US09127814B2

An object of this invention is to provide a lighting device in which a predetermined distance between the LED units and the optical member can be maintained without increasing the number of the parts, and to provide a display device, and a television device including the same. The lighting device includes a chassis 21, an LED unit 30, and an optical member 22. The chassis 21 houses the LED unit 30. The LED unit 30 includes an LED package 31 and a printed circuit board 32. The LED package 31 is mounted on the LED package 31. The LED package 31 includes an LED chip sealed therein and a spacer portion 37. The optical member 22 is arranged opposite the LED package 31. The spacer portion 37 is in contact with and maintains the optical member 22 having a predetermined distance away from the LED package 31.
US09127812B2

A vessel of a heat storage and release apparatus, the vessel comprises a shell comprising a metallic material, the shell having an elongated shape with a first end region and a second end region remote from the first end region, and an internal surface defining a cavity configured to contain a heat storage and release device and to guide gas-flow; a first opening through the shell for a flow of gas at high temperature and high pressure, the first opening being located in the first end region; a second opening through the shell for a flow of gas at low temperature and high pressure, the second opening being located in the second end region; and a lining of thermally insulating material adjacent to the internal surface and only partially covering the internal surface, the lining being located at least in the first end region.
US09127802B2

The present invention provides a pipeline pig (10) comprising an elongate body (12) and annular front and rear supports (26,30) projecting radially from the body (12). Each support (26,30) has an upstream side and a downstream side, with the front support (26) including at least one first fluid passage (18) permitting fluid flow from the upstream side to the downstream side. and the rear support (30) including at least one second fluid passage (22) permitting fluid flow from the upstream side to the downstream side. The pig further comprises a launch valve (50) adapted to move from an open position to a closed position to close the at least one first fluid passage (18), and a control means adapted to control the closing of the launch valve (50). A launch trap for launching pigs into a pipeline is also provided.
US09127800B2

A duct for fluid under pressure for an air-conditioning circuit having a conduit including a male end fitting of nominal inside diameter D0 and a female end fitting connected to it in a fluid-tight manner in or in the immediate vicinity of an enlarged axial portion of inside diameter D2 of the male or the female end fitting, the female end fitting having a nominal inside diameter D0′, and a tubular noise-reducing device that is mounted inside the male end fitting and defines between an axially internal end and an axially external end of this device at least one fluid flow channel. The enlarged portion of the male or female end fitting has a length L2 such that L2≧0.6D, where D designates their common value if D0 and D0′ are equal or whichever is the lower of the values D0 and D0′ if they are not equal.
US09127798B2

A quick connector having an anti-disengagement structure includes a first body, a second body and a locking member. The locking member is connected to one end of the first body and stopped by an oil seal. The second body is connected to the first body and the locking member is fitted on the second body. A locking block of the locking member is engaged in a locking recess of the second body to complete the assembly of the first body, the second body and the locking member. Particularly, the locking recess has an anti-disengagement design to prevent any unexpected disengagement and to ensure the connection of the connector.
US09127791B2

A retractable pressure hose can be created which comprises an inlet connector, an outlet connector, an inner elastic tube, an outer cover, and a lubricant disposed to reducing chafing between the inner elastic tube and the outer cover. In such a hose, the lubricant can comprise a solid lubricant such as paraffin wax or other slippery solids, a liquid lubricant such as olive oil or other slippery liquids, or a combination of solid and/or liquid lubricants.
US09127783B2

A micro-fluidic system comprising a micro-fluidic channel, which has a wall provided with a hole, within which a closing portion of a closing element extends; when the closing portion is arranged within the micro-fluidic channel, the passage of the liquid along the channel is interrupted; by deforming the closing element by suction the closing portion may be lifted and therefore allow the passage of liquid along the micro-fluidic channel.
US09127782B2

A microfluidic valve including a microchannel, a membrane arranged so as to seal off the microchannel and equipped with resistive units, characterized in that at least one face of the membrane includes at least one groove, and in that the resistive units are arranged in the groove and are capable, when an electric control current flows through them, of expanding sufficiently under the effect of the heat produced by the flow of the electric current to cause the rupture of at least one part of the membrane.
US09127781B2

A pneumatic pinch valve having a main body, a piston supporting a plunger, and a detachable headpiece for receiving a portion of compressible tubing between the plunger and a contoured surface of the headpiece is disclosed. A first safety cap which may restrict access to the plunger when the valve is operated and a manual override handle which may open the plunger are also provided. The pneumatic pinch valve is opened by the injection of gas through an air inlet port to a pneumatic chamber. The headpiece and plunger are configured to compress a portion of flexible tubing in a manner which reduces or eliminates damage to the tubing even after repeated open/close cycles. Further, the pinch valve may be installed onto an existing process system without disruption of fluid flow. Also disclosed is a manual version of the pinch valve.
US09127779B2

A frictionless, pressure balanced proportioning valve assembly, for low power electric operated thermostatic cartridge, composed of a housing with spaced apart hot and cold water inlets and intermediate mixed water outlet, flow communicated to a spool bore with a central widened portion; a spool, guided in the spool bore, by widened end portions, is carrying a central widened disk portion, separating the spool bore into two tubular inlet chambers; two diaphragm seals disposed at both ends of the spool and housing, pressure balancing the inlet chambers; a temperature sensor, exposed to the mixed water outlet pathway, generates a signal, readable by a control circuit; a drive unit energized by a low power electric motor, driving past gear train and eccentric shaft, a bendable connecting rod, axially displacing the spool. Axial displacement of the balanced friction-free spool, proportions flow from the hot and cold water inlets to the mixed water outlet.
US09127777B2

A reversing valve (100) for a high-viscosity medium comprises a housing (10) having an inlet opening (23) and at least two outlet openings (21, 22), extending into a valve bore in which is mounted an axially displaceable valve stem (10, 10′). The valve stem comprises a groove by which the inlet opening (23) is alternatively to be connected to one of the outlet openings (21, 22). The groove has an axially extending inflow zone (12) and an axially extending outflow zone (11, 11′). The inflow and outflow zones are connected at both ends to a continuous annular channel by way of connecting channels (13, 14).
US09127774B2

In a system for optimizing natural gas production in response to real-time variations in wellbore parameters, a PLC or other wellsite intelligence technology is used to monitor liquid and gas production from the wellbore under friction-loaded conditions. Using baseline production data obtained during production tests, the PLC determines and initiates the appropriate operating mode for the wellbore to optimize a selected production criterion to suit measured wellbore parameters. The operating mode either a continuous clean-out mode, in which gas is continuously injected into the wellbore to control liquid loading, or an intermittent clean-out, in which liquid loading is regulated by intermittent gas injection. In preferred embodiments, the system uses bladder-type control valves having upstream and downstream solenoids, to control production tubing flow rate within a range between upper and lower set points.
US09127760B1

An axle assembly for a vehicle includes an axle housing assembly having a carrier housing and a differential assembly mounted in the carrier housing for rotation about a rotational axis. In an exemplary implementation, the differential assembly includes a unitary differential case, a differential gear set and a shroud member. The differential case defines an interior cavity and a window having an outer perimeter, where the window is configured to provide access to the interior cavity for assembling the gear set into the interior cavity. The shroud member is configured to be removably coupled to the differential case to cover the window and provide a radiused contour aligning with a radiused contour of the differential case thereby reducing spin losses when the differential assembly is rotating relative to the axle housing assembly.
US09127748B1

A device having at least two channels, each channel having a corresponding locking element which restricts movement of a cable, guy wire, rope, cord, or the like to one direction. Methods for using the device to splice cables, form loops, and secure a cable to and apply tension to a fixed structure, such as a telephone pole.
US09127743B2

A mold bonded chassis bushing has an outer housing and an inner member separated by a tubular gap. A body of elastomeric material is mold bonded into a first portion of the bushing such that it bridges and at least partially fills the gap. The elastomeric material does not fill or bridge the annular gap in a central area or a second portion of the bushing, such that a void is defined between the inner surface of the outer housing and the outer surface of the inner housing in the central area and second portion. A protrusion extends from the inner surface of the outer housing or the outer surface of the inner member, in the central area such that the void extends between the protrusion and the respective opposed surface. The protrusion functions as a travel limiter for the bushing without compressing the elastomeric material in the first portion.
US09127742B2

A protective tube arrangement for a piston-cylinder unit includes a substantially disk-shaped carrying cap and a protective tube which has axially projecting crenellations and free portions formed between the crenellations. First and second axially acting securing elements axially fix the protective tube to the carrying cap by positive engagement. Each of the securing elements is formed by a wrapped binding element which is wrapped around the protective tube over the crenellations and tightened between the crenellations over the free portions so that the binding element defines secant segments through the indentation of the imaginary contour of the protective tube between the crenellations in the free portions of the protective tube, which secant segments form a positively engaging arrangement for the carrying cap.
US09127738B2

A damper assembly includes an outer cylinder, an inner cylinder, a cap, a plunger, an annular piston, and a barrier. The inner cylinder is at least partially positioned within the outer cylinder. The cap is coupled to the inner cylinder, and the plunger is received within the inner cylinder. At least a portion of the annular piston and the barrier extend between the inner and outer cylinders. During operation of the damper assembly, the plunger moves relative to the inner cylinder and the annular piston moves relative to the outer cylinder.
US09127737B2

A spring wall for securement between associated end members for forming an associated gas spring assembly includes a first wall portion that extends axially along a longitudinal axis and circumferentially thereabout. The first wall portion is formed from an unreinforced elastomeric material, and the first wall portion has a first nominal stiffness value. A second wall portion extends along the longitudinal axis and circumferentially thereabout. The second wall portion is disposed in longitudinal relation to the first wall portion and has a second nominal stiffness value that is different from the first nominal stiffness value of the first wall portion such that a non-constant stiffness profile is established along a longitudinal length of the spring wall. A gas spring and a gas spring and reservoir assembly utilizing such a spring wall as well as a method of manufacturing a gas spring are also included.
US09127736B2

The present invention relates to a working device having an element movable via at least one working drive, with at least one energy recovery cylinder being provided for recovering energy from the movement of the movable element and having a chamber filled with gas. In this respect, the energy recovery cylinder has a sealing arrangement for sealing the chamber filled with gas which includes an annular space filled with oil.
US09127733B2

A friction material contains: at least one kind of a titanate compound having a shape having a plurality of convex portions; and a bio-soluble inorganic fiber. In the titanate compound, a three-dimensional shape of a particle thereof has a plurality of convex portions.
US09127729B2

A method of learning a kiss point of a first clutch of a dual clutch transmission includes controlling a rotational speed of the input shaft to be within a pre-determined range. When both the first clutch and the second clutch are determined to be disengaged from the input shaft, and the rotational speed of the input shaft is within the pre-determined range, then the first clutch is moved from a disengaged position into an engaged position. An increase in a rotational speed of a first transmission shaft, which is coupled to the first clutch, is detected. When the increase in the rotational speed of the first transmission shaft is detected, a position of the first clutch is identified. The identified position of the first clutch is saved in a memory of a transmission control module as a learned first clutch kiss point.
US09127728B2

A method is provided for the load-free opening of a separating clutch. The method includes the following steps: receiving a signal for disengaging the clutch; applying a negative torque at the separating clutch using a drive machine; applying a positive, predefined torque at the separating clutch using the drive machine; and opening the separating clutch as soon as the amount of the torque applied at the separating clutch lies within predefined limit values. In other words, a torque in the known range of the system is set via a drive-side deceleration. Then, a drive-side acceleration takes place, so that the torque is increased on the drive side, starting from the known range of the system, until it generally matches the torque on the output side. This enables a load-free opening of the clutch.
US09127725B2

An electromagnetic clutch includes a rotatable input member or pulley and a rotatable output member or shaft. A hub cover is coupled to the pulley and includes an inner facing surface located proximal an outer friction pad or clutch plate which is fixed for rotation with the output member. An armature plate is axially moveable relative to the output member and is biased toward a position of engaging the clutch plate and the hub cover for transferring a torque from the pulley to the output shaft. A self-energizing actuator converts rotary motion of the input member or pulley to linear movement of the armature plate to further engage the clutch. The actuator includes a biasing member urging relative rotation between the one of the input member and the output member and the armature plate to initially engage the armature plate and the clutch plate. An electromagnet is provided for axially translating the armature plate away from the friction plate to disengage the clutch plate from the hub cover thereby disengaging the input force from the pulley. The clutch plate is coupled to the shaft using a splined coupling which does not prevent axial movement of the clutch plate on the shaft.
US09127716B2

A cage holds a plurality of balls such that the balls are arranged at intervals in the circumferential direction. The cage is allowed to be in contact with an outer ring, and a portion of the outer ring, with which the cage is brought into contact, is only an inner periphery raceway groove. The cage is located so as to be apart from an inner ring.
US09127713B1

Embodiments of the invention relate a bearing assembly, which may be operated at least partially hydrodynamically, and includes a support ring having reduced-thickness portions configured to elastically flex for promoting hydrodynamic fluid flow between opposing bearings of the bearing apparatus incorporated in a bearing apparatus. The disclosed bearing assemblies and apparatuses may be employed in downhole motors of a subterranean drilling system or other mechanical systems.
US09127712B2

The invention provides a rolling bearing assembly device having an inner race, an outer race, at least one row of rolling elements between the inner race and the outer race, and a sleeve mounted in the bore of the inner race. An annular elastic element is mounted axially between a radial bearing flange of the sleeve and the inner race, the elastic element having an inner bore that is able to bear against an outer surface of the sleeve so as to transmit a force having a radial component in the direction of the interior of the device. The sleeve includes at least one slot extending axially towards the inner race from a lower edge of the radial bearing flange, the lower edge being disposed on the opposite side from the inner race.
US09127707B1

An improved trolling motor lift cord apparatus for assisting in the moving of a trolling motor between a lowered position and a raised position. The improved trolling motor lift cord apparatus includes a flexible, high-strength, cord-like member that engages the trolling motor locking mechanism and a handle end for the user to grasp and pull.
US09127702B2

Clamping connection (1) for mounting plate-like components (13) on rail-like supports (8), in particular solar modules comprising a bearing (2), a central supporting bar (4) which is oriented in the longitudinal direction of the clamping connection (1) and has lateral wing strips (5, 6) with bearing surfaces (10, 11) for the components (13), and an abutment (7), which is present on the lower face of said supporting bar, for mounting the bearing (2) on the support (8), and a clamping cap (3) having a longitudinal groove (9) which surrounds the upper part of the supporting bar (4), and having clamping surfaces (13, 14) which cover the bearing surfaces (10, 11) of the bearing (2), and having a holding connection (25, 28, 29) for fixing the clamping cap (3) on the bearing (2), wherein the support (8) has guide grooves with edges (34) which project inwardly into the groove, and the abutment (7) is formed in a T shape, is inserted into the guide groove by way of its transverse bar (36) and engages behind the projecting edges (34) after rotation through 90°, characterized in that the bearing (2) has a passage (24), a spring disc (31) being accommodated in the center of said passage and said spring disc surrounding a retaining pin (30), which is pushed into said spring disc and is connected to the clamping cap, in a force-fitting manner and thereby fixing the clamping cap (3) to the bearing (2).
US09127698B1

An anchoring device for a deck or dock or similar structure comprising an anchoring member, a holding plate, and a fastener. First, the fastener is threaded through the holding plate and ring assembly. Then, the holding plate and fastener is inserted through an opening in the support structure, e.g., a narrow slot between the boards on the deck or patio, and, finally, the fastener is pulled outward in relation to the anchoring member to securely affix the anchoring member and the holding plate against two opposing sides of the support structure.
US09127697B1

A hydraulic pressure control system having a variable displacement pump fluidly connected to a hydraulic motor. The pump provides flow to a first circuit upon demand. Remaining flow is provided to a second circuit. The second circuit includes a pilot controlled pressure reducing valve that adjusts the pumps outlet pressure based upon a sensed loads taken from a conduit between the pressure control valve and an active flow regulator valve.
US09127692B2

A centrifugal blower including a hollow housing and an impeller having a plurality of blades disposed in the hollow housing, wherein the impeller causes a fluid received in a fluid inlet of the hollow housing to flow in a radially outward direction to a fluid outlet of the hollow housing. A guide device for directing the flow of the fluid in the blower is disposed in the fluid inlet of the hollow housing, the guide device including a shroud configured to militate against turbulence, noise, a recirculation of flow of the fluid at the fluid inlet, and interference between the guide device and balance weights of the blower during an assembly of the blower.
US09127691B2

A radial fan assembly for use in a powered air purifying respirator includes at least an impeller, a printed circuit board and a scroll casing. The scroll casing has a first and a second scroll casing element. The second scroll casing element includes at least a portion of the printed circuit board. When the radial fan assembly is used in a powered air purifying respirators, the respirator may also include components such as a filter assembly.
US09127689B2

A bladeless fan assembly for creating an air current includes a nozzle mounted on a base. The nozzle comprises an interior passage and a mouth for receiving the air flow from the interior passage and through which the air flow is emitted from the fan assembly. The nozzle defines an opening through which air from outside the fan assembly is drawn by the air flow emitted from the mouth. The nozzle is detachable from the base, which is preferably sized to be accommodated within the opening of the nozzle for transportation.
US09127688B2

A bearing cooling structure includes a metal base seat and a plastic bearing cup. The metal base seat has a raised section and an extension section. The plastic bearing cup encloses the raised section and has an inner circumference defining a bearing hole. The extension section horizontally extends from the raised section toward a center of the plastic bearing cup. The extension section has a free end and an upper surface positioned in the bearing hole. A bearing is received in the bearing hole and disposed on the extension section. A bottom face of the bearing is in contact with the upper surface of the extension section. Accordingly, the heat of the bearing can be transferred (conducted) through the extension section to the metal base seat to be dissipated. A fan with the bearing cooling structure is also disclosed.
US09127685B2

A vacuum pump rotor suitable for use in a vacuum pump is described for a vacuum pump that comprises a regenerative pumping mechanism. The rotor has a generally disc-shaped configuration and is mounted on an axial shaft for rotation relative to a stator of a vacuum pump. The rotor has a first and second opposing surface on which a rotor formations are disposed, each rotor formation defining a portion of a pump stage formed between the pump rotor and a stator for pumping gas from an inlet to an outlet in the same radial direction along the first and second opposing surface. A conduit is provided to interconnect the portions of the pump stage and assist with pressure imbalance that might occur on opposing sides of the rotor.
US09127677B2

A compressor is provided and may include a shell assembly defining a suction pressure region and a discharge pressure region. A first scroll member may include a first discharge port and a first modulation port. A second scroll member may include a first variable volume ratio port. A capacity modulation valve assembly may be in fluid communication with the first modulation port and may be displaceable between open and closed positions to selectively provide communication between a first intermediate compression pocket and the suction pressure region via the first modulation port. A variable volume ratio valve assembly may be in fluid communication with the first variable volume ratio port. The variable volume ratio valve assembly may be displaceable between open and closed positions to selectively provide communication between a second intermediate compression pocket and the discharge pressure region via the first variable volume ratio port.
US09127671B2

