel. The process comprises the steps of contacting the silica supported depleted alkali metal catalyst with a solution of a salt of the alkali metal in a solvent system that has a polar organic solvent as the majority component. A re-impregnated catalyst prepared by the process of the invention any comprising a silica zero-gel support and a catalytic metal selected from an alkali metal in the range 0.5-5 mol % on the catalyst, wherein the surface area of the silica support is <180 m2/g is also described. The invention is applicable to a process for preparing an ethylenically unsaturated acid or ester comprising contacting an alkanoic acid or ester of the formula R1—CH2—COOR3, with formaldehyde or a suitable source of formaldehyde.
US10221120B2
The invention relates to a process for separation of organic acids from mixture of ammonium salts of one or more organic acids and other compounds via an integrated process. The process involves suspending mixture of ammonium salts of one or more organic acids and other compounds in dry hydrocarbon solvent/s or mixtures thereof; wherein the selected hydrocarbon solvent/s or mixtures thereof have boiling point more than 100° C. and forms an azeotrope with water. The reaction mixture thus obtained is dehydrated azeotropically followed by esterification of basic salt of the organic acids by addition of alcohol in presence of metal or metal salt; thereafter the individual esters formed are separated by distillation and hydrolyzed to obtain corresponding organic acids having more than 98% purity.
US10221119B2
Methods, systems and catalysts for converting an alcohol containing feedstock to an upgraded material in a single catalyst bed wherein a feedstock is fed to a catalyst under preselected conditions to obtain an intermediate; and condensing the intermediate through an aldol condensation reaction to yield a product containing an upgraded material. In one instance the feedstock includes ethanol, the catalyst is a mixed metal oxide catalyst and the upgraded material is typically a C5+ ketone(s) or alcohol(s), such as 2-pentanone, 2-heptanone, 4-heptanone and 2-nonanone.
US10221117B2
The present invention provides monomers, analogs, and/or derivatives of bisphenols substituted with one or more fluoromethyl groups. These monomers, analogs, and/or derivatives can be used to form oligomers and/or polymers, which in turn can be used to make compounds with dielectric properties suitable for dielectric materials, including for example, use in energy dense capacitors. In a preferred embodiment, the compounds can comprise a polycarbonate of a homopolymer, copolymer, and/or terpolymer of a bisphenol with one or more fluoromethyl substitution groups. In an aspect of the invention the compounds chosen can be selected based on various desired characteristics, including, for example, their energy density, glass transition temperature, dielectric loss, and/or dipole density.
US10221116B2
The invention provides a process for separating monoethylene glycol from a mixture comprising monoethylene glycol and 1,2-butanediol, said process comprising the steps of: a. providing a first stream comprising monoethylene glycol and 1,2-butanediol to a first distillation zone operated at a first pressure and under conditions to remove a first bottoms stream comprising 1,2-butanediol and to remove a first azeotrope of monoethylene glycol and 1,2-butanediol from the first distillation zone as a first overheads stream; b. withdrawing said first overheads stream from said first distillation zone; and c. providing said first overheads stream to a second distillation zone operated at a second pressure higher than said first pressure and under conditions to remove a second bottoms stream comprising monoethylene glycol and providing a second azeotrope of monoethylene glycol and 1,2-butanediol as a second overheads stream; d. withdrawing said second overheads stream from the second distillation zone and providing it to the first distillation zone as at least a portion of the first stream comprising monoethylene glycol and 1,2-butanediol, e. wherein the mixture comprising monoethylene glycol and 1,2-butanediol is initially provided to at least one of the first distillation zone and the second distillation zone.