An oil pump includes: an inner rotor rotatable with a drive shaft in a unified manner on a drive-rotation axis; an outer rotor which has inner teeth configured to engage with outer teeth of the inner rotor and is rotatable about a driven axis eccentric to the drive-rotation axis; and an adjustment ring for rotatably supporting the outer rotor. A guide means which allows the adjustment ring to rotate about the driven axis, while allowing the driven axis to revolve about the drive-rotation axis, is formed of: first and second arm portions provided on the adjustment ring; and first and second guide faces with which the first and second arm portions are brought into slidable contact.
US09127668B2

Apparatus for the treatment of the blood, comprising at least one pump (25, 26, 27), matchable with a corresponding portion of tube (35, 36, 37) supported by a cartridge or module (3) which is associated to the apparatus (1), characterized in that it comprises a pump capable of reducing the pressure inside the chamber defined by the association of the cartridge (3) to the apparatus (1).
US09127652B2

A driving unit that may improve characteristics in a low temperature environment while implementing downsizing, and a lens module as well as an image pickup device with such a driving unit are provided. The driving unit includes one or a plurality of polymer actuator elements, and a voltage supply section supplying a driving voltage and a heating voltage to the polymer actuator element.
US09127649B2

A state detection device according to the invention includes a strain gauge that detects a physical state of a tapered roller, and a processing portion that obtains a detection signal that is output from the strain gauge, performs processing on the detection signal, and transmits detection data obtained by performing the processing on the detection signal, to an outside. The strain gauge and the processing portion are accommodated in a through-hole formed at an axis center of the tapered roller.
US09127645B2

The invention relates to a method for controlling a wind power plant having a rotor (5) driven by wind and rotating about a horizontal or substantially horizontally aligned rotor axis (6). The rotor includes a plurality of rotor blades (1, 2, 3), each extending in the direction of a blade axis (11, 12 13) which is perpendicular or substantially perpendicular to the rotor axis and about which the respective rotor blade (1, 2, 3) is rotated, wherein the rotor (5) is rotated about a vertical or substantially vertically aligned yaw axis (8) having a yaw angle velocity (γ), whereby gyroscopic loads are generated on the rotor blades (1, 2, 3), and wherein the gyroscopic loads on the rotor blades (1, 2, 3) are reduced by rotating the rotor blades (1, 2, 3) about the blade axes (11, 12, 13) thereof depending on the yaw angle velocity (γ) or a guide variable (γc) influencing said velocity.
US09127643B2

A rotary moto actuator with a base 22, a table 21, a stator 25 and a rotor 26 of a rotary motor 31 and a first member 12 and a second member 14 of a guide mechanism 24 that have a plurality of base segments 22a, a plurality of table segments 21a, a plurality of stator segments 25a, a plurality of rotor segments 26a, a plurality of first member segments 12a and a plurality of second member segments 14, respectively, which all arranged circumferentially around a center line C. The stator segments 25a are connected to the base segments 22a, to which the first member segments 12a are connected. The rotor segments 26a are connected to the table segments 21a, to which the second member segments 14a are connected.
US09127642B2

A method for adjusting the power output of a wind turbine (10) based on component operating temperatures is disclosed. The method may generally include receiving a signal associated with an operating temperature of the wind turbine (402), determining a desired power output range of the wind turbine at the operating temperature (404), comparing a power output of the wind turbine to the desired power output range (406) and adjusting the power output when the power output is outside the desired power output range (408).
US09127635B2

A method of generating a spray by a fluid injection valve is provided. The fluid injection valve includes a valve seat (10), a valve body (8), and an orifice plate (11) having a plurality of orifices (12). The flows in the orifices and the flows directly below the orifices are configured to be substantially liquid film flows. The directions of jet flows (30), (31) from the respective orifices (12) are not necessarily matched to the central axis directions of the orifices and are not necessarily intersected with each other at a downstream position thereof. The sprays are caused to converge by the Coanda effect acting on a plurality of sprays after jet flows from the orifices (12) become sprays at a downstream position farther than a break-up length (a). The convergence of the sprays is continued until the Coanda effect is substantially lost.
US09127625B2

An air filter for a fresh air system of an internal combustion engine may include a housing having a first housing shell and a second housing shell. An intermediate panel may be disposed therebetween separating a crude chamber from a clean chamber in the housing. The intermediate panel may have a passage opening. A filter element may be arranged in the passage opening, and the filter element may include a surrounding seal. The intermediate panel may include a surrounding seal contour on an inside edge bordering the passage opening, and the seal may rest on the seal contour. A fixing frame may be configured as a separate component with respect to the intermediate panel, the two housing shells, and the filter component. The fixing frame may encompass a side of the seal facing away from the seal contour along the filter element and be secured to the intermediate panel.
US09127618B2

A piston assembly and method of construction thereof for an internal combustion engine are provided. The assembly includes a piston head having an upper combustion wall with an undercrown surface and a ring belt region. The piston head has a floor with an upper surface and a bottom surface. The floor is spaced beneath the upper combustion wall in radial alignment with the ring belt region. A substantially enclosed, annular cooling gallery is bounded by the undercrown surface and the floor. A pair of pin bores depends directly from the floor of the cooling gallery. The assembly further includes a pin having ends configured for oscillating receipt in the pin bores. A pin bearing surface extends within the pin bores and between the pin bores in the lower surface of the floor. The assembly includes a connecting rod with an end fixed to the pin for conjoint oscillation therewith.
US09127614B2

A control system for an internal combustion engine, which is capable of directly and properly calculating the most fuel-efficient torque according to operating conditions of the engine without setting or learning in advance operating lines indicative of the most fuel-efficient torques, thereby making it possible to reduce costs and enhance fuel economy. In the control system, when the engine is operated at a predetermined reference rotational speed, a plurality of fuel consumption ratio parameters associated with a plurality of estimated torques are calculated based on a provisional intake air amount-estimated torque relationship which is the relationship between provisional intake air amounts and estimated torques to be obtained when the provisional intake air amounts of intake air are supplied. Further, an estimated torque associated with a minimum value of the fuel consumption ratio parameters is calculated as the most fuel-efficient torque at the reference rotational speed.
US09127608B2

An electronic control unit detects an index value of an amount of generated heat of fuel to be combusted in a diesel engine. The electronic control unit also executes the injection of a predetermined amount of the fuel to estimate a cetane number of the fuel and calculates an index value of output torque of the diesel engine generated with that execution. Then, the electronic control unit calculates an estimated value of the cetane number of the fuel based on the index value of the output torque and the index value of the amount of generated heat.
US09127606B2

A system for improving operation of an EGR system is presented. The system provides distinct models to estimate EGR temperature in response to a valve position. In one example, the system can judge EGR system operation when a state of a control valve is adjusted during driving conditions.
US09127605B2

A canister purge valve, fuel vapor recovery system, and method are provided. The canister purge valve may include an inlet port configured to be coupled with an inlet line to receive a fluid from a vapor-recovery canister. The canister purge valve may also include an outlet having two or more exit ports configured to be coupled with a common exit line to pass the fluid to an engine. In this way, improved mixing may be achieved without substantially increasing flow resistance and/or noise.
US09127599B2

The present invention is intended to suppress an excessive increase in the amount of emission of HC in a multi-fuel internal combustion engine of compression ignition type which is able to perform mixed combustion of a liquid fuel, which can be ignited by compression, and a gas fuel which has methane as a primary component. In the present invention, a required mixing ratio of the liquid fuel and the gas fuel as well as a required amount of HC emission is calculated based on an operating state of the multi-fuel internal combustion engine (S103, S104). Then, based on the required mixing ratio and the required amount of HC emission, a required compression ratio is calculated which is a compression ratio at which an amount of HC emission from the multi-fuel internal combustion engine becomes the required amount of HC emission (S105), and the compression ratio of the multi-fuel internal combustion engine is controlled to the required compression ratio (S107).
US09127598B2

Ambient air is compressed into a compressed ambient gas flow with a main air compressor. The compressed ambient gas flow having a compressed ambient gas flow rate is delivered to a turbine combustor and mixed with a fuel stream having a fuel stream flow rate and a portion of a recirculated low oxygen content gas flow to form a combustible mixture. The combustible mixture is burned and forms the recirculated low oxygen content gas flow that drives a turbine. A portion of the recirculated low oxygen content gas flow is recirculated from the turbine to the turbine compressor using a recirculation loop. The compressed ambient gas flow rate and the fuel stream flow rate are adjusted to achieve substantially stoichiometric combustion. An excess portion, if any, of the compressed ambient gas flow is vented. A portion of the recirculated low oxygen content gas flow is extracted using an extraction conduit.
US09127594B2

A system for compressing a cryogenic gas, particularly a hydrocarbon gas, has a compressor for compressing the gas and a line arrangement, which passes the gas to the intake side of the compressor and passes the compressed gas to a subsequent device for use. The line arrangement has a bypass and the compressed gas can be passed back to the intake side of the compressor via the bypass. An expander is disposed in the bypass, for re-cooling the gas that flows through the bypass. A method regulates a system for compressing a cryogenic gas, particularly a hydrocarbon gas that occurs during storage of a cryogenic liquid.
US09127592B2

The disclosure relates to a range extender for a hybrid vehicle configured to be driven by an electric machine. The range extender includes a generator configured to generate electrical energy, an internal combustion engine configured to drive the generator which generates a number N of generator output voltages, and an N-phase rectifier configured to rectify the number N of generator output voltages to form a rectified output voltage. The range extender further includes a direct voltage converter configured to convert the rectified output voltage of the generator.
US09127589B2

A turbo compound transmission, such as in a heavy duty or medium duty diesel engine, includes a turbo compound turbine to be driven by exhaust gases from an internal combustion engine, and a coupling including a first rotor including a mechanical input drive adapted to be driven by the turbine, and a second rotor including a mechanical output drive. A brake is arranged to brake and limit the rotation of the turbine. The coupling is arranged to decouple when braking with the brake, subjecting the coupling to a torque above a predetermined torque limit. A method for controlling a turbo compound transmission is also disclosed.
US09127587B2

A cooling system for an engine includes a coolant tank, a heat exchanger, and a drain valve. The coolant tank holds a fluid coolant and is coupled with a tank conduit through which the coolant flows from or to the coolant tank. The heat exchanger is fluidly coupled with a supply conduit. The drain valve is fluidly coupled with the coolant tank by the tank conduit and with the supply conduit. The drain valve is fluidly coupled with a drain conduit that directs the coolant out of the cooling system and alternates between a closed position and an open position. The drain valve prevents the coolant from flowing out of the cooling system through the drain conduit when in the closed position and permits the coolant to flow from the heat exchanger and out of the cooling system through the drain conduit when in the open position.
US09127585B2

A catalyst temperature estimating device that estimates the temperature of an upstream end of a catalyst for purifying exhaust gas of an internal combustion engine in an exhaust gas flow direction by executing a smoothing process for upstream end temperature estimation; the temperature of a downstream end of the catalyst in the exhaust gas flow direction by executing either a downstream end temperature estimation process using the estimated upstream end temperature with a smoothing process for downstream end temperature estimation; and calculates a smoothing coefficient for the estimated downstream end temperature used to smooth the estimated downstream end temperature based on the operation state of the internal combustion engine.
US09127575B2

A camshaft phaser is provided for varying the phase relationship between a crankshaft and a camshaft in an engine. The camshaft phaser includes a stator having lobes. A rotor is disposed within the stator includes vanes interspersed with the stator lobes to define alternating advance and retard chambers. A lock pin is provided for selective engagement with a lock pin seat for preventing relative rotation between the rotor and the stator. Pressurized oil disengages the lock pin from the seat while oil is vented for engaging the lock pin with the seat. A phase relationship control valve is coaxial with the rotor and controls the flow of oil into and out of the chambers. A lock pin control valve is coaxial with the phase relationship control valve and controls the flow of oil to and from the lock pin. The control valves are operational independent of each other.
US09127564B2

According to an aspect of the disclosure, an annular seal generally includes a hollow member having two ends and an inner surface. The hollow member has a number of depressions formed in and extending around its inner surface. Each of the depressions having a depth that is a function of its distance from one of the two ends.
US09127562B2

Rotor having of rotor blades. Every rotor blade has a blade body and coupling segment. A width of the coupling element segment is defined in circumferential direction by edges extending in axial direction. The coupling segment is contoured at a first side such that, on the flow inlet side to a flow inlet edge, the radially outer edge projects beyond the radially inner edge in axial direction. At this side on the flow outlet side of the blade body, the radially inner edge projects beyond the radially outer edge. The coupling segment is contoured at a second side such that, adjacent on the flow outlet side to the flow outlet edge, the radially outer edge extending in axial direction projects beyond the radially inner edge in axial direction. At, this second side facing away from the flow inlet edge the radially inner edge projects beyond the radially outer edge.
US09127556B2

A rotor disc, such as one made of a damage intolerant material or other material sensitive to stress concentrations, has at least one balancing assembly which includes a plurality of circumferentially spaced-apart sacrificial protrusions projecting between adjacent stress-relieving slots. Selective material removal is permitted from the rotor disc, while managing stress concentrations in the rotor disc created by such material removal, such that the rotor disc may be balanced without detrimentally affecting its service life.
US09127550B2

Voids, cracks or other similar defects in substrates of thermal barrier coated superalloy components, such as turbine blades or vanes, are filled with resin, without need to remove substrate material surrounding the void by grinding or other processes. The resin is cured at a temperature under 200° C., eliminating the need for post void-filling heat treatment. The void-filled substrate and resin are then coated with a thermal barrier coating.
US09127549B2

A turbine shroud cooling assembly for a gas turbine system includes an outer shroud component disposed within a turbine section of the gas turbine system and proximate a turbine section casing, wherein the outer shroud component includes at least one airway for ingesting an airstream. Also included is an inner shroud component disposed radially inward of, and fixedly connected to, the outer shroud component, wherein the inner shroud component includes a plurality of microchannels extending in at least one of a circumferential direction and an axial direction for cooling the inner shroud component with the airstream from the at least one airway.
US09127545B2

Described herein is a modular, adjustable system for distributing fluids to one or more wellbores. The system is readily configured and assembled at a well site, and allows for one portion of the system to be isolated for service or repair while the remainder of the system continues to operate. The system includes a plurality of pump skids having both a distribution junction in fluid communication with inlets to of plurality of pump trucks and an exit junction in fluid communication with outlets of the plurality of pump trucks.
US09127542B2

A process of treating a subterranean well comprising a plurality of flow channels and at least one of the flow channels is impaired. The treatment is used for alleviating the impairment. The process comprises a flow of gaseous carrier fluid supplied into the subterranean well. The gaseous carrier fluid pushes liquids out of the plurality of the flow channels. A liquid treatment agent is created. To create the liquid treatment agent, first, a surfactant solution is created and diluted with a solvent. The surfactant solution is created by compounding a plurality of non-ionic ethoxylated sorbitan fatty acid ester surfactants together until a proper hydrophilic-lipophilic balance is achieved. At some point, the liquid treatment agent is atomized. This atomized liquid treatment agent is blended with the gaseous carrier fluid, to create an atomized treatment fog. The atomized treatment fog is supplied into the subterranean well.
US09127535B2

A deliquification pump for deliquifying a well comprises a fluid end pump adapted to pump a fluid from a wellbore. In addition, the deliquification pump comprises a hydraulic pump adapted to drive the fluid end pump. The hydraulic pump includes a first internal pump chamber and a first pump assembly disposed in the first chamber. The first pump assembly includes a piston having a first end, a second end, and a throughbore extending between the first end and the second end. In addition, the first pump assembly includes a first wobble plate including a planar end face axially adjacent the second end of the piston and a slot extending axially through the first wobble plate. The first wobble plate is adapted to rotate about the central axis relative to the housing to axially reciprocate the piston and cyclically place the throughbore of the piston in fluid communication with the slot.
US09127532B2

Fiber optic enabled casing collar locator systems and methods include a wireline sonde or a coil tubing sonde apparatus configured to be conveyed through a casing string by a fiber optic cable. The sonde includes at least one permanent magnet producing a magnetic field that changes in response to passing a collar in the casing string, a coil that receives at least a portion of the magnetic field and provides an electrical signal in response to the changes in the magnetic field, and a light source that responds to the electrical signal to communicate light along an optical fiber to indicate passing collars.
US09127531B2

Fiber optic enabled casing collar locator systems and methods including a wireline sonde or a coil tubing sonde apparatus configured to be conveyed through a casing string by a fiber optic cable. The sonde includes at least one permanent magnet producing a magnetic field that changes in response to passing a collar in the casing string. Such magnetic field changes induce voltages changes within associated pick-up electrical coil conductors. Some embodiments include a cylinder configured to change its diameter in response to the changes in the magnetic field and/or impressed voltage, and an optical fiber wound around the cylinder to convert the cylinder diameter change into an optical path length change for light being communicated along the fiber optic cable. The cylinder may include a magnetostrictive material or a piezoelectric material.
US09127530B2

A collision avoidance system including a plurality of inclinometers in offset wellbores and a processing unit for receiving a vibration signal from the inclinometers and determining a distance between the offset wellbore and a central wellbore based on the vibration signal. Also, a method of avoiding wellbore collisions by determining relative movement of a drill bit within a central wellbore including the steps of determining an original distance between the central wellbore and an offset wellbore, drilling in the central wellbore so that the drill bit moves a known distance with respect to the offset wellbore, capturing vibration readings during the drilling step, characterizing movement of the drill bit based on the drilling step, and calculating drill bit movement during drilling with respect to the offset wellbore based upon the characterizing step.
US09127518B1

A variable angle drilling machine comprises a frame and a pipe handling system. The pipe handling system is capable of moving from a horizontal to a second orientation and comprises a magazine, a carriage assembly, a shuttle assembly, and a pipe section biasing assembly. The pipe section biasing assembly biases pipe sections towards an open side of the magazine in order for the shuttle assembly to grab a pipe section from the magazine and transport the pipe section to the carriage assembly. The carriage assembly makes up or breaks up a drill string during variable angle boring operations.
US09127514B2

Embodiments of the present disclosure are directed toward a bladder-type crimper. The crimper includes a cylindrical body comprising a cavity and a bladder assembly disposed within the cavity, wherein the bladder assembly comprises an elastic bladder and a plurality of fingers arrayed about opposite ends of the elastic bladder, wherein the cylindrical body and the bladder assembly are configured to be disposed about a tubular.
US09127511B2

An offshore universal riser system may include a valve module which selectively permits and prevents fluid flow through a flow passage extending longitudinally through a riser string. An anchoring device may releasably secure the valve module in the passage. A method of constructing a riser system may include the steps of installing the valve module in the passage, and installing at least one annular seal module in the passage. The annular seal module may prevent fluid flow through an annular space between the riser string and a tubular string positioned in the passage. Drilling methods may include injecting relatively low density fluid compositions into the annular space, and selectively varying a restriction to flow through a subsea choke in a drilling fluid return line. The riser string, including housings for the various modules and external control systems, may be dimensioned for installation through a rotary table.
US09127501B1

A lead system for a fire/smoke protection device that enables deployment/retraction of the device's flexible protection member relative to a building wall opening and improves the member's resistance to forces. The system comprises lead guides for guiding the flexible protection member between storage and protection configurations, for permitting stretching when a force is applied, and for transferring forces to the building. The guides are configured with the flexible protection member to slidably receive member loops extending about lead members. The guides and lead members are also configured to allow lead member movement and permit elastic deformation or destruction of connections between certain internal guide components, when a force is exerted on the flexible protection member. Additionally, the system comprises one or more members configured with a flexible protection member having a bar to enable bar movement during stretching of the flexible protection member responsive to a force.
US09127500B2

A cord winding device for a Venetian blind includes a receiving unit, a resilient driving unit mounted in the receiving unit, a braking unit mounted in the receiving unit and adjacent to the resilient driving unit, and a unidirectional damping unit mounted in the receiving unit. Through cooperation between the braking unit and the resilient driving unit, during winding and unwinding of pull cords, a bottom rail can be descended slowly and stopped conveniently at any desired height.
US09127487B2

A case for a viewing device with a spring-loaded slide-able bracket.
US09127485B2

A bracket encircles a conduit or lamp post and includes an opening for access to a cover attached to the conduit or lamp post and serves as a security device to prevent access to the electrical conductors behind the cover. A removable plate having a bottom edge engaged within a channel extends across the opening of the bracket. A tang extends from the bracket for penetrable engagement with a slot in the plate. An aperture in the tang extending through the plate is engageable with the shackle of a lock to preclude removal of the plate.
US09127484B2

A door latch actuator includes a cage fixedly attached to a first surface and a torque plate coupled to the cage for rotation about a spindle axis. The torque plate includes a first engagement portion. An input member is rotatable about the spindle axis between a rest position and an actuated position. The input member has an actuator axis that is normal to the spindle axis. A spindle is coupled to the input member and includes a second engagement portion that is selectively engageable with the first engagement portion. The spindle is movable between an engaged position in which the torque plate holds the spindle and the input member in the rest position, and a disengaged position in which the spindle and the input member are movable with respect to the torque plate to change the orientation of the actuator axis when the input member is in the rest position.
US09127483B2

A device for cycling a component between a first condition and a second condition includes an element and a reset apparatus connected to and driven by the element. The element is formed from a shape memory alloy, wherein the alloy is transitionable between a martensite crystallographic phase and an austenite crystallographic phase in response to a thermal energy source. The apparatus is actuatable by the element from an initial state in which the alloy has the martensite phase and the component is in the first condition, to an actuated state in which the alloy has the austenite phase and the component is in the second condition. The apparatus is resettable from the actuated state to a reset state in which the alloy transitions from the austenite to the martensite phase while the component is in the first condition, and further resettable from the reset state to the initial state.
US09127482B2

The invention relates to a door lock device for household appliances such as washing machines, clothes dryers and the like. The device comprises a slide (6) which is movable between a door lock position and a door unlock position, and which cooperates with a coupling tooth arranged on the door in order to hold the door locked when the household appliance is in operation. The device is fitted with a thermoactuator (4) that drives the slide (6) by imparting thereto a translational motion between a door lock position and a door unlock position.
US09127481B2

A mechanical barrier recipient verification system including a combination lock assembly having a housing carrying a combination lock mechanism. The housing forms an aperture. The lock mechanism selectively receives and captures a post inserted through the aperture. Further the lock mechanism is configured to provide combination unset and set states; unlocked and locked positions; and correctly and incorrectly entered code arrangements. Following insertion of the post into the aperture and with the lock mechanism in the locked position, the post is retained by the lock mechanism regardless of the correctly or incorrectly entered code arrangement.
US09127470B2

A unit module compartment structure includes: a first unit module compartment, including a first partition board having connection means at one end, and a second partition board having connection means at two ends thereof, respectively, the connection means of the first partition board and the connection means at one end of the second partition board being connected so as to form a first angle less than 90°; and a second unit module compartment, including a third partition board having connection means at one end, and a fourth partition board having connection means at two ends thereof, respectively, wherein the connection means at one end of the third partition board, the connection means at one end of the fourth partition board and the connection means at another end of the second partition board are connected so as to form a second angle identical with the first angle.
US09127468B2

A building is provided in which safety, comfort, and economic efficiency are improved by an enclosed structure and by shielding from an exterior. The building has a foundation 3, a wall 8 standing around the foundation 3 so as to be integrated with the foundation 3, a housing section 2 serving as an interior space arranged in a center of the foundation 3, a roof 30 covering an internal space surrounded by the wall 8, the roof 30 being supported by the wall 8 and not structurally combined with the housing section 2, and seismic isolation mechanisms 40 for suppressing vibration of the housing section 2 upon generation of earthquake. An interior of the building is formed as an enclosed space defined by the foundation 3, the wall 8, and the roof 30.
US09127467B2

An improved lath is disclosed having a water drainage layer provided in association with the lath. The water drainage layer serves to remove water that might otherwise build up between the lath and wall structure.
US09127466B2

An installation method and tool facilitate the installation of decking members onto an elongated fastening track in an integrated fastening track systems. The installation tool comprises a base having a distal portion and a proximal portion. Imparting a striking force to the rear face of the base distal portion urges the front surface of the base proximal portion laterally into contact with fastening tangs integral with and extending upwardly from the fastening track, thereby engaging the fastening tangs to secure a decking member with longitudinal side edge slots to the fastening track.
US09127465B1

A universal crosshead structure having a first member and a second member. The crosshead structure may be reconfigured from a first length to a second length to fit a variety of applications. Each one of the first and second members may include a severable portion. The crosshead structure may include a trim and a head piece disjointed among the first and second members.
US09127456B2

The outer rail retains two lateral screw webs of an intermediate rail to construct a base for wall plate covering. Two retention devices are disposed oppositely on respective inner sides of each retention web for retaining a respective screw web of the intermediate rail. Each retention device including an abutment part, which extends inwards from the inner side of the retention web such as to form an abutment surface for the respective screw web when the latter is positioned to be retained in the retention device, and extends from the abutment part into a locking part, which extends at an angle to the abutment part and at a distance from the respective retention web. Each locking part comprising a first resilient locking pin adapted to lock a first screw web configuration and a second, separate resilient locking pin adapted to lock a second screw web configuration, the first and second screw web configurations being pre-defined and different from each other. Hereby, different screw web configurations can be attached to the same retention web.
US09127454B2

The present application is directed toward fire-rated wall construction components and wall systems for use in building construction. Embodiments can include tracks for holding studs which incorporate various geometries capable of receiving fire-retardant material, flat straps for use between tracks and fluted wall components, fire sponges for use in fluted wall components, and tracks with protruding grooves or other structures which prevent unwanted air movement between a wallboard component and the track.
US09127442B1

An excavating machine, representatively a tracked excavator, has a boom stick portion on which an excavating bucket and a gripper assembly mounted. A hydraulic breaker is protectively mounted inside the breaker assembly and extends outward therefrom. The bucket may be operated independently of the gripper assembly for digging operations. The gripper assembly may be positioned independently of the bucket and the breaker actuated for refusal material-breaking operations. The bucket and the gripper may be cooperatively operated to perform removal operations. The same excavating machine can be used for digging, gripping, and breaking operations without a tool change.
US09127439B2

A first target engine speed is set in response to a command value commanded by a command unit. A second target engine speed equal to or lower than the first target engine speed is set based on the first target engine speed. When the first target engine speed is reduced, the second target engine speed is set to be constant or be decreased and a reduction range for decreasing the first target engine speed to the second target engine speed is set to be decreased. The reduction range is set at zero when the first target engine speed is equal to or lower than an engine speed at least at a maximum torque point.
US09127435B2

A power shovel including a tool for lifting, a machine house, a hoist drum, hoist drum machinery and an auxiliary weight box having a perimeter, the hoist drum and hoist drum machinery being at least partially disposed within the perimeter of the auxiliary weight box and the hoist drum being disposed outside of the machine house.
US09127433B2

A method for sealing piles in foundations in the construction field, wherein a hollow-body formwork element is used. The method includes: 1) applying a barrier layer to the foundation; 2) introducing a pile into the foundation, the pile being arranged so as to penetrate the barrier layer; 3) applying a hollow-body formwork element along the central longitudinal axis of the pile, the hollow-body formwork element surrounding the pile; 4) introducing mineral binding agents into the intermediate space between the pile and the hollow-body formwork element; 5) connecting the barrier layer and the hollow-body formwork element. The hollow-body formwork element has on the side facing the pile a contact layer, which includes a composite layer of a porous material and/or a sealant. The hollow-body formwork element can remain as a part of the structure and thus can perform a sealing function.
US09127432B2

A complex electrokinetic decontamination equipment is disclosed, which removes a radionuclide from contaminated soil with a high efficiency, using a combination of a washing decontamination method performed in an electrokinetic unit using electrolyte and an electrokinetic decontamination method performed by the electrokinetic unit. pH values in an anode chamber and a cathode chamber are optimally controlled by a pH control unit, thereby reducing quantity and size of metal oxide particles. In addition, a water level of the electrolyte in the electrokinetic unit may be automatically controlled by an electrolyte supply controller.
US09127431B2

A manhole security cover includes a manhole cover body comprising a non-metallic RF signal transmissive material. The manhole cover body is seatable on a manhole frame to cover a manhole opening. In the seated position, the first side is accessible from outside the manhole, the second side is disposed within the manhole, and the peripheral edge portion engages a manhole cover support surface on the manhole frame. A manhole cover tamper sensor is responsive to a predetermined movement of the manhole security cover body. A transmitter is operatively connected to the manhole cover tamper sensor and configured to generate a radio frequency manhole cover tamper signal when the manhole cover tamper sensor detects the predetermined movement of the manhole security cover body. An antenna is operatively coupled to the transmitter to radiate radio frequency energy through the manhole cover body to a receiver located outside of said manhole.
US09127427B1

The present disclosure relates to systems and methods for recovering mature fine tailings (MFT) from oil sands tailings ponds. Some examples include a hollow, fully enclosed around its perimeter, ideally of cylindrical form, open bottom structure (a hollow conduit), of predetermined geometry, which is placed at the pond surface. The hollow conduit can penetrate MFT deposits to or below a level at which MFT of required density is located. A width or diameter of the hollow conduit can be determined with respect to the MFT inflow velocity and the corresponding shear rate, so as to enable MFT flow into the hollow conduit at a rate matching a rate at which the MFT is removed from the pond (e.g., a recovery rate). An MFT fill level inside the hollow conduit can be kept constant and equal to a required fill level throughout MFT recovery operations. MFT can enter the hollow conduit during MFT recovery operations solely under action of hydraulic head pressure. MFT can be transferred from within the hollow conduit utilizing a mechanical device such as a pump or a siphon, for transfer to shore based facilities and further processing.
US09127425B2

An auger may have a spiral blade that extends radially outwardly from a shaft and that has resiliently-deformable material at the radial outer edge that physically contacts the inner surface of the tube in which the auger is positioned. When the auger is not rotated, the physical contact of the resiliently-deformable material on the inner surface of the tube may prevent granular material from flowing through the opening in the tube.
US09127422B2

A bollard apparatus for use as a fixed vehicle barrier including a bollard member having a base end and a foundation assembly adapted for fixed ground engagement. The foundation assembly comprises a housing part dimensioned and arranged for retaining the base end of the bollard member together with cementing material for cementing the bollard member to the foundation assembly within the housing part. The inclination of the bollard member relative to the foundation assembly is adjustable while the cementing material is not set (e.g. cured or hardened or rigid) and is fixed upon the cementing material becoming set thereby to cement the inclination of the bollard member relative to the foundation assembly.
US09127415B1

A form is provided for positioning an anchor in a castable material, such as concrete, having a core element defining a volume for creating a recess in the castable material, an anchor having one end positioned inside the core element for engaging a security device, such as a cable or chain, and the anchor having another end extending outside the core element, for fixing the anchor in the castable material, and an elongated drain forming member extending from the bottom of the core element to the ground, for creating a passageway for transporting water that collects in the recess.
US09127410B2

Elastic pad with a concrete element on which rails of a railway rest, whereby the elastic pad includes a fixing mat and an elastic mat, the fixing mat being provided with standing filaments that are at least partially embedded in the concrete element.
US09127409B2

In the rail, 95% or more of a structure in a head surface section, which is a range from surfaces of head corner sections and a head top section of the rail as a starting point to a depth of 20 mm, is a pearlite or bainite structure and the structure contains 20 to 200 MnS-based sulfides formed around an Al-based oxide as a nucleus and having a grain size in a range of 1 μm to 10 μm per square millimeter of an area to be inspected on a horizontal cross section of the rail.
US09127395B2

A washing machine is disclosed. A washing machine includes a tub holding wash water, a drum rotatable within the tub to hold laundry, a first cabinet defining a first space to wash laundry together with the tub and the drum, a second cabinet defining a second space for an additional function, the second cabinet formed as one body with the first cabinet, and a single partition provided between the first and second cabinets to partition off the second space from the first space.
US09127394B2

A laundry treating appliance having a tub a defining an interior, a wash basket within the interior and having a bottom from which extends a peripheral wall to at least partially define a laundry treating chamber, a clothes mover located within the laundry treating chamber in an overlying relationship to at least a portion of the bottom of the wash basket, and rotatable about an axis of rotation, and a foreign object trap located in the portion of the wash basket defines a foreign object passageway for retaining foreign objects, the foreign object trap having at least one outlet opening with a first portion that is not at a right angle to the axis of rotation.
US09127392B2

Example methods for determining an over-sudsing condition during a wash cycle of operation in a laundry treating appliance containing a foamable liquid are disclosed. An example method includes rotating within a tub a drum defining a treating chamber while the tub contains a foamable liquid, determining, over time, a fluctuation in a signal from a pressure sensor fluidly coupled to the tub while the drum is rotating, the signal representing an amount of water in the tub, determining an over-sudsing condition when the fluctuation satisfies a predetermined threshold, and altering a cycle of operation in response to the determination of an over-sudsing condition.
US09127391B2

An appliance has a dispensing device that is configured for self-cleaning. In one embodiment, a flow regulator is fluidly connected to the dispensing device. The flow regulator has a first state in which a washing fluid is dispensed into the dispensing device and a second state in which the washing fluid is evacuated therefrom. To facilitate cleaning, the washing fluid flows through a spray device that is configured to direct the washing fluid onto a peripheral wall of a compartment in which an additive for the dispensing device can be disposed.
US09127389B2

A method of washing fabric articles in a tunnel washer includes moving the fabric articles from the intake of the washer to the discharge of the washer through first and second sectors that are a pre-wash zone. Liquid can be counter flowed in the wash interior along a flow path that is generally opposite the direction of travel of the fabric articles. The main wash zone can be heated as an option. In the wash zone, there is a pre-rinse and/or a rinse. The fabric articles are transferred to a water extraction device that enables removal of excess water. A sour solution can be added to the fabric articles while extracting excess water.
US09127386B2

A sewing machine includes a bed, a needle plate, a needle bar, a needle bar swing mechanism, an optical detecting portion, and a control portion. The optical detecting portion is configured to optically detect a cord pressed by a presser foot, and to output data representing the cord. The control portion is configured to calculate a width of the cord based on the data output by the optical detecting portion, calculate a swing width of the needle bar based on the width of the cord, and cause the needle bar swing mechanism to swing the needle bar with the swing width.
US09127369B2

A cathodic protection system is provided for a subterranean well casing having an enclosed upper section of the well casing being substantially shielded by a cellar from an impressed-current cathodic protection circuit passing through earth media. The impressed-current cathodic protection circuit is provided to protect an unenclosed lower section of the well casing. To protect the enclosed upper section of the well casing, a supplemental cathodic protection circuit is provided. The supplemental cathodic protection circuit is a galvanic anode cathodic protection circuit comprising the enclosed upper section of the well casing and one or more bracelet galvanic anodes being circumferentially mounted to the enclosed upper section. The enclosed upper section of the well casing and the one or more bracelet galvanic anodes are substantially surrounded by a cellar backfill, and the galvanic anode cathodic protection circuit is equally effective throughout a broad range of non-homogeneity within the cellar backfill.
US09127368B2

An etchant includes, based on a total amount of the etchant, from about 0.5 to about 20 wt % of a persulfate, from about 0.01 to about 2 wt % of a fluorine compound, from about 1 to about 10 wt % of an inorganic acid, from about 0.5 to about 5 wt % of an azole compound, from about 0.1 to about 5 wt % of an electron-donating compound, from about 0.1 to about 5 wt % of a chlorine compound, from about 0.05 to about 3 wt % of a copper salt, from about 0.1 to about 10 wt % of an organic acid or an organic acid salt, and a remaining amount of water.
US09127367B2

A precoated metal sheet excellent in conductivity and corrosion resistance and able to be inexpensively produced is provided. The present invention is a conductive, corrosion resistant precoated metal sheet comprising a metal sheet on at least one surface of which is formed a coating film (α) which contains an organic resin (A) and non-oxide ceramic particles (B) with a 25° C. electrical resistivity of 0.1×10−6 to 185×10−6 Ωcm selected from borides, carbides, nitrides, and silicides, a volume ratio of the organic resin (A) and the non-oxide ceramic particles (B) in the coating film (a) at 25° C. being 90:10 to 99.9:0.1, the organic resin (A) including a derivative (A2) of a resin (A1) which includes at least one type of functional group selected from a carboxyl group and sulfonic acid group in a structure of the resin (A1).
US09127361B2

A method of and a multiple zone pressure controller system for controlling the pressure of a gas or vapor flowing to at least two zones of a process tool such as a vacuum deposition chamber. The system comprises: at least two channels configured and arranged so as to provide the flow of the gas or vapor to corresponding zones of the process tool, each channel including a pressure controller configured and arranged to control the pressure of gas or vapor in each channel, a leakby orifice or nozzle configured to provide a leak rate of gas or vapor from the channel; and a controller configured and arrange to determine the true flow information to each zone of the process tool so that the true leak rate in the chamber can be determined.
US09127356B2