US10221113B2
A hydrogenation process is disclosed. The process involves reacting a fluoroolefin with H2 in a reaction zone in the presence of a palladium catalyst to produce a hydrofluoroalkane product, wherein the palladium catalyst comprises palladium supported on a carrier wherein the palladium concentration is from about 0.001 wt % to about 0.2 wt % based on the total weight of the palladium and the carrier. Also disclosed is a palladium catalyst composition consisting essentially of palladium supported on α-Al2O3 wherein the palladium concentration is from about 0.001 wt % to about 0.2 wt % based on the total weight of the palladium and the α-Al2O3. Also disclosed is a hydrogenation process comprising reacting a fluoroolefin with H2 in a reaction zone in the presence of a palladium catalyst to produce a hydrofluoroalkane product, characterized by: the palladium catalyst consisting essentially of palladium supported on α-Al2O3 wherein the palladium concentration is from about 0.001 wt % to about 0.2 wt % based on the total weight of the palladium and the α-Al2O3. Also disclosed is a hydrogenation process comprising (a) passing a mixture comprising fluoroolefin and H2 through a bed of palladium catalyst in a reaction zone wherein the palladium catalyst comprises palladium supported on a carrier; and (b) producing a hydrofluoroalkane product; characterized by: the palladium catalyst in the front of the bed having lower palladium concentration than the palladium catalyst in the back of the bed.
US10221109B2
The present invention relates to a method for producing an α-olefin low polymer through low polymerization reaction of an α-olefin in the presence of a catalyst containing a transition metal-containing compound, an aluminum-containing compound and a hydrocarbon having 2 or more carbon atoms and substituted with a halogen atom, and a solvent, which comprises a reaction step, a purification step and a circulation step of circulating the unreacted raw material α-olefin and the solvent from the purification step to the reaction step; and in which the amount of the olefin having 2 or more carbon atoms and substituted with a halogen atom that is supplied from the circulation step to the reaction step is within a range of from 0.1 to less than 200 (molar ratio) relative to the amount of the transition metal in the reaction step.
US10221108B2
An improved solvent system for the formulation and application of N-alkyl thiophosphoric triamide urease inhibitors. These formulations provide safety and performance benefits relative to existing alternatives and enable storage, transport and subsequent coating or blending with urea based or organic based fertilizers. These formulations are comprised primarily of environmentally friendly aprotic and protic solvents (particularly dimethyl sulfoxide and alcohols/polyols) to stabilize the urease inhibitor.
US10221106B2
A process for the manufacture of a urea-sulphur fertiliser composition, the process comprising providing feeds comprising elemental sulphur, urea, and optionally a surfactant, such as a multifunctional ionic surfactant; merging the feeds in order to obtain a combined feed; passing the combined feed through a mixing stage in order to obtain a mixed feed; and passing the mixed feed through a processing stage in order to obtain the urea-sulphur fertiliser composition. Compositions obtained by the process are also provided.
US10221103B2
Disclosed are a composite particle and a method of manufacturing the same. The composite particle may have an appropriate level of particle diameter and may maintain a stable shape and internal porous structure when the composite particle is applied during a coating process at high temperature.
US10221099B2
Dry mortar mixture characterized by a glass mixture of expanded glass beads with a grain size d/D 0/8, mixed in a ratio of between 1:1 and 1:3, for example 1:2 with a dust poor or dust free binding mixture of hydraulic binders and stone granules in the weight ratio of 1:2 to 1:4. The glass has a discontinuous grain distribution. For the glass mixture the fractions 0.5/1.0 and 2.0/4.0 are present while the fractions 0.25/0.5 and 1.0/2.0 are absent. For the glass mixture preferably all grain sizes between 1.0 and 2.0 mm are absent and the grain size distribution is around an average, so that an open structure is obtained.
US10221095B2
A variety of methods and compositions are disclosed, including, in one embodiment, a method of cementing in a subterranean formation, comprising: providing a set-delayed cement composition comprising water, pumice, hydrated lime, and a set retarder; activating the set-delayed cement composition; introducing the set-delayed cement composition into a subterranean formation; and allowing the set-delayed cement composition to set in the subterranean formation.
US10221094B1
A method of providing highly reactive hydrated lime and the resultant lime hydrate where an initial lime feed comprising calcium and impurities is first ground to a particle-size distribution with relatively coarse particles. Smaller particles are then removed from this ground lime and the smaller particles are hydrated, allowed to mature in a damp state, and flash dried to form a hydrated lime, which is then milled to a significantly smaller particle size than that of the relatively coarse particles.