A sputtering target is provided that includes a planar backing plate and a target material formed over the planar backing plate and including an uneven sputtering surface including thick portions and thin portions and configured in conjunction with a sputtering apparatus such as a magnetron sputtering tool with a fixed magnet arrangement. The uneven surface is designed in conjunction with the magnetic fields that will be produced by the magnet arrangement such that the thicker target portions are positioned at locations where target erosion occurs at a high rate. Also provided is the magnetron sputtering system and a method for utilizing the target with uneven sputtering surface such that the thickness across the target to become more uniform in time as the target is used.
US09127354B2

Vacuum deposition apparatus including cathodic arc source for application of coatings on the substrate. Cathodic arc source comprises focusing magnetic source for generating magnetic field, arc cathode containing film forming material and anode. The focusing magnetic source is placed between arc cathode and substrate. Arc spot generated on the cathode evaporation surface is kept by the magnetic field lines in the place where the magnetic field lines are perpendicular to the cathode surface.
US09127347B2

A magnetron sputtering coating device includes a deposition chamber, sputtering cathodes, a rotating stand within the deposition chamber, a support platform on the rotating stand, a first rotation system for driving the rotating stand to rotate around a central axis of the rotating stand, and a baffle fixed on the rotating stand. The sputtering cathodes are arranged around and perpendicular to the rotating stand.
US09127346B2

This invention provides sputtering target materials having high reflectance and excellent heat resistance, which are formed of Ag base alloys formed by adding a specific, minor amount of P to Ag and alloying them.
US09127331B2

Provided is a method for producing an oxide and/or hydroxide wherein the ratio of oxide and hydroxide has been controlled. The method produces an oxide, a hydroxide, or a mixture thereof, and obtains an oxide and/or a hydroxide wherein the ratio of oxide and hydroxide has been controlled by means of changing a specific condition relating to at least one fluid to be processed introduced between processing surfaces (1, 2) when causing the precipitation of the oxide, hydroxide, or mixture thereof by mixing an basic fluid containing at least one type of basic substance and a fluid containing at least one type of metal or metallic substance as the fluids to be processed between the processing surfaces (1, 2) that are provided facing each other, are able to approach to and separate from each other, and of which at least one rotates relative to the other. The specific condition is at least one condition selected from the group consisting of: the speed of introduction of at least one of the fluids to be processed; and the pH of at least one of the fluids to be processed.
US09127327B2

An environmentally friendly flux for molten steel desulfurization includes CaO and Al2O3 so that [CaO]/[Al2O3] is within a range of 1.6 to 3.0, and includes one or more alkali metal oxides of Na2O, K2O, and Li2O, and SiO2 so that [SiO2]/[R2O] is within a range of 0.1 to 3, [R2O] is within a range of 0.5 mass % to 5 mass %, and [SiO2] is within a range of 0.05 mass % to 15 mass % in a case in which the [CaO], the [Al2O3], the [SiO2], and the [R2O] represent the mass % of CaO, the mass % of Al2O3, the mass % of SiO2, and the total amount of the mass % of Na2O, the mass % of K2O, and the mass % of Li2O respectively.
US09127321B2

The present invention provides methods and kits that may be used to detect and quantify the presence of Coccidioides species. The methods include quantification PCR assays, and the kits and compositions include oligonucleotides used as primers and probes.
US09127314B2

The invention provides a nucleotide or nucleoside having a base attached to a detectable label via a cleavable linker, characterized in that the cleavable linker contains a moiety selected from the group comprising: Formula (I) (wherein X is selected from the group comprising O, S, NH, and NQ wherein Q is a C1-10 substituted or unsubstituted alkyl group, Y is selected from the group comprising O, S, NH, and N(allyl), T is hydrogen or a C1-10 substituted or unsubstituted alkyl group and * indicates where the moiety is connected to the remainder of the nucleotide or nucleoside).
US09127311B2

The present invention relates to compositions and methods that allow the manipulation of the catalytic activity of multi-component nucleic acid complexes. Further, the invention provides methods which use these compositions and methods to create molecular sensors, molecular switches, and/or modulators or propagators of autocatalytic self-replicating cascades and other iterative processes. More particularly, the invention relates to compositions allowing self-assembly of active and inactive multicomponent nucleic acid complexes, methods of making such compositions, and methods for use.
US09127305B2

Methods for performing a direct enzymatic reaction involving a nucleic acid molecule include performing the enzymatic reaction directly using a biological specimen in a reaction mixture containing a zwitterionic buffer and/or a non-reducing carbohydrate to prevent the biological specimen from inhibiting the enzymatic reaction, in which a nucleic acid molecule present in the biological specimen is not purified before the enzymatic reaction, and obtaining a product from the enzymatic reaction.
US09127297B2

A metabolically enhanced cyanobacterial cell for the production of ethanol is provided. The metabolically enhanced cyanobacterial cell for the production of ethanol comprises at least one recombinant gene encoding a pyruvate decarboxylase enzyme (Pdc) converting pyruvate to acetaldehyde, and at least one recombinant gene encoding a first Zn2+ dependent alcohol dehydrogenase enzyme (Adh) converting acetaldehyde to ethanol. The invention also provides a method for producing the metabolically enhanced cyanobacterium, a method for producing ethanol with the metabolically enhanced cyanobacterium, and a method for screening of alcohol dehydrogenase enzyme expressing cyanobacterial strains for the presence of NADPH-dependent native alcohol dehydrogenase enzymes.
US09127295B2

The invention is directed to a method for producing metal oxide nanoparticles, the method comprising: (i) subjecting a combination of reaction components to conditions conducive to microbial-mediated formation of metal oxide nanoparticles, wherein said combination of reaction components comprise: metal-reducing microbes, a culture medium suitable for sustaining said metal-reducing microbes, an effective concentration of one or more surfactants, a reducible metal oxide component containing one or more reducible metal species, and one or more electron donors that provide donatable electrons to said metal-reducing microbes during consumption of the electron donor by said metal-reducing microbes; and (ii) isolating said metal oxide nanoparticles, which contain a reduced form of said reducible metal oxide component. The invention is also directed to metal oxide nanoparticle compositions produced by the inventive method.
US09127274B2

The invention relates to iRNA, e.g., double-stranded ribonucleic acid (dsRNA), compositions targeting the Serpinc1 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of Serpinc1 and methods of treating subjects having a bleeding disorder, such as a hemophilia.
US09127272B2

Compounds, compositions and methods are provided for modulating the levels expression, processing and function of miRNAs. The compositions comprise oligomeric compounds targeted to small non-coding RNAs and miRNAs. The oligomeric compounds possess potent miRNA inhibitory activity, and further exhibit improved therapeutic index. Further provided are methods for selectively modulating miRNA activing in a cell.
US09127271B2

The present invention is a method of generating a library of expressed cDNA sequences using multi-targeted primers that are complementary to degenerate motifs present in a large proportion of corresponding mRNA sequences. Multi-targeting priming (MTP) for genome-wide gene expression assays provides selective targeting of multiple sequences and counter-selection against undesirable sequences. Priming with MTPs in addition to oligo-dT can result in higher sensitivity, a greater number of genes whose expression is well measured, a greater number of genes whose differences in gene expression are detected to be statistically, and a greater power to detect meager differences in expression.
US09127270B2

This invention provides a cell pattern recovery tool comprising a base material layer having a surface subjected to easy adhesion treatment, a temperature responsive polymer layer that is provided on the base material layer and has a surface subjected to silane treatment, and a cell adhesion inhibiting material layer provided on the temperature responsive polymer layer. According to the present invention, a cell pattern can be rapidly recovered while maintaining the cell pattern stably and reliably under minimally invasive conditions for the cells.
US09127269B2

The present invention is directed to a mutant thermostable ligase having substantially higher fidelity than either T4 ligase or Thermus thermophilus ligase. The ligase of the present invention is a mutant of a wild-type thermostable ligase having a histidine adjacent a KXDG motif, where the mutant thermostable ligase has a mutation in its amino sequence where the histidine adjacent the KXDG motif in the wild-type thermostable ligase is replaced with an arginine, and wherein X is any amino acid. The DNA molecule encoding this enzyme as well as expression systems and host cells containing it are also disclosed. The thermostable ligase of the present invention is useful in carrying out a ligase detection reaction process and a ligase chain reaction process.
US09127267B2

In one aspect, the invention relates to a peptide that forms a calcium-dependent hydrogel using a rationally engineered beta roll peptide. In the absence of calcium, the peptide is intrinsically disordered. Upon addition of calcium, the peptide forms a corkscrew-like structure. In one embodiment, one face of the beta roll is mutated to comprise leucine residues. In some embodiments, a leucine zipper forming helical domain to the engineered beta roll forms hydrogels by physical cross-linking in calcium rich environments.
US09127260B2

The invention relates to a synthetic phytase with elevated thermostability, elevated stability to acids at p H 2, elevated stability to pepsin and with a broadened active p H range, and to an isolated nucleic acid sequence coding for a synthetic phytase and to the use of the phytase in an animal feed for reducing the phosphate content in the slurry and to animal feed additives and animal feeds comprising the synthetic phytase.
US09127252B2

The invention provides a quiescent stem cell having the capacity to differentiate into ectoderm, mesoderm and endoderm, and which does not express cell surface markers including MHC class I, MHC class II, CD44, CD45, CD13, CD34, CD49c, CD73, CD105 and CD90. The invention further provides a proliferative stem cell, which expresses genes including Oct-4, Nanog, Sox2, GDF3, P16INK4, BMI, Notch, HDAC4, TERT, Rex-1 and TWIST but does not express cell surface markers including MHC class I, MHC class II, CD44, CD45, CD13, CD34, CD49c, CD73, CD105 and CD90. The cells of the invention can be isolated from adult mammals, have embryonic cell characteristics, and can form embryoid bodies. Methods for obtaining the stem cells, as well as methods of treating diseases and the differentiated stem cells, are also provided.
US09127251B2

The invention provides a method for influencing the stability of an antibody producing cell, comprising directly or indirectly influencing the amount of BCL6 and/or Blimp 1 expression product within said antibody producing cell. Stable antibody producing cells and cell lines are also provided, as well as methods for producing antibodies using such cells and/or cell lines.
US09127248B2

The present invention relates in part to methods for producing tissue-specific cells from patient samples, and to tissue-specific cells produced using these methods. Methods for reprogramming cells using RNA are disclosed. Therapeutics comprising cells produced using these methods are also disclosed.
US09127245B2

A method of arranging a large number of living bodies, such as cells, embryos, or organisms rapidly, individually, and one by one, a holding sheet for the method, and a device for processing the living bodies. The method of holding living bodies includes using a sheet in which multiple through-holes with a size capable of holding one of the target living bodies, but not capable of holding two or more of the living bodies, are provided, to thereby arrange and hold the living bodies one by one in the multiple through-holes in the sheet together with a liquid.
US09127243B2

The invention provides a stirring apparatus for stirring microorganisms such as, an alga in a culturing medium. The stirring apparatus includes one or more supporting structures. The stirring apparatus further includes a plurality of paddle units operatively connected to the one or more supporting structures. The plurality of paddle units are submerged in the culturing medium holding the microorganisms. Further, the plurality of paddle units are configured to rotate for stirring the microorganisms in the culturing medium. In response to the rotation of the plurality of paddle units, the stirring apparatus propels in the culturing medium.
US09127234B2

A particulate coke composition including expandable coke is capable of removing deposits from rotating parts of a gas turbine engine while under full fire or idle speed. The coke composition may be introduced directly into the combustion chamber (combustor) of the gas turbine or, alternatively, anywhere in the fuel stream, water washing system, or the combustion air system. By kinetic impact with the deposits on blades and vanes, the deposits will be dislodged and will thereby restore the gas turbine to rated power output. If introduced into the compressor section, the coke particles impinge on those metal surfaces, cleaning them prior to entering the hot gas section where the process is repeated.
US09127231B2

The lubricating composition of this invention is primarily comprised of an admixture of an API Group V base oil component and a polyolefin base oil component. In general, the blend components include at least 45 wt. % of a Group V base oil component having a kinematic viscosity of less than 20 cSt at 100° C., and from 10 wt. % to 60 wt. % of a polyolefin base oil component having a kinematic viscosity of at least 500 cSt and not greater than 4000 cSt at 100° C. The lubricating composition has improved efficiency and lower operating temperatures, comparable to polyalkylene glycol-based lubricant level, which provides improved machine life and seal life, relative to other lubricating compositions.
US09127228B2

There is provided a process for operating a coal-fired furnace to generate heat. The process has the steps of a) providing the coal to the furnace and b) combusting the coal in the presence of a first slag-reducing ingredient and a second slag-reducing ingredient in amounts effective to reduce slag formation in the furnace. In one embodiment, the first slag-reducing ingredient is one or more oxygenated magnesium compounds and the second slag-reducing ingredient is selected from the group consisting of one or more oxygenated calcium compounds, one or more oxygenated silicon compounds, and combinations thereof. In another embodiment, the first slag-reducing ingredient is one or more oxygenated silicon compounds, and wherein the second slag-reducing ingredient is one or more oxygenated aluminum compounds. There are also provided methods for reducing slag formation in a coal-fired furnace. There are also provided methods for treating coal. There are also treated coals.
US09127226B2

Haze may be removed from a biofuel or biofuel intermediate by using a clarifier. The clarifier includes copolymer prepared using a formulation comprising an alpha olefin and maleic anhydride. The clarifier may also be used with admixtures of biofuels, biofuel intermediates, or biofuel feedstocks with conventional hydrocarbons.
US09127220B2

A system for the production of synthesis gas, the system including a mixing apparatus configured for combining steam with at least one carbonaceous material to produce a reformer feedstock; and a reformer comprising a cylindrical vessel containing a plurality of coiled tubes, wherein each of the plurality of coiled tubes has a vertical height in the range of from about 40 feet 12.2 m) to about 100 feet (30.5 m) and a coil length that is at least four times the vertical height; at least one burner configured to combust a fuel and provide heat to maintain the reformer at a reformer temperature; at least one outlet for reformer product comprising synthesis gas; and at least one outlet for flue gas produced via combustion of fuel in the burners. A suitable mixing apparatus is also provided.
US09127213B2

Disclosed herein is a method involving the steps of: (a) precipitating an amount of polyaromatic compounds from a liquid sample of a first hydrocarbon-containing feedstock having solvated polyaromatic compounds therein with one or more first solvents in a column; (b) determining one or more solubility characteristics of the precipitated polyaromatic compounds; (c) analyzing the one or more solubility characteristics of the precipitated polyaromatic compounds; and (d) correlating a measurement of catalyst activity performance for the first hydrocarbon-containing feedstock sample with a mathematical parameter derived from the results of analyzing the one or more solubility characteristics of the precipitated polyaromatic compounds to predict catalyst performance of a catalyst in a refinery operation of the hydrocarbon-containing feedstock.
US09127209B2

Two or three strippers are used to strip three hydroprocessed effluent streams, perhaps from a slurry hydrocracking reactor, separated by temperature instead of a single stripper to preserve separations previously made and conserving energy and reducing vessel size. A cold stripped stream may be taken as a diesel blending stock without further fractionation.
US09127208B2

The present invention is related to a thermal extract of a plant material and methods of extraction thereof. The method of producing a thermal extract from a plant starting material by means of a thermal extraction of the starting material wherein the improvement consists in requiring smaller amounts of costly and/or toxic organic solvents for the extraction and partitioning steps.
US09127202B1

Methods and systems biomedical application of up conversion nanoparticles. Co-doped cerium oxide nanoparticles were synthesized by precipitation technique. Up conversion nano cerias are biocompatible as a biomarker with antioxidant properties. Up conversion nano cerias interact in a cell specific manner showing catalase mimetic activity. With suitable surface targeting ligands, up conversion nano cerias can be used for site selective drug delivery for the treatment of diseases like cancer.
US09127200B2

The instant invention relates to liquid crystalline media comprising a chiral component, component A, consisting of one or more chiral compounds, optionally, a bimesogenic component, component B, consisting of one or more bimesogenic compounds, a liquid crystalline component, component C, consisting of one or more liquid crystalline, respectively mesogenic compounds, and a reactive mesogenic component, component D, comprising, one or more reactive mesogenic compounds, as defined in claim 1, to their stabilization by polymerization and to the polymer-stabilized liquid crystal materials, as well as to liquid crystal displays comprising these liquid crystal media, respectively these stabilized materials, especially to USH-displays and in particular to active matrix displays and, last not least, to the processes of preparation of the respective composite systems and of the displays comprising these systems.
US09127196B2

The invention provides a tin phosphate glass containing embedded luminescent material particles, wherein the luminescent material particles comprise luminescent material from the class of CaAlSiN 3:Eu 2+ and optionally other luminescent material particles. The invention further provides a method for the production of such glass as well as a lighting unit using such glass as (part of) a light conversion unit.
US09127186B2

A film sealant useful for tightly sealing an electric device at a low temperature and a sealing method of using the sealant are provided. The device is covered and sealed by covering at least a region of the device with a film sealant containing a copolyamide-series resin, heat-melting the sealant, and cooling the sealant. The copolyamide-series resin may have a melting point or softening point of 75 to 160° C. and may be a crystalline resin. The copolyamide-series resin may be a multiple copolymer or may contain a unit derived from a long-chain component having a C8-16alkylene group (e.g., a C9-17lactam and an aminoC9-17alkanecarboxylic acid). The film sealant may cover one side of the device.
US09127182B2

A polymer dispersion comprising one or more proton-conducting polymer materials in a liquid medium, and an electrocatalyst ink comprising one or more electrocatalyst materials and one or more proton-conducting polymer materials in a liquid medium are disclosed. The polymer dispersion and the electrocatalyst ink further comprise a protic acid. Electrocatalyst layers, gas diffusion electrodes, catalyzed membranes and membrane electrode assemblies prepared using the dispersion and/or the ink are also disclosed.
US09127170B2

An object of the invention is to provide a plating pretreatment solution that can convert the surface of an aluminum substrate for hard disk devices into a surface suitable for electroless nickel plating, and a method for producing an aluminum substrate for hard disk devices using the same. The plating pretreatment solution of the present invention used for a plating pretreatment in production of an aluminum substrate for hard disk devices has an iron ion concentration of 0.1 g/l to 1.0 g/l and a nitric acid concentration of 2.0 wt % to 12.0 wt %. This plating pretreatment solution is used for a pretreatment of a plating step in which electroless nickel plating is applied to an aluminum substrate for hard disk devices. Accordingly, the surface of the aluminum substrate for hard disk devices is converted into a surface suitable for electroless Ni plating, and a smooth surface of a plated film is obtained by suppressing generation of waviness, nodules, and pits on the plated surface when electroless nickel plating is performed in the plating step.
US09127168B2

The present invention relates to a magnetic particle-containing water dispersion wherein the magnetic particles have a primary particle diameter of 5 to 15 nm and an average secondary particle diameter of 10 to 60 nm, and the water dispersion has a zeta potential of not more than −20 mV when a pH value of the water dispersion lies within the range of 6 to 8, and further a surface of the respective magnetic particles is coated with a carboxyl group-containing polymer. The magnetic particle-containing water dispersion is produced by heating an aqueous solution in which the carboxyl group-containing polymer is dissolved, to a temperature of 90 to 100° C. in a nitrogen atmosphere; adding a solution of a ferrous (II) salt and a ferric (III) salt and an alkali solution to the aqueous solution to react with each other at the same temperature; adding ethanol to the solution to obtain a precipitate; and removing a supernatant liquid from the solution, and then dispersing the precipitate in water and subjecting the resulting dispersion to dialysis. The magnetic particle-containing water dispersion is useful as a magnetic particle-containing water dispersion capable of producing magnetic particle-containing drugs for diagnosis and therapies which can exhibit a uniform functionality, with a good reproducibility.
US09127163B2

Aqueous binder composition comprising an organic emulsifiable polyisocyanate, an aromatic polyester polyol and a alkali metal salt of a carboxylic acid as trimerisation catalyst and its use for bonding mineral fibre or lignocellulosic material.
US09127160B2

The present invention relates to a process for the work-up of polymer solutions comprising N-methyl-2-pyrrolidone and a polymer where the polymer solution is hydrogenated with hydrogen in the presence of a hydrogenation catalyst.The present invention also relates to the product obtainable from said process, and to its use for producing, in particular, polyarylene ether products.
US09127158B1

In accordance with some embodiments of the present invention, a composite material is prepared by blending a bio-derived filler into a polymer, wherein the filler includes a diene-modified cellulosic nanomaterial (e.g., cellulose nanocrystals (CNCs) and/or cellulose nanofibrils (CNFs) functionalized to contain a diene) and a dienophile-modified cellulosic nanomaterial (e.g., CNCs and/or CNFs functionalized to contain a dienophile). The modulus of the composite material is reversibly controllable by adjusting a degree of crosslinking between the diene-modified cellulosic nanomaterial and the dienophile-modified cellulosic nanomaterial. This degree of crosslinking is thermally reversible. On one hand, the degree of crosslinking may be increased via a Diels-Alder (DA) cycloaddition reaction at a first temperature, thereby increasing the modulus of the composite material. On the other hand, the degree of crosslinking may be decreased via a retro-DA reaction at a second temperature higher than the first temperature, thereby decreasing the modulus of the composite material.
US09127156B2

In one embodiment, A flame-retardant thermoplastic starch material, including (A1) 100 parts by weight of starch; (A2) 5 to 75 parts by weight of plasticizer; and (A3) 5 to 30 parts by weight of organic phosphonate flame-retardant, wherein the organic phosphonate flame-retardant has the following formula (I): wherein X is a trivalent aliphatic hydrocarbon radical containing 3 to 12 carbon atoms; R1 and R2 are independently C1 to C8 alkyl; and n is 0 or 1.
US09127155B2

Phosphorus free polycarbonate compositions having flame retardant properties and a desirable balance of flow, impact resistance, and heat deflection properties are disclosed.
US09127153B2

The present invention relates to molding and overmolding compositions for delicate components. More particularly the invention relates to compositions for low pressure molding and overmolding, making these compositions particularly well suited for electronic devices. The molding and overmolding composition is suitable for low pressure injection molding processes, particularly at 0.5 to 200 bars at 70° C. to 240° C.
US09127152B2

A method for making a thermoplastic material includes: (a) introducing into an extruder an elastomer composition including an ethylenically unsaturated elastomer polymer, a first free radical initiator, and a second free radical initiator; (b) in a first zone of the extruder, heating and partially crosslinking the elastomer composition at a first crosslinking temperature to form a thermoplastic, partially crosslinked elastomer composition; (c) introducing into the extruder in a second zone downstream of the first zone a thermoplastic polymer composition; (d) mixing and heating the thermoplastic polymer composition and the thermoplastic, partially crosslinked elastomer composition to a second crosslinking temperature higher than the first crosslinking temperature, wherein the thermoplastic polymer composition is liquid at the second crosslinking temperature; and (e) mixing and further crosslinking the elastomer composition to form a thermoplastic material having a dispersed phase of the crosslinked elastomer composition in the thermoplastic polymer composition.
US09127149B2

A refrigerator interior liner can be made of a composition including a monovinylaromatic polymer matrix having an average molecular weight in weight Mwabove 150,000 g/mol; rubber particles; and low- Mwplasticizers. The rubber particles can have an RPS volume of about 8.5 μm, a monomodal distribution, a swell index above 13.8, and an RPVF of at least 39%. The composition can be prepared by forming a polymerizable mixture including a monovinylaromatic monomer, and dissolving a viscous rubber in the polymerizable mixture. A free radical initiator and a chain transfer agent can be contacted with the polymerizable mixture at conditions whereby phase inversion subsequently occurs. The chain transfer agent can produce an increase of the rubber to PS phase viscosity ratio within the inversion reactor. Polymerization can be continued until a monovinylaromatic polymer matrix having rubber particles dispersed therein is obtained.
US09127135B2

Expanded composite polystyrene-based resin particles having a plurality of cells and cell membranes separating the plurality of cells, said cell membranes including a polystyrene-based resin forming a continuous phase and polyacrylic acid alkyl ester-based resin fine particles dispersed in said continuous phase to form a dispersed phase, and said polystyrene-based resin being complexed with said polyacrylic acid alkyl ester-based resin fine particles, wherein said dispersed phase is present in the form of a plurality of layers in a cell membrane thickness direction in a cell membrane cross-section of said expanded composite polystyrene-based resin particles.
US09127134B2

A method for curing a resin includes the steps of placing the resin into a reaction vessel, drawing a vacuum in the reaction vessel, positioning the reaction vessel in a gaseous coupling fluid, and applying ultrasonic energy to the coupling fluid.
US09127130B2

The present invention relates generally to branched macromolecules and their use as imaging or contrast agents. In particular, the invention relates to dendrimers, derived from lysine or lysine analogs, bearing a plurality of functional moieties and their application to imaging techniques in which a disease state may be imaged with a targeted contrast agent.
US09127124B2

The present invention is directed to linear, biodegradable polyesteramide (PEA) polymers synthesized with repeating units derived from aminophenol esters and diacids. These PEAs have a monomer repeat represented by as well as a variety of uses to coat, form or comprise medical devices, combination medical devices and pharmaceutical compositions, including sustained release formulations.
US09127122B2

There is provided an article comprising a copolyester containing residues of neopentyl glycol, 2,2,4,4-tetraalkyl 1,3-cyclobutanediol such as 2,2,4,4-tetramethyl 1,3-cyclobutanediol, tin atoms, aluminum atoms, an alkali or alkaline earth metal atoms such as lithium atoms, optionally phosphorus atoms, and having an It.V. of at least 0.55 dL/g, and Tg of at least 90° C. Such higher It.V. copolyesters can now be made having high Tg, good thermal stability, and higher insertion of 2,2,4,4-tetraalkyl 1,3-cyclobutanediol.
US09127112B2

The present invention provides a hydrogenated block copolymer which has an excellent balance in a transparency, optical property, flexibility, mechanical property, moldability, heat resistance, gas barrier property, low moisture absorbency and non-adsorptive property of chemical. Also, the present invention has an object to provide a resin composition containing the hydrogenated block copolymer as a resin component, and a film and container containing the composition. The present invention relates to a hydrogenated block copolymer containing a Block A of a hydrogenated vinyl aromatic polymer and a Block B of a polymer containing isobutylene.
US09127111B2

Provided is a process for the production of a fluorine-containing block copolymer, which suppresses the formation of a homopolymer as a by-product and which, regardless of whether the chain transfer constant of the iodine end is large or small, achieves nearly 100% conversion into a block copolymer. The process is characterized by reacting (A) a fluorine-containing polymer which has an iodine atom or a bromine atom at either or both terminals of the backbone chain and/or at a side-chain terminal with (M) a radical-polymerizable monomer in the presence of (C) a sulfur compound represented by general formula (2): (Y1)nH2-nS2O4 (wherein Y1 is a mono- or di-valent metal ion or an ammonium ion; and n is an integer of 0 to 2).
US09127103B2

The present invention relates to a polymerizable liquid crystal compound, a liquid crystal composition including the same, and an optically anisotropic body. The polymerizable liquid crystal compound according to the present invention has not only large solubility in various solvents but also high birefringence and excellent coating orientation, and thus it can provide an optically anisotropic body which is thin but superior in optical properties.
US09127099B2

Provided are a polymer having low cytotoxicity and capable of imparting surface hydrophilicity and biocompatibility to medical device surfaces by simple processing, a method for producing the polymer, and a surface treatment agent for medical devices. The polymer of the present invention has a particular ratio of structural units represented by the formulae (1a) and (1b), and a particular weight average molecular weight, and is useful as a surface treatment agent for various medical devices.
US09127096B2

A method for controlling the physical state of an ultra-high molecular weight polymer to make the ultra-high molecular weight polymer suitable for further processing, and related polymers compositions methods and systems, wherein the method comprises combining a catalyst, monomers, and an additive, for a time and under condition to allow synthesis of a nascent polymer and co-crystallization of the nascent polymer with the additive.
US09127095B2

Catalyst component comprising Mg, Ti, and halogen atoms, and is characterized in that (a) the Ti atoms are present in an amount higher than 4% based on the total weight of the said catalyst component, (b) the amount of Mg and Ti atoms is such that the Mg/Ti molar ratio is higher than 2 and (c) by a X-ray diffraction spectrum, in which, in the range of 2θ diffraction angles between 47° and 52°, at least two diffraction lines are present at diffraction angles 2θ of 48.3±0.2°, and 50.0±0.2°, the most intense diffraction lines being the one at 2θ of 50.0±0.2°, the intensity of the other diffraction line being equal to or lower than the intensity of the most intense diffraction line.
US09127094B2

Olefin polymerization is carried out with a supported phosphinimine catalyst which has been treated with a long chain substituted amine compound.
US09127093B2

Graft polymers whose grafting base is selected from the group consisting of polymers having vinylamine units, polyamines, polyamidoamines and polymers of ethylenically unsaturated acids and which comprise exclusively oligoalkylenimine side chains as side chains, process for the preparation of graft polymers having oligoalkylenimine side chains, at least one oligoalkylenimine which comprises a terminal aziridine group being grafted onto one of said grafting bases, and the use of the graft polymers thus obtainable as process chemicals in the production of paper, as antimicrobial coating materials, as builders in detergents and for the treatment of metal surfaces.
US09127089B2

Highly-purified soluble thrombomodulin which has a content of host cell-originated proteins being in a ratio of less than 10 ng of the proteins per 10,000 U of the soluble thrombomodulin, wherein the soluble thrombomodulin is produced by a transformant cell obtained by transfecting a host cell with a DNA containing a nucleotide sequence encoding the soluble thrombomodulin.
US09127081B2

Fusion polypeptides comprising a TRAIL trimer and a targeting domain are disclosed. The targeting domain can be, in some embodiments, a sequence that binds MUC16, which is prevalent on some tumor cells such as pancreatic and ovarian tumor cells. A sequence that binds MUC 16 can be mesothelin or a MUC16-binding fragment thereof, such as amino acids 1-64 of mesothelin. A fusion polypeptide of the present teachings can induce apoptosis in a target cell such as a MUC16-expressing cancer cell. Also disclosed are nucleic acids encoding the fusion polypeptides, and methods of use of the fusion polypeptides and nucleic acids.
US09127079B2

Described herein are isolated polypeptides having phosphatase and tensin homolog (PTEN) inhibitory activity, vectors and cells for the expression thereof and methods for their use in treating diseases associated with cytotoxic stress, such as spinal cord injury, stroke, traumatic brain injury, multiple sclerosis, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, and Huntington's disease.
US09127057B2

The present disclosure provides an isolated or recombinant IL-23-binding protein comprising an antigen binding domain of an antibody, wherein the antigen binding domain specifically binds to IL-23 but does not significantly bind to an IL-12p40 subunit and does not significantly bind to an IL-23p19 subunit when they are not components of IL-23. The present disclosure also provides uses of the IL-23-binding protein.
US09127055B2

Anti-human NGF antibodies are useful for treating pain.
US09127053B2

This invention relates generally to the generation of antibodies, e.g., monoclonal antibodies including fully human monoclonal antibodies, that recognize Jagged 1 and/or Jagged 2, to antibodies, e.g., monoclonal antibodies including fully human antibodies that recognize Jagged 1 and/or Jagged 2, and nucleic acid molecules that encode antibodies, e.g., nucleic acid molecules that encode monoclonal antibodies including fully human cross-reactive antibodies that recognize both Jagged 1 and Jagged 2, and to methods of making the anti-Jagged antibodies and methods of using the anti-Jagged antibodies as therapeutics, prophylactics, and diagnostics. The invention also relates generally to activatable antibodies that include a masking moiety (MM), a cleavable moiety (CM), and an antibody (AB) that specifically bind to Jagged 1 and Jagged 2, and to methods of making and using these activatable anti-Jagged antibodies in a variety of therapeutic, diagnostic and prophylactic indications.
US09127052B2

The present invention relates to monoclonal antibodies that are capable of specifically binding to lectin-like transcript 1 (LLT1), to polynucleotides encoding such antibodies and to cells that express such antibodies. Antibodies of the invention have utility in the treatment of autoimmune diseases and cancer, in which LLT1-and CD161-expressing cells play a role in disease pathogenesis.
US09127050B2

A number of β-hemolytic streptococci polynucleotides and polypeptides, particularly Streptococcus pyogenes polypeptides and polynucleotides, are described. Two or more of the polypeptides of the invention can be formulated for use as immunogenic compositions. Also disclosed are methods for immunizing against and reducing infection caused by β-hemolytic streptococci.
US09127042B2

Methods are disclosed for use of apatite chromatography, particularly without reliance upon phosphate gradients, for purification or separation of at least one intact non-aggregated antibody, or at least one immunoreactive antibody fragment, from an impure preparation. Integration of such methods into multi-step procedures with other fractionation methods are additionally disclosed.
US09127037B2

New crystalline forms of 17β-(3-Furyl)-5-βandrostane-3β,14β,17α-triol are described together with pharmaceutical composition containing the same and methods for their preparation. In particular new Forms B, C, D, E and H are here described.
US09127029B2

The present invention relates to fosamprenavir calcium (Ia) substantially free of isomer impurity, (3R) tetrahydro-3-furanyl(1S,2R)-3-[[(4-aminophenyl)sulfonyl](isobutyl)amino]-1-benzyl-2-(phosphonooxy)propyl carbamate (Ib), and its process for preparation thereof. The present invention also provides fosamprenavir calcium intermediate, (S)-3-tetrahydrofuranyl-N-succinimidyl carbonate (IIa) substantially free of (R)-3-tetrahydrofuranylsuccinimidyl carbonate (IIb) and its process for preparation thereof.
US09127020B2

The invention relates to compounds of general formula IIIa and their use in optoelectronic components.
US09127015B2

Compounds which are tricyclopyrazole derivatives or pharmaceutically acceptable salts thereof, their preparation process and pharmaceutical compositions comprising them are disclosed; these compounds are useful in the treatment of diseases caused by and/or associated with an altered protein kinase activity such as cancer, viral infection, prevention of AIDS development in HIV-infected individuals, cell proliferative disorders, autoimmune and neurodegenerative disorders; also disclosed is a process under Solid Phase Synthesis conditions for preparing the compounds of the invention and chemical libraries comprising a plurality of them.
US09127008B2

Processes for reducing the amount of impurities, especially α,β-unsaturated ketones (ABUK), in materials containing morphine. Novel compounds, namely low ABUK morphine sulfate methanolic solvate, and a novel crystal form are also described. The method for making morphine sulfate methanolic solvate comprises mixing a morphine free base composition with methanol to form a solution and adding a liquid comprising sulfuric acid to the solution to form a morphine sulfate methanolic solvate precipitate. A method of making a morphine sulfate compound comprises drying the morphine sulfate methanolic solvate in the presence of water vapor, such that methanol molecules are removed and replaced with water vapor molecules. A composition for treating pain comprises the morphine sulfate compound and at least one pharmaceutically acceptable excipient. A method for treating pain comprises administering to a patient in need thereof the composition comprising the morphine sulfate compound and at least one pharmaceutically acceptable excipient.
US09127006B2

Provided are modulators of TLRs of Formula II: pharmaceutically acceptable salts thereof, compositions containing such compounds, and therapeutic methods that include the administration of such compounds.
US09126996B2

The present invention relates to a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein the symbols are as defined in the specification; a pharmaceutical composition comprising the same; and a method for treating or preventing autoimmunity disease using the same.
US09126991B2

Disclosed are compounds of Formula 1a, wherein HX represents HBr, phosphoric acid, sulfuric acid, methanesulfonic acid or ethanesulfonic acid, and polymorphs thereof.
US09126988B2

There is disclosed a methylated intermediate which may be demethylated to provide an inhibitor of catechol-O-methyltransferase useful in the treatment of Parkinson's disease. Also disclosed are methods of making and using said intermediate.
US09126986B2

Inhibitors of HCV replication of formula I, including stereochemically isomeric forms, and salts, hydrates, solvates thereof, wherein R and R′ have the meaning as defined herein. The present invention also relates to processes for preparing said compounds, pharmaceutical compositions containing them and their use, alone or in combination with other HCV inhibitors, in HCV therapy.
US09126984B2

The present invention embodiments relate to compound of Formula I or pharmaceutically acceptable enantiomers, salts or solvates thereof. The invention further relates in certain embodiments to the use of the compounds of Formula I as TDO2 inhibitors. The invention also relates in certain embodiments to the use of the compounds of Formula I for the treatment and/or prevention of cancer, neurodegenerative disorders such as Parkinson's disease, Alzheimer's disease and Huntington's disease, chronic viral infections such as HCV and HIV, depression, and obesity. The invention also relates in certain embodiments to a process for manufacturing compounds of Formula I.
US09126983B2

The present invention relates to novel compounds of formulae (I) and (II) and pharmaceutically acceptable salts thereof that are useful in the treatment and/or prevention of human and animal bacterial infections and associated diseases and conditions; compositions containing such compounds; derivation of such compounds by fermentation and isolation, partial synthesis and total synthesis; methods of inhibiting bacterial growth; methods of treating, preventing or controlling bacterial infection; biologically pure cultures of bacterial strains from which such compounds may be produced; and processes for preparing compositions containing such compounds.
US09126981B2

Alpha-helix mimetic structures and compounds represented by the formula (I) wherein the general formula and the definition of each symbol are as defined in the specification, a compound relating thereto, and methods relating thereto, are disclosed. Applications of these compounds in the treatment of medical conditions, e.g., cancer diseases, fibrotic diseases, and pharmaceutical compositions comprising the mimetics are further disclosed.
US09126980B2