US10221093B2
A substrate is coated on one face with a thin-film multilayer including at least one metal functional film based on silver or made of silver having a thickness e of between 7 nm and 20 nm inclusive of these values, and two antireflection coatings. The antireflection coatings each include at least one antireflection film. The functional film is placed between the two antireflection coatings. The multilayer includes two discontinuous metal films each having a thickness e′ of between 0.5 nm and 5 nm inclusive of these values. A lower discontinuous metal film is located between the face and the only or first metal functional film as counted starting from the face and an upper discontinuous metal film located above the only or last metal functional film as counted starting from the face.
US10221092B2
There are provided coated articles that include two or more infrared (IR) reflecting layers (e.g., of or including NbZr, Nb, NiCr, NiCrMo, and/or a nitride thereof) sandwiched between at least dielectric layers, and/or a method of making the same. The coating may be designed so that the coated articles realize green glass side reflective coloration in combination with a low solar factor (SF) and/or a low solar heat gain coefficient (SHGC). Such coated articles may be used in the context of monolithic windows, insulating glass (IG) window units, laminated windows, and/or other suitable applications, and may optionally be heat treated (e.g., thermally tempered) in certain instances.
US10221086B2
The present disclosure provides a laser drilling method and a laser drilling system. The laser drilling method includes a hole-boundary formation step of outputting a pulse laser beam and scanning a substrate to be drilled, to form a boundary cutting groove of a preformed hole; a material-in-hole heating step of outputting a CO2 laser beam, aligning the CO2 laser beam with the preformed hole, and heating a substrate material of the preformed hole for a predetermined period of time; and a hole formation step of cooling the substrate material of the preformed hole, to deform the substrate material and enable the substrate material to fall off from the substrate to be drilled.
US10221085B2
Methods of processing molten material comprising the step (I) of flowing molten material through an interior of a conduit from a first station to a second station of a glass manufacturing apparatus and the step (II) of cooling the molten material within the interior of the conduit by passing a cooling fluid along an exterior of the conduit. The method further includes the step (III) of directing a travel path of the cooling fluid toward a vertical plane passing through the conduit. In further examples, a glass manufacturing apparatus comprises a first station, a second station, and a conduit configured to provide a travel path for molten material traveling from the first station to the second station. The glass manufacturing apparatus further comprises at least one baffle configured to direct a travel path of cooling fluid toward a vertical plane passing through the conduit.
US10221081B2
An emitter arrangement includes a UV irradiation source, a cladding tube surrounding the UV irradiation source, and a UV-C sensor. The cladding tube has an end face on an open end. The UV-C sensor has a sensitive area, wherein the UV-C sensor is in optical connection with the end face of the cladding tube, so that the sensitive area of the UV-C sensor can detect the UV irradiation emerging from the end face of the cladding tube during the operation of the UV irradiation source.
US10221075B1
A novel chemical cycle for producing and capturing ammonia using nitrogen and hydrogen sulfide containing feedstocks is presented. An example of this cycle may start with the reaction between lithium nitride and hydrogen sulfide containing materials to form both lithium sulfide containing material and ammonia, where the produced ammonia is separated and captured. Metallic lithium may then be extracted high temperatures from said lithium sulfide containing material and then may or may not be separated from the said lithium sulfide containing material and other byproducts. The said extracted metallic lithium containing material may then be reacted with nitrogen containing feedstock to form lithium nitride containing material to complete the cycle.
US10221074B2
The present disclosure is directed to a new synthetic crystalline molecular sieve material designated SSZ-111, its synthesis using N,N,N′,N′-tetramethyl-N,N′-diisobutylhexane-1,6-diammonium cations as an organic structure directing agent, and uses for SSZ-111.
US10221073B2
A novel synthetic crystalline molecular sieve designated as SSZ-108 is disclosed. SSZ-108 may be synthesized using a structure directing agent comprising one or more of 1-butyl-1-methylpyrrolidinium cations and 1-butyl-1-methylpiperidinium cations. Molecular sieve SSZ-108 may be used in catalytic and sorptive processes.
US10221070B2
A coal upgrade plant includes: a dryer 1 that dries coal; a pyrolyzer 3 that pyrolyzes the coal dried by the dryer 1; a quencher 5 that cools the coal pyrolyzed by the pyrolyzer 3; a finisher 7 that deactivates the coal cooled by the quencher 5; and cyclones 28 and 94 that collect pulverized coal generated from the coal, wherein the pulverized coal collected by the cyclones 28 and 94 is fed to an absorber fed to a scrubber 32 that treats a flue gas. Thus, the mercury generated from the coal upgrade plant can be removed.
US10221066B2
A process for manufacturing an interaction system of a microelectromechanical type for a storage medium, the interaction system provided with a supporting element and an interaction element carried by the supporting element, envisages the steps of: providing a wafer of semiconductor material having a substrate with a first type of conductivity and a top surface; forming a first interaction region having a second type of conductivity, opposite to the first type of conductivity, in a surface portion of the substrate in the proximity of the top surface; and carrying out an electrochemical etch of the substrate starting from the top surface, the etching being selective with respect to the second type of conductivity, so as to remove the surface portion of the substrate and separate the first interaction region from the substrate, thus forming the supporting element.
US10221064B2
A semiconductor device may include a first substrate, a first electrical component, a lid, a second substrate, and a second electrical component. The first substrate may include an upper surface, a lower surface, and an upper cavity in the upper surface. The first electrical component may reside in the upper cavity of the first substrate. The lid may cover the upper cavity and may include a port that permits fluid to flow between an environment external to the semiconductor device and the upper cavity. The second substrate may include the second electrical component mounted to an upper surface of the second substrate. The lower surface of the first substrate and the upper surface of the second substrate may fluidically seal the second electrical component from the upper cavity.
US10221063B2
A getter structure is provided, including a support; a first layer of getter material disposed on the support a second layer of getter material, the first layer of getter material being disposed between the support and the second layer of getter material; a first portion of material mechanically connecting a first face of the second layer of getter material to a first face of the first layer of getter material and forming at least one first space between the first faces of the first and second layers of getter material configured to allow a circulation of gas between the first faces of the first and second layers of getter material; and a first opening crossing through at least the second layer of getter material and emerging into the first space.
US10221060B2
Provided is a microvolume liquid dispensing method in which a variable capacity passage section of a liquid passage in a microvolume liquid dispenser is pressurized from the outside and shrunk in a direction that reduces the internal capacity thereof so that a liquid that is within the variable capacity passage section is pushed toward both a downstream passage section and an up stream passage section. A microvolume of the liquid is pushed toward the downstream passage section as a result of the downstream passage section having a much larger liquid passage resistance than the upstream passage section. It is thus possible to precisely drip a microvolume liquid of a picoliter order from the tip opening of a nozzle by simple control.
US10221057B1
A gripping mechanism extends from a clamping mechanism. The clamping mechanism includes a fixed handle, a pivotally connected movable handle, a releasable locking mechanism, and the upper section of two opposing L-shaped arms. The lower section of each arm extends from the clamping mechanism to connect to a pair of lugs to form the gripping mechanism. Each lug includes an elongated member and a gripping surface for gripping a valve box cover. The gripping mechanism is manipulated to pivot the arms and move the gripping surfaces into position to grip the valve box cover. Once the gripping surfaces grip the cover, the arms are locked in a fixed position relative to one another to facilitate the separation of the cover, the lifting of the cover, and the transportation of the cover from the valve box.
US10221056B2
A component moving system may include a cart, and a component support assembly coupled to the cart. The component support assembly may include a component cradle moveable in first linear translational directions, second linear translational directions that are orthogonal to the first linear translational directions, third linear translation directions that are orthogonal to the first and second linear translational directions, and first rotational directions.
US10221054B2
A vehicle lift assembly includes a base, a vehicle engagement member, an actuation assembly, and a lifting linkage assembly. The vehicle engagement member vertically actuates relative to the base member while interfacing with a vehicle in order to lift the vehicle relative to the base member. The actuation assembly drives the vehicle engagement member relative to the base member. The lifting linkage assembly connects the actuation assembly with the vehicle engagement member. The lifting linkage assembly also includes one or more longitudinally extending links, while one or more reinforcement plates are fixed to each of the longitudinally extending links, wherein each reinforcement plate is shorter than the respective link to which it is attached.