The present invention relates to compounds of formula (I) in which R1, R2, R3 and R4 are as defined in the Summary of the Invention. Compounds of formula I are capable of disrupting the BCL-2 interations with proteins containing a BH3 domain. Disrupting this interaction can restore the anti-apoptotic function of BCL-2 in cancer cells and tumor tissue expressing BCL-2. The invention further provides a process for the preparation of compounds of the invention, pharmaceutical preparations comprising such compounds and methods of using such compounds in the treatment of cancerous diseases.
US09126974B2

The present application provides processes for making pesticidal compounds and compounds useful both as pesticides and in the making of pesticidal compounds.
US09126969B2

The disclosure relates to compounds of formula (I): wherein R1, R2, R3, R4, and R5 are as defined in the disclosure, to the compositions containing them and to the use thereof as medicaments, in particular as anticancer agents. The disclosure also relates to the process for preparing the compounds of formula (I) and to reaction intermediates.
US09126957B2

The invention is directed to compounds for selectively inhibiting glycosidases, uses of the compounds and pharmaceutical compositions including the compounds, and methods of treating diseases and disorders related to deficiency or overexpression of O-GlcNAcase, and/or accumulation or deficiency of O-GlcNAc.
US09126955B2

The invention relates to compounds of the formula (I) which are inhibitors of activated thrombin-activable fibrinolysis inhibitor. The compounds of the formula I are suitable for producing medicaments for prophylaxis, secondary prevention and treatment of one or more disorders associated with thromboses, embolisms, hypercoaguability or fibrotic changes.
US09126944B2

The present invention provides compounds of Formula (I): or stereoisomers, tautomers, or pharmaceutically acceptable salts thereof, wherein all the variables are as defined herein. These compounds are selective ROCK inhibitors. This invention also relates to pharmaceutical compositions comprising these compounds and methods of treating cardiovascular, smooth muscle, oncologic, neuropathologic, autoimmune, fibrotic, and/or inflammatory disorders using the same.
US09126938B2

This invention relates to compounds of Formulas I, II, and III, and their use as inhibitors of phosphatidylcholine transfer protein (PC-TP). The invention further relates to pharmaceutical compositions and methods of treatment of disorders related to the inhibition of PC-TP using the compounds of Formulas I, II, and III. Such disorders include obesity and disorders associated with obesity.
US09126932B2

The present invention relates to certain substituted 1,2,3,4-tetrahydrocyclopenta[b]indol-3-yl)acetic acid derivatives of Formula (Ia) and pharmaceutically acceptable salts thereof, which exhibit useful pharmacological properties, for example, as agonists of the S1P1 receptor. Also provided by the present invention are pharmaceutical compositions containing compounds of the invention, and methods of using the compounds and compositions of the invention in the treatment of S1P1 receptor-associated disorders, for example, psoriasis, rheumatoid arthritis, Crohn's disease, transplant rejection, multiple sclerosis, systemic lupus erythematosus, ulcerative colitis, type I diabetes, acne, microbial infections or diseases and viral infections or diseases.
US09126925B1

Disclosed herein are compounds of formula (I): wherein n, R1, and R2 are defined herein. Methods of oligomerizing/polymerizing the compounds of formula (I) and methods of making the compounds of formula (I) are also disclosed.
US09126921B1

The present invention includes a nutritional supplement composition that may be used for livestock and the like, as well as to a livestock feed mixture containing same. Also included are methods of preparing the nutritional supplement composition, the livestock feed mixture, as well as methods of providing nutrition to livestock and the like. The livestock feed composition comprises: (a) a solid particulate livestock feed material and (b) a solidified particulate mixture of (i) free fatty acid and (ii) a calcium salt of a fatty acid, the calcium salt of a fatty acid being present in a molar ratio amount in the range of from about 25% to about 55% of the amount of the free fatty acid. The preferred mixture is a solid having an onset melt point of between about 140 and 170 degrees Fahrenheit, and a hardness of from about 5 to about 15 Shore A units at 170 degrees Fahrenheit.
US09126915B2

The invention discloses a method for preparation of 2-(2,3-dimethylphenyl)-1-proponal from bromo 2,3-dimethyl-benzene and aceton, its use in perfumes and its use for the preparation of medetomidine.
US09126909B2

We have now discovered a novel process for the removal or extraction of metal species from a variety of solid, liquid or gas phase materials. Metal species may be removed by contacting the material suspected of containing one or more metals with a thiolated fatty acid or ester thereof for a period of time and under conditions effective for the sequestration of the metal species by the thiolated fatty acid or ester thereof. The thiolated fatty acid or ester thereof comprising sequestered metal species may then be separated and recovered from the treated material. Moreover, following the treatment of aqueous liquids or mixtures, or suspensions or dispersions of solids in aqueous liquids, the resultant thiolated fatty acid or ester thereof comprising the sequestered metal species is insoluble in water and forms a separate layer from the aqueous liquid phase, which layer may be readily removed.
US09126900B2

A process for producing a mandelonitrile compound represented by the following formula (2), comprising a step of reacting a benzaldehyde compound represented by the following formula (1) with at least one member selected from the group consisting of metal cyanides and hydrogen cyanide in the presence of a phase transfer catalyst in a solvent.
US09126898B2

The present invention relates to a process for preparing a prostaglandin derivative and an intermediate therefor. In accordance with the present invention, the prostaglandin F (PGF) derivative can be efficiently prepared with high purity by removing the protecting group of a protected prostaglandin E (PGE) derivative obtained from conjugate addition and then stereoselectively reducing the ketone group on the cyclopentanone ring of the PGE derivative.
US09126879B2

One exemplary embodiment can be a process for treating a hydrocarbon stream. The stream can include passing the hydrocarbon stream into a vessel containing a packed zone and a coalescing zone, passing an amine stream into the vessel at a location above an inlet for the hydrocarbon stream, and withdrawing the hydrocarbon stream.
US09126867B2

Disclosed are an additive for cement compositions that includes a polycarboxylic copolymer and a cement composition including the same and, more particularly, an additive for cement compositions that includes a polycarboxylic copolymer and/or a salt thereof, wherein the polycarboxylic copolymer is a copolymer of a monomer mixture including an alkoxy polyalkylene glycol mono(meth)acrylic acid ester-based monomer, a (meth)acrylic acid-based monomer, a (meth)acrylic acid ester-based monomer, and a polyoxyalkylene alkenyl ether sulfate salt and a cement composition including the same.
US09126865B2

The present invention provides a geopolymeric cement formed from a precursor having a relatively high alumina content (Si:Al atomic ratio of less than or equal to 1.3:1) to form an alkaline multiphase alumino-silicate material.The precursor comprises basaltic rock in which kaolinization is at an advanced stage, preferably Interbasaltic material found in Northern Ireland.The present invention also provides structural units for constructing a building, the structural units being manufactured using the geopolymeric cement of the invention.The invention also provides a process for producing a geopolymeric cement comprising a precursor having a relatively high alumina content (Si:Al atomic ratio of less than or equal to 1.3:1) to form an alkaline alumino-silicate geopolymer material for manufacturing geopolymeric structural building units having compressive strengths of greater than 3 N/mm2 and preferably having compressive strengths in the range of 12-25 N/mm2.
US09126863B2

Method for batch wise slaking of burnt lime in a slaker, in which a lime slurry is produced with a great degree of fineness and long sedimentation time, comprising the following steps: the regulation of the slaking temperature is carried out in either of two steps—at incoming water temperatures between 0-10° C. a predetermined amount of the finished slurry is emptied out—at incoming water temperatures between 10-20° C. a predetermined amount of flushing water or diluting water is added.
US09126861B2

A metal-coated flake glass of the present invention includes: a flake glass; a metal coating layer formed to coat a surface of the flake glass; and a silicon oxide-based protective layer formed to coat a surface of the metal coating layer. The silicon oxide-based protective layer contains nitrogen at an amount of 0.05 mass % to 0.5 mass % relative to a whole of the metal-coated flake glass.
US09126859B2

Provided is a Li2O—Al2O3—SiO2-based crystallized glass, comprising, as a composition in terms of mass %, 55 to 75% of SiO2, 20.5 to 27% of Al2O3, 2% or more of Li2O, 1.5 to 3% of TiO2, 3.8 to 5% of TiO2+ZrO2, and 0.1 to 0.5% of SnO2, and satisfying the relationships of 3.7≦Li2O+0.741MgO+0.367ZnO≦4.5 and SrO+1.847CaO≦0.5.
US09126850B1

A self-uprighting aeration device that minimizes turbulence and disruption of any sediment layer in a tank. The device includes a float positioned about a first position on a longitudinal axis of the aeration device, a ballast positioned about a second position on the longitudinal axis, and a diffuser. The float and the ballast are configured to orient the aeration device in a liquid with the longitudinal axis substantially aligned with a gravitational vector to dispose the diffuser above the sediment layer. The aeration device can be configured to rest on a support surface in the tank or float above such a support surface. Methods for aerating liquid in tanks with the aeration device are also provided.
US09126847B2

Disclosed is lithium titanate having excellent rate properties and useful for electricity storage devices, which is produced by preparing lithium titanate secondary particles that are aggregates of lithium titanate primary particles and forming at least macro-pores on the surfaces of the secondary particles. The lithium titanate can be produced by a process which comprises drying and granulating a slurry comprising crystalline titan oxide, a titanic acid compound and a lithium compound and firing the granulated product to thereby produce lithium titanate secondary particles, wherein (1) the crystalline titan oxide to be used comprises at least two types of crystalline titan oxide particles having different average particle diameters from each other, and/or (2) the crystalline titan oxide is used in an amount at least four-fold larger than that of the titanic acid compound in terms of TiO2 content by weight. The lithium titanate can achieve a satisfactory level of charge-discharge capacity for practical uses when used in a electricity storage device without requiring the use of a carbon-containing substance, such as carbon black, acethylene black or Ketjen black, as an electrically conductive material in combination, in spite of a fact that lithium titanate has an electrically insulating properties by nature.
US09126836B2

A method for manufacturing a carbon nanotube (CNT) of a predetermined length is disclosed. The method includes generating an electric field to align one or more CNTs and severing the one or more aligned CNTs at a predetermined location. The severing each of the aligned CNTs may include etching the predetermined location of the one or more aligned CNTs and applying a voltage across the one or more etched CNTs.
US09126832B2

The invention provides a method for using an ozone generating apparatus containing a power supply apparatus and ozone generating device. The apparatus can be operated by controlling the power supplied from the power supply apparatus to the ozone generating device, supplying a flow of oxygen-containing gas to the ozone generating device, and controlling the flow of the oxygen-containing gas. The power supplied to the ozone generating device and flow of oxygen to the ozone generating device can be controlled to obtain a predetermined yield of ozone and to minimize the consumption of resources of the ozone generating apparatus.
US09126825B2

An implantable biocompatible component (10) integrating an active element of the type of a sensor for the measurement of a physiologic parameter, a micro-electromechanical system and an integrated electronic circuit. This component (10) has a substrate (12) and a lid (22) in silicon or quartz. The substrate (12) integrates the active element (14) and biocompatible metallic pads (16), electrically connected to the active element. The lid (22) encompasses and peripherally closes the substrate in a hermetic manner, level with the face integrating the active element. This component is void of metallic case for insulation between the active element and outside environment, and of insulative feedthrough for electrical connection to the active element. The substrate and lid can be directly welded to each other through their faces in vis-à-vis, or by interpositioning a sealing ring made of a biocompatible material.
US09126818B2

A dispensing system includes one or more digital image capture devices for capturing images in a dispenser well and a digital image analyzer operatively coupled to the digital image capture device(s) for analyzing the images for use in regulating a dispensing operation. The digital image analyzer evaluates digital images captured by the digital image capture device(s) to determine various characteristics of a container, such as the height and position of the container.
US09126815B2

Disclosed is a beverage system having an ingredient module and an ingredient dispensing valve assembly in communication with the ingredient module via at least one ingredient conduit, in which the ingredient dispensing valve assembly includes a dispensing manifold with at least one dispensing valve having a through-hole, an insert disposed within the through-hole, and a valve disposed between the insert and the dispensing valve, with the dispensing valve having a body portion and the insert is removeably connected to the body portion. The insert can be secured to the body portion of the dispensing valve by a locking mechanism, with the locking mechanism providing for removing or securing the valve from between the body portion of the dispensing valve and the insert by hand.
US09126808B2

In an elevator control device that transfers an elevator to pause operation when predetermined pause conditions are met, the elevator operation can be changed over properly according to the call cutoff state without decreasing the building security. This control device includes a pause operation selecting means and a car call cutoff means. The pause operation selecting means stops a car at a predetermined pause floor, closes a door after door opening motion, and pauses the elevator by selecting pause operation if predetermined pause conditions are met. The car call cutoff means prohibits a car call from being registered from a car call button in the car by cutting off the car call. The configuration is made such that when the car call to the pause floor has been cut off by the car call cutoff means, even if the predetermined pause conditions are met, the elevator is not transferred to pause operation.
US09126797B2

The present invention is concerning to a sheet processing apparatus comprising: a pressing unit configured to provide additional folding to a fold line portion of a sheet bundle by pressing the fold line portion; a carriage unit configured to reciprocate the pressing unit in width directions of the sheet bundle; a guiding shaft configured to support the pressing unit and guides movement of the pressing unit; and a supporting unit configured to support the pressing unit and moves on a structure provided to the sheet processing apparatus.
US09126793B2

A sheet feed device has a tray with holding surface for holding sheets, a feed unit for feeding sheets from the tray, and a separation plate. The separation plate has an inclined surface and two or more separation portions that separate a sheet from the sheets held in the tray. At least one of the separation portions projects a first distance from the inclined surface. The separation plate also has a projection positioned on the inclined surface that projects a second distance from the inclined surface. The second distance is greater than the first distance. A first of the separation portions is positioned upstream of the particular projection in the sheet feed direction, and a second of the separation portions positioned downstream of the particular projection in the sheet feed direction.
US09126791B2

A conveyance apparatus includes a pair of registration rollers configured to convey a print medium to a printing unit of a printing machine in a conveyance direction, a motor configured to rotate the registration rollers, and a controller configured to control the motor such that after the print medium strikes the registration rollers and thereby forms a predetermined amount of slack in the print medium, the motor starts rotating the registration rollers to convey the print medium, and the motor stops rotating the registration rollers once the print medium exits the registration rollers. In stopping rotating the registration rollers, the controller is configured to drive the motor to generate torque in a reverse rotational direction opposite from a rotational direction in which the motor generates torque to convey the print medium in the conveyance direction.
US09126789B2

The present invention provides an image forming apparatus that can facilitate a replacement of a sheet feeding portion.When a detecting portion detects that a sheet feeding cassette is mounted, a controller controls a driving portion in such a manner as to lift a sheet supporting plate for the mounted sheet feeding cassette. When the detecting portion detects that a sheet feeding cassette is mounted, the controller controls a driving portion in such a manner as not to lift a sheet supporting plate for the mounted sheet feeding cassette in the case where it is determined that a sheet feeding cassette nearest a feeding roller of the mounted sheet feeding cassette is drawn or detached.
US09126785B2

The suction transport device for taking off a sheet from a sheet stack in a sheet running direction (BL) includes at least two revolving suction means (12, 14) which are mounted to be adjustable horizontally and transversally to the sheet running direction.
US09126778B2

An image forming system includes a feed section, a transport section, a transport position adjuster, and a load-position moving unit. The feed section feeds a sheet. The transport section transports the sheet fed from the feed section. The transport position adjuster adjusts a position of the sheet in an intersecting direction that intersects with a transport direction of the sheet transported by the transport section. The load-position moving unit moves the position, in the intersecting direction, of the sheet loaded in the feed section so as to reduce an adjustment amount by which the position is adjusted in the intersecting direction by the transport position adjuster if the adjustment amount is larger than a predetermined amount.
US09126774B2

A pneumatic conveying system is disclosed for conveying a granular product, such as grain, from a grain inlet device to a selected one of a plurality of grain bins or other storage vessels. The system includes a blower for forcing air under pressure into a conveyor piping system. A grain inlet device is located downstream from the blower. The piping system has a portion leading from the grain inlet to an inlet in a first one of the vessels. A discharge/bypass valve is connected to a portion of the piping system leading from the grain inlet so as to receive the granular product being conveyed therethrough with the valve having a discharge outlet for discharging the granular product into the vessel. The valve is installed on the vessel such that the discharge outlet is in communication with the interior of the vessel. The valve further has an inlet coupling operatively connected to the piping system and an outlet coupling operatively connected to another portion of the piping system downstream of the valve leading to another of the vessels. The valve has a sleeve movable between a discharge position in which the inlet coupling is disconnected from the outlet coupling such that the granular product is discharged from the piping system into the valve and then is discharged into the vessel and a by-pass position in which the inlet and outlet couplings are operatively connected so that the granular product is conveyed through the valve and into the piping system downstream from the valve.
US09126770B1

A device for engaging and aligning items moving along a conveyance line that are to be positioned on a pallet is provided. The device includes a robotic arm positioned adjacent the conveyance line and having a manipulator thereon. The manipulator includes a number of fingers that extend downwardly from the manipulator in order to engage the items on the conveyance line. The fingers operate to stop and align the items to form a well-defined stack in the shape defined by the position of the fingers on the manipulator. The manipulator can rotate while the fingers are in engagement with the stack of items in order to reposition the items as desired for placement on the pallet by sliding the items along the various surfaces of the system and without lifting the items off of the conveyance line, thereby limiting the cost and time associated with the operation of the device.
US09126766B2

Provided is a semiconductor device that suppresses the occurrence of defects due to photocorrosion. A method for manufacturing the semiconductor device includes the steps of: forming an insulating layer with a concave portion over a substrate; forming a conductive film over the insulating film and the inside of the concave portion; polishing and removing the conductive film positioned over the insulating layer; and cleaning the insulating layer in a light-shielded state. Between the step of polishing and the step of cleaning, or after the step of cleaning, the substrate SUB is moved by detecting the presence or absence of the substrate SUB in the light-shielded state using an infrared sensor.
US09126761B1

A variable guide system for shingling in-store adhesive signage cards that works with the offset moment/trajectory resulting from some shingling systems by employing multiple adjustable hold downs guides. Adjustments to the hold downs guides are made on the fly by an operator using easily accessible and controllable thumb screws. The thumb screws facilitate side to side movement and angle adjustment of each guide individually in order to prevent jamming of the cards while being shingled at the guides.
US09126759B2