US10221049B1
The present disclosure is a lift attachment apparatus for construction and farm equipment, including a loader. In an embodiment of the disclosure, lift apparatus may include a frame including an attachment device configured to attach to a tilting plane of a loader having a forward facing loader arm, a pair of wheels connected to the frame, a first wheel of the pair of wheels located on a first side of the frame and a second wheel of the pair of wheels located on a second side of the frame, the first wheel configured to be maintained parallel to the second wheel. The lift attachment apparatus may further include a boom connected to the frame, wherein control of the boom is provided by application of force to the attachment device by the forward facing loader arm in a downward direction to create lift and rotation of the tilting plane causing rotation of an end of the boom about the first wheel and the second wheel.
US10221048B2
A crane assembly includes a main body, a boom, a hoist, a sheave, a hook assembly including a hook, a cable, and a projection. The boom extends from the main body and includes a tubular main section and a tubular extension section telescopically nested within the tubular main section. The boom has a first end pivotally coupled to the main body. The hoist is coupled to at least one of the first end of the boom and the main body. The sheave is disposed at an opposing second end of the boom opposite to the main body. The cable extends from the hoist, along the length of the boom, over the sheave, and downward to the hook assembly. The projection extends outward from the boom and toward the main body.
US10221047B2
Equipment provided with a display device, the equipment including a mechanism that includes a movable portion, an operating device that operates movement of the movable portion, a moving mechanism that moves the movable portion, the display device that makes a display about movement of the movable portion, and a drive control unit that, based on the operation by the operating device, controls operation of the moving mechanism and the display of the display device. The display device is configured to make a display about movement of the movable portion prior to start of the movement of the movable portion.
US10221045B2
The invention is an elevator car, with a door system, for with a bottom-driven elevator, where it does not play a structural role in lifting, but provides aesthetics and safety to the passengers. The elevator car comprises lightweight materials. The car comprises a frame and a door system. The door system comprises at least one elevator door and at least one pulley system. The pulley system is attached to the frame and the elevator door is attached to the pulley system, such that the elevator door rotates horizontally around the frame when the pulley system is engaged. The elevator door comprises a pliable material, such as ballistic nylon. The elevator car can have one, two, three, or four door openings, including two adjacent door openings. Finally, the system may also include at least one light curtain that transmits signals to an elevator control system.
US10221043B2
An elevator system includes an elevator car, one or more sheaves, and one or more belts operably connected to the car and interactive with the one or more sheaves for suspending and/or driving the elevator car. The one or more belts include a plurality of wires arranged into one or more cords, and a jacket substantially retaining the one or more cords. A cord ratio, between a smallest sheave diameter (D) of the one or more sheaves of the elevator system that are interactive with the belt and a largest cord diameter (dc) of the one or more cords, (D/dc) is less than about 55. A wire ratio, between the smallest sheave diameter (D) and the largest wire diameter (dw) of the plurality of wires, (D/dw) is between about 160 and about 315.
US10221038B2
A control system (48) having a motor (28) is disclosed. The control system (48) may include a converter (32) operatively connected to a power source (36), an inverter (34) operatively connected to the motor (28), and a controller (50) operatively connected to the converter (32) or inverter (34). The controller (50) may be configured to receive control command signals, receive state feedback signals, and generate duty cycle signals for upper and lower arms of each phase (40) of the motor (28) based at least in part on the control command signals and state feedback signals. The duty cycle signals may minimize neutral point current in the converter (32) or inverter (34).
US10221032B2
A banknote collecting and recycling box includes a box body including a door body having a banknote inlet, a banknote conveying passage, a conveying mechanism and a banknote stacking plate. The conveying mechanism is close to the banknote inlet and includes a driving shaft roller, a steering shaft roller in interference fit with the driving shaft roller, an outlet driving shaft roller away from the banknote inlet and in interference fit with the steering shaft roller, and a flapping vaned wheel coaxially arranged with the outlet driving shaft roller. The banknote stacking plate is supported by a spring on a bottom plate in the box body and slidable up and down, a side, facing the banknote stacking plate, of the first passage plate is provided with a guiding elastic piece, and a Y-shaped passage is formed by the guiding elastic piece and the banknote stacking plate.