A tire conveyor includes a roller portion provided at a position, in the width direction perpendicular to the conveying direction, without a conveying surface. The roller portion extends parallel to the conveying surface and is provided with a plurality of placement rollers forming a placement surface on which the tire is rotatably placed. An elevation mechanism includes a single actuator and a link mechanism connecting the roller portion or the conveyor to the actuator in a supported state and moves the placement surface of the roller portion upward and downward relative to the conveying surface by driving the actuator.
US09126758B2

An apparatus for the processing of articles (5) is disclosed. The apparatus includes guide means (1) having a body, a first end (2) for receiving articles, and a second end (3) for dispatching articles. The apparatus may be used to transfer articles (5) from a first conveyor means to a second conveyor means with a reduced likelihood of the articles colliding with other articles.
US09126746B2

Adaptors for spray cans are provided. Such adaptors may include a body which may be positioned on the neck of a can and an actuator for operating the dispenser nozzle of the spray can, and a plurality of nozzle-holders, each of which can be joined to a nozzle for dispensing to a mechanical instrument.
US09126744B2

A container for containing and/or suppressing a fire may include a floor, a roof, and at least one wall associating the floor and the roof. The at least one wall may define an opening configured to provide access to the interior of the container. The container may further include at least one panel configured to close the opening. At least one of the floor, the roof, the at least one wall, and the at least one panel may include an intumescent material substantially covering an interior surface thereof.
US09126739B2

A display box for sockets contains a body and a limiting frame. The body includes a plurality of receiving chambers arranged on a front surface thereof so as to accommodate socket tools and includes an accommodation portion defined on a back surface thereof and communicating with the plurality of receiving chambers. The limiting frame is fixed in the accommodation portion of the body by a fixing structure and includes a vertical rod, the vertical rod has a plurality of horizontal posts extending outwardly therefrom so as to insert into the socket tools.
US09126737B2

A three-dimensional torso-shaped storage device having a fabric cover in the appearance of a sports jersey being worn on a torso. A frame portion made up of an upper body piece and lower body piece provides a compartment and supports the cover. The lower body piece may be hinged to open at a base of the device to provide access to the compartment. An object retention member may be slidably attached to the frame portion to retain an object in the compartment.
US09126735B2

A reclosable pouch includes an elongated closure mechanism, at a top portion of the pouch, capable of closing an opening of the pouch. The closure mechanism includes a male closure element having a base, a stem, and an engagement end, and a female closure element that has first and second spaced legs. The male closure element is constructed and arranged to engage the legs of the female closure element in order to close the opening of the pouch. The closure mechanism further includes a plurality of normal segments and a plurality of deformed segments, such that at least one of the male and female closure elements comprises an asymmetric deformation in each of the deformed segments. The asymmetric deformation creates at feast one of a clicking feel and a clicking sound when the male closure element engages the female closure element to close the opening of the pouch.
US09126731B2

A sealed reservoir cap for attaching to a bottle includes an annular part slidably received into another annular part to define an enclosed reservoir there between that is closed off by a punchable seal.
US09126723B2

A security box system for securely housing a game camera includes a mount portion having a rear surface conforming to curvature of and secured to a tree with at least one aperture for a fastener passing therethrough, and a sleeve extending from the mount portion rear surface toward the tree. The sleeve surrounds the fastener aperture and is rotatable when contacted by a cutting implement. The cover portion has an opening for the camera to permit the photographing of game. The cover portion is securable to the mount portion to house the camera therebetween. An internal pin on the cover portion is positionable within a pin aperture on the mount portion to secure the cover portion to the mount portion and prevent removal therefrom. The pin and pin aperture are inaccessible from outside the security box system.
US09126718B2

A box for packaging, the box including an aperture for packing or unpacking the box and one or more securing panels adapted to operatively secure the aperture closed using adhesive tape. The box also includes a wall panel, wherein a flap of the wall panel is configured to hingeably open to thereby assist in removing the adhesive tape from the one or more securing panels.
US09126716B2

A carton for containing a plurality of articles. The carton includes a plurality of panels that extends at least partially around an interior of the carton. A handle extends in at least one panel of the plurality of panels. The handle can include a handle grip and at least one handle opening. The at least one handle opening can include a main portion extending adjacent the handle grip of the handle and an expanded portion that is for being generally aligned with a respective space at least partially defined by at least two adjacent articles of the plurality of articles. The expanded portion can allow access to the respective space via the at least one handle opening.
US09126713B2

Provided are a joining portion in which a male threaded portion threaded to a container-side female threaded portion is formed; a connector main unit disposed at an inner side of the joining portion, sharing a center axis therewith, and is connected so as to be rotatable relative thereto; and a siphon tube attached to the connector main unit so as to extend toward the bottom portion of the container and has a tip curved in a substantially horizontal direction, wherein the joining portion is screwed in independently of the connector main unit when attaching the connector by using a securing jig that, by being inserted from above the connector main unit, causes depressed/protruding portions to be engaged, thus preventing relative rotation to each other, and by using a tightening jig that tightens the male threaded portion by being engaged at the upper surface of the joining portion.
US09126712B2

The present disclosure relates to rigid, collapsible bottles that may be drained of their contents by gravity. The structural features of the bottle design help facilitate controlled bottle collapse.
US09126702B2

A method and apparatus are disclosed for transferring and filling a viscous material from a container into a syringe while preventing the ingress of gas into the viscous material during the process of filling the syringe with the viscous material, but without requiring a housing for holding both the container and the syringe in an air-tight manner. The method includes inserting a plunger into the container that holds the viscous material and inserting a first plug, which permits gas flow in one direction, into the syringe. Then, the container is coupled to the syringe, a rod is inserted into the syringe such that the rod engages with the first plug, and the plunger is pushed within the container, thereby extruding the viscous material from the container. As a result, the extruded viscous material is transferred into the syringe and the syringe is filled with the viscous material.
US09126693B1

Systems, methods, and devices are provided for assisted takeoff of an aerial vehicle. The aerial vehicle may takeoff using a first control scheme and switch to a second control scheme for normal flight when a takeoff threshold is met. The first control scheme optionally does not use integral control while the second control scheme may use integral control. The aerial vehicle may determine that a takeoff threshold is met, based on an output to a motor of the aerial vehicle and/or an acceleration of the aerial vehicle.
US09126681B1

A mechanism in a teetering rotor head that has an actuating shaft with a carrier, in a hollow spindle, in a hollow central tower, with teetering sidewalls and with rotor blade anchor blocks bolted between them, and with blade root anchor bolts that turn with the blades, connected by 4 short straight levers and 2 sliding plates that work together to turn the bolts and twist the blades, changing the pitch.
US09126678B2

A rotor system for tilt rotor aircraft comprises an engine disposed at a first fixed location on a wing member; a prop-rotor pylon mechanically coupled to the engine along a drive path, and a gearbox disposed in the drive path. The prop-rotor pylon is rotatably mounted on a spindle, and the prop-rotor pylon is configured to selectively rotate about a rotational axis of the spindle between a vertical position and a horizontal position. The gearbox comprises a rotational axis aligned with the rotational axis of the spindle.
US09126674B2

A beam (20) comprising first and second flanges (23, 24), the beam (20) having a first region (28, 30) extending between the flanges (23, 24) and a second region (26) extending between the flanges. The first region (28, 30) is designed to support an applied concentrated shear load and the second region (26) is designed to support a predominantly bending load. The first region comprises a fan-shaped truss comprising a hub (36) adjacent the first flange and a plurality of struts (37) which extend substantially radially from the hub (36), and the second region (26) comprises either a truss structure which is substantially regular in the longitudinal beam direction or a shear web. The beam may, for example, be used as a floor beam for an aircraft fuselage.
US09126672B2

An access door assembly for joining to a structure. The access door assembly has an access door with at least one access door nonlinear edge, a support structure with at least one support structure nonlinear edge, and a doubler element attached to an interior side of the support structure. The support structure nonlinear edge is designed to interlace with the access door nonlinear edge to form an access door assembly for joining to a structure, the access door assembly having an interlaced nonlinear edge interface. A diameter of the doubler element of the access door assembly is preferably reduced as compared to a diameter of a doubler element of an access door assembly having a linear or circular edge, such that the reduced diameter preferably results in an overall reduced weight of the access door assembly and the structure to which the access door assembly is joined.
US09126667B2

A marine vessel propulsion control device includes a marine vessel maneuvering pattern storage section that stores a plurality of marine vessel maneuvering patterns corresponding to a plurality of combinations of a propulsion device attached to a marine vessel and an operation device attached to the marine vessel, a selection information storage section that stores selection information that specifies one marine vessel maneuvering pattern selected from the plurality of marine vessel maneuvering patterns, and a control section programmed to read out from the marine vessel maneuvering pattern storage section a marine vessel maneuvering pattern corresponding to selection information stored in the selection information storage section, and to output a command signal to the propulsion device according to an operation signal of the operation device based on the read-out marine vessel maneuvering pattern.
US09126661B2

Controllable tail buoy. At least some of the illustrative embodiments are methods including: towing a sensor streamer and tail buoy through water, the sensor streamer defining a proximal end and a distal end with the tail buoy coupled to the distal end, and the towing with the sensor streamer and the tail buoy submerged; and during the towing controlling depth of the distal end of the sensor streamer at least in part by the tail buoy; and steering the distal end of the sensor streamer at least in part by the tail buoy.
US09126652B2

A steering damper control apparatus includes a steering damper configured to generate a damping force which acts on a steering device, a pressure sensor configured to detect a pressure of a front wheel suspension, a steering angle sensor configured to detect a steering angle of the steering device, and a damping force adjuster configured to adjust the damping force of the steering damper with one of a first command value which is a damping force command value according to a change rate of the pressure, and a second command value which is a damping force command value according to a steering angular speed, based on each detection result of the pressure sensor and steering angle sensor.
US09126649B2

In a mobile vehicle 1 having a vehicle body 2, a front wheel 3f, and a rear wheel 3r, the steering control wheel 3f can be steered by a steering actuator 8 about a steering axis Csf which is tilted backward. The steering actuator 8 is controlled by a control device 15. The height a, from a ground surface 110, of the intersection point Ef of the steering axis Csf of the steering control wheel 3f and a virtual straight line connecting the ground contact point of the steering control wheel 3f and the center of axle of the steering control wheel 3f in a basic posture state of the mobile vehicle 1 is set to satisfy a prescribed condition.
US09126645B2

A cartridge for a track chain is disclosed. The cartridge includes a track pin. The cartridge also includes a rotatable bushing and a rotatable bearing located on the track pin. The cartridge further includes a first thrust bearing located on the track pin between the bearing and the bushing. The first thrust bearing is configured to contact the rotatable bearing and configured to contact the rotatable bushing. The first thrust bearing is configured to bear thrust loads and not radial loads. The cartridge may further include a collar located at an end of the track pin. The cartridge includes a second thrust bearing located between the bearing and the collar. The second thrust bearing is configured to contact the rotatable bearing and configured to contact the collar. The second thrust bearing is configured to bear thrust loads and not radial loads.
US09126635B2

A cowl section structure for a vehicle includes a cowl top cover arranged between a bonnet and a windshield and a contact piece portion. The cowl top cover includes a windshield fitting member provided to a lower end portion of the windshield and a protruding claw extending in a direction in which the protruding claw is inserted into an engagement recessed portion of the windshield fitting member. The contact piece portion is arranged in a space between the protruding claw and the engagement recessed portion. One end of the contact piece portion comes into contact with a tip end portion of the protruding claw. An opposite end of the contact piece portion comes into contact with an inner wall of the engagement recessed portion of the windshield fitting member.
US09126629B2

A motor vehicle structure has an A pillar (5), a sill, a front wheel (8) and a slide-off surface (50) for the front wheel (8). The A pillar (8), as viewed in cross section, exhibits a higher strength in an inner region (49) than in an outer region (48) in order to realize the slide-off surface (50).
US09126624B2

The electric steering wheel position adjustment apparatus of the present invention comprises: a non-expandable steering shaft 2b; a non-expandable steering column 5b; a column holder 31 that supports the steering column 5b so as to be able to move in the axial direction; a pair of left and right tilt shafts 33 that support the column holder 31 so as to be able to pivotally move around the center axis thereof; and an expandable intermediate shaft 28 that is connected to the steering shaft 2b by way of a universal joint 27b; and a tilt shafts 33 that are arranged so that the center axis thereof is orthogonal to the center axis of the steering shaft 2b. The center axis OC of the pair of left and right tilt shafts 33 is located in a range between the position OF of the center of displacement of the front-end section and the position OB of the center of displacement of the rear-end section of the universal joint 27b.
US09126622B2

A steering arrangement includes a steering spindle and a steering coupling provided with a fork crown bearing a connecting element that connects an end of the steering spindle to the steering coupling in the form of a plug connection. To enable the combined steering spindle and steering coupling ends to be connected to each other in the correct relative position and thus to be able to prevent a defective assembly, the steering spindle end and the connecting element are coaxial plug partners on ends facing each other, by means of at least one tongue and groove guide element pair that provides a torque-transmitting priority control. The at least one groove and/or the at least one tongue of the guide element pair is molded on the interior of the shaft. A clamping device clamps the plug partners against each other in a plugging position so that they cannot come loose.
US09126618B2

A vehicle steering system, in which a steering member and steered wheels are not mechanically coupled to each other, includes a rotation angle restriction mechanism that restricts a rotation angle of the steering member within a restricted angular range. In a failure mode, that is, in a case where a malfunction occurs in a steering angle sensor, a steering direction is detected on the basis of a strain of the rotation angle restriction mechanism, which is detected by one of strain gauges at a corresponding one of a pair of terminal ends of a restricted angular range. Drive control is executed on a steered system actuator on the basis of the detected steering direction.
US09126613B2

A cart is provided. The cart includes a plurality of walls to define an internal volume and a top surface. The top surface comprises a planar portion that is enclosed by edges along its perimeter, some or all of the edges including upstanding portions that extend above the planar portion. One or more of the upstanding portions includes an open portion proximate to the intersecting adjacent edge that forms a gap therebetween. A plurality of caps are provided, with a cap disposed upon each corner to contact the planar portion and the upstanding portions of the edges and enclose the gap in each corner.
US09126605B2

A control device for a brake system of a rail vehicle, the brake system having at least one first brake device and a second brake device, which devices can be actuated by an actuating force during a braking process. The first brake device and the second brake device are adhesion-type brake devices. The control device is capable of receiving and/or generating a loss of adhesion signal, which identifies insufficient adhesion for the first and/or second brake device, and is also designed, during a braking process, to actuate the first and/or second brake device with an increased actuating force if a loss of adhesion signal is present. Also disclosed is a brake system for a rail vehicle having a control device of this type, a corresponding rail vehicle and a method for controlling the brake system of a rail vehicle using a control device.
US09126593B2

In order to properly perform vibration damping control in a vehicle 1 in which vibration occurs due to driving characteristics, a vibration damping control device 10 performs sprung vibration damping control of suppressing sprung vibration generated in the vehicle 1, by control of the torque that is generated in wheels 5 of the vehicle 1, with this vibration damping control device 10 performing vibration damping control suppression control of stopping sprung vibration damping control, or reducing a control amount of sprung vibration damping control, on the basis of engine speed and engine torque of an engine 14 that is a power source of the vehicle 1 during travel. As a result, it becomes possible to prevent vibration damping control from being brought to an inappropriate state, due to a travel state of substantial vibration, during vibration damping control.
US09126580B2

A method and system for operating vehicle accessories is described. The method and system allocate an available amount of engine torque between different accessories depending on boundary conditions and nominal vehicle operating conditions. In one example, the accessories may include an air conditioner compressor, an alternator, and various vehicle electrical loads that are in electrical communication with the alternator.
US09126575B2

When a brake ECU is started up rapidly by a brake pedal operation, the brake ECU executes a depression force fluid pressure mode. When the control pressure detected by a control pressure sensor becomes smaller than a switching determination threshold value, the brake ECU determines that an operation of returning a brake pedal is being performed, and switches the braking mode from the depression force fluid pressure mode to a normal control mode. Accordingly, even when the operation of a stroke simulator has been started, no uncomfortable feeling is given to a driver. Further, even when the operation of returning the brake pedal is not being performed, the braking mode is switched from the depression force fluid pressure mode to a simulator non-operation control fluid pressure mode when a vehicle starts to travel. Consequently, desired braking force can be rapidly generated.
US09126574B2

A device for controlling braking in vehicles with two braking pedals (PS, PD), such as farm tractors, earthmovers and the like, comprises a body (30) in which there are formed: a pair of master cylinders (12S, 12D) with an associated brake booster (13S, 13D); a duct (18) for balancing braking of the rear wheels; seats (4, 5, 6) for a pair of balancing valves (14), a trailer brake valve (15) and a valve (16) for disabling braking of the front wheels; as well as passages (36, 46, 47, 62, 72) for transmitting a control pressure from the master cylinders to the valves and from the valves to outlets from the device (1) connected to the braking systems of the wheels of the vehicle and of a trailer, if any.
US09126572B2

A method of managing the braking of an aircraft, the aircraft having a plurality of wheels R1, . . . , R12, each fitted with a brake F1, . . . , F12 adapted to generate a braking force in response to brake pedals 5 being depressed. The management method comprising the steps of: distributing the wheels fitted with respective brakes in at least two distinct groups G1, G2, G3, G′1, G′2, G′3; allocating respective relationships to each of the groups of wheels for determining how braking force varies as a function of the depression of the brake pedals; and modifying the distribution of the wheels in response to a predetermined event occurring.
US09126567B2

In a tire inflating device having a machine frame (2), a tire filling bell (4) arranged on the machine frame (2) and a supporting and sealing device (5) for sealing a filling chamber. The tire filling bell (4) is comprised of a filling plate (10) and a separate filling ring (11). A magazine (3) has a magazine rack (20) and magazine guides (21) lying in a plurality of parallel planes, each of said guides being able to hold a filling ring (11, 11′) mounted so that it can move. The magazine rack (20) and the filling plate (10) can be moved with respect to each other into a plurality of transfer positions in the direction of the axis of rotation. The magazine guide (21) in each case is connected to a filling plate guide (18) arranged on the filling plate (10) in said transfer positions. A filling ring (11) which is located in the magazine guide (21) arranged in the transfer position can be conveyed by a conveying device (40) into a filling plate guide and a centered position on the filling plate (10).
US09126566B2

An airbag module for a vehicle according to the present invention includes: an inflator; and an airbag cushion which is deployed by high pressure gas discharged from the inflator, in which a dead zone, which allows the high pressure gas discharged from the inflator to branch off and flow through at least two branch flow paths, is formed in the airbag cushion, and a variable tether, which guides the high pressure gas passing through the at least two branch flow paths to the upper side of the airbag cushion and has a plurality of vent holes that is opened so that upper and lower portions of the airbag cushion communicate with each other when internal pressure of the airbag cushion exceeds a preset value, is installed in the airbag cushion, such that the high pressure gas is quickly and uniformly distributed and supplied into the airbag cushion.
US09126565B2