US10221030B2
A sheet conveying apparatus includes first and second roller members fixed to a rotatable shaft, a first follower roller that cooperates with the first roller member to form a conveying nip, and a second follower roller that cooperates with the second roller member to form a conveying nip. The first and second roller members have outer periphery cut-away parts and the first and second follower rollers are moveably supported and can be biased to home positions. If the first roller member cut-away part faces the first follower roller, the first follower roller is biased to move toward a home position while the nip of the second roller member nips and conveys a sheet. If the second roller member cut-away part faces the second follower roller, the second follower roller is biased to move toward a home position while the nip of the first roller member nips and conveys a sheet.
US10221027B2
According to the present disclosure, a tape feeder includes a main body that is attached to a component mounter and has a tape traveling path which is a traveling path of a carrier tape; and a sprocket that is provided in the main body, causes an outer peripheral tooth to engage with a feed hole of the carrier tape, and rotates so as to perform pitch feeding of the carrier tape on the tape traveling path. The tape feeder includes a lock mechanism that has a press operation unit operated with pressing force, locks the sprocket in the main body in a state where the press operation unit is not operated, and unlocks the sprocket in a state where the press operation unit is operated.
US10221021B2
The present invention relates to an endless conveyor for transporting products, for example packaging units, along a transport path in a transport direction T, wherein the conveyor comprises: ⋅freely rotating supporting rollers (2) which extend substantially perpendicular to the transport direction, which are connected at both ends to conveyor elements (3), and which form an endless transport surface, and ⋅flights (4), connected to the conveyor at well-defined positions, which with a control are movable to and away from a carrying position above the transport surface, wherein, after such carrying position has been taken up, a product present on the transport surface is carried along in the transport direction T, wherein the flights comprise strip-shaped thresholds (41) which, from a rest position below at least the transport surface, can be moved up between the rollers to the carrying position. Suitable to carry and buffer along products over an incline and thus transport them.
US10221020B2
A transfer device (19), comprising a carrier (21) including a number of mutually spaced-apart, substantially parallel extending transfer fingers (22) that in use reach into grooves (14) between ribs (13) on a conveying surface of a grooved conveyor belt (2). Back parts (23) of the fingers form a comb shaped part (24) of a substantially planar slide-over surface (25) of the transfer device. The carrier further includes a conveyor guide track (26) that is lowered with respect to the slide over surface and that extends transversely to the fingers, and that in use is provided with a cross conveyor belt (6) movable in a conveying direction transversely to the fingers, so that a conveying surface (9) of the cross conveyor belt forms a conveying part (27) of the slide-over surface that is substantially contiguous to and flush with the comb shaped part (24). At a side opposite to the fingers the carrier further includes a hinge connection (29) extending transversely to the fingers, and being spaced apart from the fingers. Further, the carrier includes support surfaces that in is use are supported on the grooved conveyor belt.
US10221012B2
A grabber assembly has a beam assembly with a bracket. A grabber gear assembly is coupled with the bracket. The grabber gear assembly has a pair of gear mechanisms coupled with the bracket. Each gear mechanism has a shaft and a pair of thrust bearings, one at each end of the shaft. A grabber arm mounting pad is coupled with each shaft. A gear section is coupled with each shaft. The gear sections of each shaft mesh with one another to drive the grabber arm mounting pads. An actuating driver is coupled with one of the shafts to drive the grabber gear assembly and move the arms between an open and grasping position.
US10221011B2
A bear-resistant waste disposal container comprises a bin, a handle, and a lid rotatably connected to the handle. A bin collar surrounds an upper perimeter of the bin, and a lid collar surrounds an outer perimeter of the lid. A picket extends upwardly from inside the bin, through an aperture in the lid, and through an aperture in a lid frame. A carabiner or other locking device is removably insertable through an opening in the upper portion of the picket to lock the lid in a closed position.
US10221006B2
A lottery ticket dispenser array includes ticket bins, with each bin defined by a housing for receipt of a supply of interconnected lottery tickets. Each bin has an electronic drive mechanism that dispenses the lottery tickets therefrom. A slot is defined in the back side of each bin housing through which the lottery tickets are dispensed from the internal space, and a separation device is adjacent the slot. A calibration field is located relative to the slot such that the lottery tickets pass alongside the calibration filed in a travel path of the lottery tickets through the slot. An optical scanner is disposed internal to the housing at a location to read the marks in calibration field. Based on a position of a forward edge of a ticket in the calibration field, a control system determines an adjustment to a predefined length of the leading ticket to advance in a subsequent dispense cycle.
US10221002B2
A method for packing polycrystalline silicon in the form of fragments or round rods, wherein at least one film in each case is inserted into a cuboidal cardboard box matched to the dimensions of the polycrystalline silicon to be packed, the polycrystalline silicon is introduced into the at least one film, the at least one film of thickness 10 to 1000 μm subsequently being welded and enclosing the polycrystalline silicon, and this at least one film being surrounded by a further film having a reinforcing structure or by a shaping element.
US10221001B2
A bottle made of PET which can be filled with a hot, warm or cold liquid has a neck, a body and a closed bottom. The body has a peripheral groove for pressure relief capable of collapsing in a controlled manner under the bias of an externally applied vertical axial load. The structure of the groove is such that after collapsing the bottle will not be able to resume its original shape unless it is subjected to the application of another external force of sufficient strength in reverse direction with respect to the force which was applied to obtain the collapsed shape.
US10221000B2
A fold open face seal package is provided. The package may comprise a one or two-piece thermoformed blister adhered to a backing card. In the one piece embodiment upper and lower portions of the blister are connected by one or more hinges. In the two-piece embodiment the blister is cut into upper and lower pieces which are adhered to the backing card. The package may be opened by folding the backing card back along a bend line and then reclosed for later use.
US10220993B2
Durable consumable packaging systems for hot melt materials, and particularly asphalt. The packaging system can include an asphalt or asphalt composition contained within a durable consumable wrap or bag without the need for an outer protective container. The durable consumable wrap or bag comprises a woven or non-woven fiber based material, and particularly a spun-bonded olefin material, the olefin material comprising a high density polyethylene (HDPE) material. The durable consumable packaging system provides a simple, cost effective solution to a number of the problems associated with the prior art packaging containers and systems described above, while providing additional benefits to overcome the problems specific with the packaging and transport of asphalt.
US10220986B2
Container includes a base, a cover, and a pull tab. The base has a bottom, a side wall extending upwardly from the bottom, and a rim at an upper edge portion of the side wall. The cover has a closed condition and an open condition and an outer edge portion interengageable with the rim of the base when the cover is in the closed condition. The pull tab extends outwardly from at least one of the base or the cover. The pull tab having a deformable formation to be deformed when the cover is moved from the closed condition to the open condition, the pull tab remaining attached to the at least one of the base or the cover when moved from the closed condition to the open condition. Additional embodiments relate to a tamper evident feature for a container, and a method for containing product in a container.
US10220984B1
A universal container lid for covering containers of differing diameters includes a circular top section formed of a center section receiving a straw therethrough and at least one expansion fold circumferentially affixed about the center section wherein the top section terminates at an outer diameter thereof. A substantially cylindrical sidewall extends downwardly from the top section outer diameter. The universal container lid can be stretched or compressed to tightly fit onto containers of differing diameters.
US10220979B2
A container (100) includes a first side (101) defining an aperture (107), a second side (102), and a plurality of other sides (103,104,105). The first side, the second side, the plurality of other sides defining an interior volume (106) of the container. A plurality of gloves (110) is disposed within the interior volume such that one or more gloves may be drawn from the container through the aperture. A magnetic device (112) is proximately located with the second side. When the second side is proximately located with a ferrous object, the magnetic device magnetically couples the container to the ferrous object.