Disclosed is a retractor for a seat belt including a spool around which a webbing is wound, a frame rotatably coupled with the spool, a flywheel gear provided at a central portion thereof with a driving gear, having one-directional gear teeth formed along an outer circumferential surface thereof, and mounted on one end of the spool, a vehicle sensor locked with the one-directional gear teeth if the frame is inclined at a predetermined angle or more, a lever locked with the one-directional gear teeth if the webbing is withdrawn by a predetermined first length, and separated from the one-directional teeth if the webbing is introduced again so that the webbing is withdrawn by the second length, and an integrated plate including a driven gear, a first plate to adjust the lever according to a withdrawn length of the webbing, and a second plate integrated with the first plate.
US09126564B2

A communication apparatus for a vehicle achieves reduction in size and cost of a portable unit by making unnecessary an oscillation circuit and a battery in the portable unit. The apparatus is provided with an on-board unit installed on the vehicle and a portable unit carried by a user of the vehicle. A response signal is sent from the portable unit to the on-board unit in response to a signal transmitted from the on-board unit. The portable unit includes a power generation circuit for supplying electric power to circuits in the portable unit by a power generation radio wave sent from the on-board unit, and the on-board unit sends a communication signal after sending the power generation radio wave.
US09126555B2

A guide that can be included as part of a pretensioner for a motor vehicle belt restraint system. The pretensioner includes a frame having walls that define an interior compartment. Located within the interior compartment is a piston assembly having a gas generator in communication with a piston. The gas generator creates an expanding gas that causes movement of the piston and applies tension to a seatbelt of the belt restraint system. The guide includes an opening through which the seatbelt passes and that causes the seatbelt to form a reduced width configuration upon exiting the guide.
US09126545B2

A method of communicating with a vehicle is provided. The method includes: initiating a communication with a vehicle activation application of a vehicle using a personal handheld device; authenticating, using a processor, the personal handheld device based on the communication; and selectively activating one or more components of a vehicle network based on the authenticating.
US09126542B2

A rewriting apparatus of a vehicle program rewriting system predicts, on the basis of both a state of a battery at the time of starting rewriting the programs of ECUs and a scheduled process time period of rewiring the programs, a state of the battery after rewriting the programs, and executes rewriting the programs if the predicted state of the battery satisfies a condition on which the vehicle can be restarted.
US09126506B2

A longitudinally adjustable vehicle seat, having at least one pair of seat rails (10), has a first seat rail (12) fixed to the structure, a second seat rail (13) guided in the first seat rail (12) and connected to the vehicle seat (1). Balls (14) are arranged in ball holders (15), which are arranged between the first seat rail (12) and the second seat rail (13) in order to reduce friction. The first seat rail (12) forms a ball track along which the balls (14) roll with a first end stop and a second end stop, which limit the mobility of the pair of seat rails (10). At least one elevation (12″) is provided, which projects into the ball track. The elevation (12″) can be overcome by at least one ball (14) and the ball holder (15).
US09126504B2

A vehicle headrest assembly includes a head restraint operably coupled to a vehicle seatback and having a head support surface. A flexible member includes a top portion operably coupled to the head restraint. The flexible member includes an intermediate portion adjacent the head support surface, a lower portion, and an upper back support disposed on the vehicle seatback and defining an elongated slot through which the flexible member extends. An actuation system is operably coupled to the lower portion of the flexible member. The actuation system operates to move the flexible member through the slot between a deployed position and a non-deployed position.
US09126503B2

A stowable rear seat includes a seat back unit; and a seat cushion unit. The seat back unit includes a tiltable seat back erected on a floor surface; a seat back locking mechanism for locking a tilt of the seat back; and a rocking member rocking in cooperation with a tilting operation of the seat back after unlocking the seat back locking mechanism. The seat cushion unit includes a seat cushion horizontally placed on the floor surface in front of the seat back, the seat cushion being foldable on a foot floor surface at a lower position than the floor surface; a lock shaft provided at a back end of the seat cushion; and a seat cushion locking mechanism provided in the floor surface, the seat cushion locking mechanism engaging with the lock shaft to lock a horizontal state of the seat cushion on the floor surface.
US09126494B2

The charging of an electric vehicle connected to a charging station is initiated. When a state of charge of the vehicle reaches a minimum state of charge, the charging is halted. The minimum state of charge is less than the full charge capacity of the vehicle. A time for reinitiating the charging is determined. The charging of the vehicle is reinitiated at the determined time.
US09126490B2

This disclosure provides systems, methods and apparatus for wirelessly transferring power using parasitic resonators. In one aspect a wireless power receiver apparatus for powering or charging an electric vehicle is provided. The wireless power receiver apparatus includes a receive circuit including a first coil. The receive circuit is configured to wirelessly receive power so as to power or charge or power the electric vehicle. The wireless power receiver apparatus further includes a passive circuit including a second coil. The passive circuit is configured to wirelessly receive power from a transmit circuit including a third coil. The passive circuit is further configured to wirelessly retransmit power received from the transmit circuit to the receive circuit. The wireless power receiver apparatus further includes a controller configured to displace the second coil from the first coil is provided.
US09126488B2

A charging device for charging a battery (10) by an external power supply (2) includes a temperature sensor (46) for detecting the temperature of the battery, a charger (4) receiving electric power from the external power supply to charge the battery, and a control device (50) controlling the charger such that the battery is charged at a charging rate determined based on the temperature difference between a charging/discharging limitation start temperature and the battery temperature. Preferably, the control device (50) determines the charging rate based on the difference between the amount of charge corresponding to full charge of the battery (10) and the current remaining amount of charge, and the temperature difference. Preferably, the vehicle (100) on which the battery (10) is mounted repeatedly carries out charging and vehicle-running. The control device (50) determines the charging rate according to the temperature increase expected amount when the vehicle runs next time.
US09126485B2

In a vehicular electric system, a first motor driver device and a second motor driver device are connected in parallel to a DC power source. A first capacitor is provided to suppress variations in a voltage developed between the DC power source and the first motor driver device. A second capacitor is provided to suppress variations in a voltage developed between the DC power source and a second motor driver device. A resistor is connected in series to the second capacitor. A filter circuit is thus suppressed form resonance even when a frequency included in a ripple current outputted from an inverter circuit of the first motor driver device overlaps a resonance frequency of the filter circuit.
US09126484B2

The present invention relates to a method for manufacturing human-machine interface (40) including an opening (48) for enabling a user to observe information displayed on the screen (44), characterized in that, each screen module (42) being provided with a specific control (52), various human-machine interfaces (40) are manufactured from the same screen modules (42) by arranging the screen modules (42) in the housings (46) housing a control board provided with at least one control and/or at least one indicator for a function separate from the screen.
US09126479B2

A hybrid power train for a vehicle may include a shift module with a plurality of shift steps of a synchro-mesh type provided on a first input shaft and an output shaft, a second input shaft driven by a motor and arranged coaxially with the first input shaft, a shaft clutch means for coupling/decoupling the second input shaft and the first input shaft, a motor side driving gear arranged rotatably on the second input shaft, a motor side driven gear arranged rotatably on the output shaft to be meshed with the motor side driving gear, a first clutch means for coupling/decoupling the motor side driving gear to/from the second input shaft, a second clutch means provided for coupling/decoupling the motor side driven gear to/from the output shaft, and a variable gear ratio providing means provided on the second input shaft to alternatively transfer a rotational force of the second input shaft to the output shaft.
US09126474B2

A window assembly includes fixed panes, a sliding pane, and a vehicle mounting frame. The mounting frame includes a unitary, substantially full-circumference frame member. The frame member includes a show surface that may extend above or below a window opening opened and closed by the sliding pane. A reinforcement is at least partially embedded in the frame member and has a portion located behind the show surface. Interior surfaces of the fixed panes may be molded to the frame member, and the exterior surface of the fixed panes may free of the frame. A laterally outboard portion of the peripheral edge of each fixed pane may be covered by the frame member.
US09126468B2

A spring seat is interposed between a spring and a suspension arm supporting the spring. The spring seat includes a support portion for supporting the spring, and an upright partition portion disposed on one side of the spring seat in a lateral direction of the spring seat. The upright partition portion is formed integrally with the support portion for covering a side surface of the spring. The suspension arm includes a recessed portion supporting the spring, and the partition portion has a height equal to or greater than a height of the recessed portion. The partition portion includes a guide surface for upward or laterally guiding foreign matters coming from an outside of the spring seat in the lateral direction of the spring seat.
US09126465B2

Hitch guide assemblies having a displaceable guide member are described. In certain embodiments, the hitch guide assembly comprises a guide a guide member and a guide mechanism that is adapted to displace the guide member upon the application of an external force to at least a portion of the guide mechanism.
US09126463B2

The present disclosure relates to a bead breaker group for a tire mounting-demounting machine, which includes a support arm displaceable, in use, in two bead breaking directions along one bead breaking axis, and includes a pair of bead breaker tools supported on substantially opposite sides with respect to the support arm, thereby defining opposite work fronts directed away from the support arm, the work front of a first bead breaker tool of the pair of bead breaker tools being directed towards one bead breaking direction of the two bead breaking directions, whereas the work front of a second bead breaker tool of the pair of bead breaker tools is directed towards the other bead breaking direction of the two bead breaking directions.
US09126452B2

A method of forming an imaging blanket for a printing apparatus comprises preparing a support structure (e.g., mold) for receipt of a polymer blanket compound, introducing the polymer blanket compound in liquid state over the support structure, curing the polymer blanket compound to produce an imaging blanket, releasing the imaging blanket from the support structure, and etching a surface of the imaging blanket to form a texture pattern therein, the surface forming an imaging surface of said imaging blanket. An imaging surface providing desirable dampening fluid retention is provided. Wet etch, dry etch or a combination of both may be used. The polymer may be a silicone compound, may include 3 percent by weight granular material.
US09126446B1

An apparatus detects inoperative inkjets in a printhead. The apparatus includes a rotating member having a light transmitting surface layer onto which material is ejected by the printhead. A light source directs light into the edge of the light transmitting surface layer and an optical sensor generates image data of the surface of the surface layer of the rotating member. Inoperative inkjets are detected with reference to the image data of the surface of the surface layer of the rotating member.
US09126445B1

A modular printhead assembly facilitates the manufacture of printers with print zones of differing widths. The printhead assembly includes a pair of end pieces and a plurality of rods that extend between the end pieces in parallel. The rods pass through holes in lugs extending from carriers configured for the mounting of printheads. Plates are interposed between the printheads and the carriers to enable actuators to move the plates and printheads within the perimeters of the carriers to adjust the stitch and roll alignments of the printheads.
US09126439B2

Provided is a printer capable of enhancing the cutting efficiency of printing paper. A printer, includes a printing unit; a fixed blade; a movable blade provided to be movable relative to the fixed blade, and cut the printing medium with the fixed blade; and a tension mechanism applying a tensional force to the printing medium. The tension mechanism includes a receiving member disposed on the discharge side of the fixed blade; and a pressing member extending from the movable blade toward the discharge side, moving with the movable blade. The pressing member includes a pressing part configured to press the printing medium against the receiving member and move toward the discharge side while holding the printing medium between the pressing part and the receiving member, as the movable blade moves toward the fixed blade.
US09126434B2

Systems and methods are provided for improved radiant heat control within a dryer of a printing system with reflective elements. One embodiment is a dryer of a printing system. The drying includes a radiant energy source configured to apply heat to a print medium. The dryer also includes a reflective element installed between the radiant energy source and the print medium. The reflective element is configured to have varying levels of reflectance. The dryer also includes a controller configured to determine an amount of heat to supply to a region of the print medium, and to adjust an amount of reflectance of the reflective element based on the determined amount of heat.
US09126427B2

The control unit of a printer feeds paper P from a paper supply path 12 to a main conveyance path, drives a paper feed roller pair, conveys the paper in a first direction through the main conveyance path, and prints on the first side of the paper. After printing on the first side ends, the conveyance direction changes from the first direction to the opposite second direction, and the medium is back-fed to a looped inverting conveyance path at a faster conveyance speed than the conveyance speed when printing. First and second conveyance rollers are then driven to convey the print medium at high speed through the inverting conveyance path, thereby inverting the front and back and returning the medium to the main conveyance path for printing the second side.
US09126426B2

A transfer control method of continuous paper includes controlling a transfer amount of the continuous paper based on a rotational amount detected by a roller feeding amount detecting unit which detects the rotational amount of a paper feed roller, when each page of the continuous paper is printed, and when the printing on each page is completed, performing a cueing process of transferring the continuous paper until a printing start position of a next page reaches the printing position. The cueing process includes transferring the continuous paper until the continuous paper reaches a reference transfer position based on the feeding amount of the tractor detected by a tractor feeding amount detecting unit for detecting a feeding amount of the tractor and after the continuous paper reaches the reference transfer position, setting the transfer amount of the continuous paper as a target feeding amount.
US09126415B2

A print fluid cartridge has a print fluid supply portion integrally formed with a cartridge body and including a cylindrical side wall protruding outwardly from the cartridge body. At least a portion of a tubular member is disposed in the print fluid supply portion with a gap formed between the cylindrical side wall and a portion of the tubular member disposed in the print fluid supply portion. An elastic member is provided in the print fluid supply portion between a first end of the tubular member and a protruding-end wall of the print fluid supply portion, and is formed with a through-hole. A lid body is disposed in the tubular member to move between a first position and a second position. An urging member is disposed in the tubular member to urge the lid body in a direction toward the first position.
US09126412B2

A printing device includes a first ink reservoir unit configured and arranged to store a first ink having sedimentary properties, a head provided with nozzles, a plurality of first ink supply paths configured and arranged to supply the first ink to the head from the first ink reservoir unit, a stirring unit configured and arranged to stir the first ink existing inside an upstream region in a supply direction of the first ink supply paths, and a control unit configured to execute again an again stirring process after a prescribed time has elapsed from a previous stirring process of the first ink by the stirring unit, and, after execution of that the again stirring process, to eject from the nozzles the first ink that is unstirred existing inside the region further downstream in the supply direction than the upstream region of the first ink supply paths, and inside the head.
US09126410B2

A liquid ejecting head unit includes a plurality of heads having a nozzle surface in which nozzle openings that eject ink are provided; a cover head that protects the nozzle surfaces of the heads, and a cover that covers the heads and between the nozzle surfaces of each head, in which the cover has a conducting portion that conducts with the cover head of the head.
US09126405B2

A liquid ejection apparatus includes a plurality of liquid ejection heads each comprising a channel member having a plurality of ejection openings, a plurality of channels communicated with the plurality of ejection openings, and a heat body, and a plurality of radiators each provided for each of the plurality of liquid ejection heads. The liquid ejection apparatus further includes a plurality of temperature sensors each provided for each of the plurality of liquid ejection heads and outputting a signal indicating a temperature of the channel member, a heat-resistance change device changing a heat resistance between one of the plurality of radiators and one of the plurality of liquid ejection heads corresponding to the one of the plurality of radiators, and a controller controlling the heat-resistance change device based on the signal outputted from at least one of the plurality of temperature sensors.
US09126404B2

A faulty discharge detection technique to detect faulty discharge of nozzles in an ink jet recording apparatus includes recording a test pattern onto a recording medium so as to include at least two or more reference marks in the width direction of the recording medium, reading the test pattern by a scanner unit, determining whether or not there is a faulty discharge image from image data read in the test pattern reading, and calculating faulty discharge nozzle position to, in the event that there is a faulty discharge image in the image data, detect the reference marks and detect the position of nozzles in a faulty discharge state from the position of the faulty discharge image in the image data.
US09126400B2

A negotiable instrument such as a check includes a unique microprint identifier that allows for authentication while preventing unauthorized reproduction and alternation. A printing system generates the identifier after receiving a customer order for printing a plurality of negotiable instruments, to allow inclusion of information that is specific to the customer order and/or the printing process. In various embodiments, the identifier is unique to each or each subset of the plurality of negotiable instruments and facilitates authentication of each of the negotiable instruments when needed.
US09126397B2

A printing method is performed by use of a printing device. The printing device includes a print head, a supply roll, a serving roll, a support roll, a feed roll, and a winding roll. The printing device feeds a fabric material toward the winding roll by a prescribed length each time that a cycle of a print operation is performed by the print head, so that the printing is performed on the fabric material intermittently. The printing method includes performing a first feed operation of intermittently rotating the feed roll by a first motor to pull the fabric material from a print unit and feed the fabric material toward the winding roll by a prescribed length; and performing a second feed operation of intermittingly rotating the serving roll by a second motor to feed the fabric material toward the print unit. A detected tensile force value based on a detected value of the tensile force of the fabric material detected at a position upstream with respect to the print unit is compared to a preset target tensile force, and the second motor is controlled based on a result of the comparison.
US09126391B2

A process and apparatus for simultaneously securing opposite parallel edge flaps of a flexible cover sheet to opposite parallel edge faces of a wall panel. A pair of wiping devices move downwardly and wipe the edge flap against the edge faces and transversely tension the cover sheet. Top sweep devices move down into holding contact with the cover sheet adjacent the parallel edge faces to maintain the transverse tension in the sheet. The edge flaps are then deflected and adhesive applied to the edge faces and back surfaces of the edge flaps. The wiping devices then again wipe the flaps downward into pressed contact with the edge faces to create an adhesive securement therewith.
US09126390B2

A stretch composite fabric comprises a sintered expanded porous polytetrafluoroethylene film and a stretch cloth laminated to each other while maintaining a flat state. The stretch composite fabric has a tensile stress at 10% elongation, as measured in at least one direction, of 1.8 N/15 mm or less. When a 5 cm-width test piece of the stretch composite fabric is stretched in a length direction under a load of 300 g and then released from the stress, an elongation recovery R of the stretch composite fabric, which is given by the following equation, is preferably 70% or more. R=(L2−L3)/(L2−L1)×100 (In the equation, L1, L2, and L3 represent the lengths of the composite fabric before the load is applied, when the load is applied, and after the load is removed, respectively.)
US09126377B2

A molding element of a mold for molding and vulcanizing a tire tread, this tread comprising a tread surface intended to come into contact with the ground when the tire is running. The molding element comprises a molding surface intended to mold part of the tire tread surface and a blade of length L and of height H intended to mold a sipe or a groove in the tread. This blade comprises a rounded end extending along the length of the blade in a direction of extension X. The molding element further comprises two cutting means positioned on either side of the blade at a certain distance from this blade. Each cutting means comprises a cutting edge extending in the direction of extension, this cutting edge making an acute angle in a cutting plane perpendicular to this direction of extension, the height of this cutting edge being greater than or equal to the height of the blade.
US09126373B1

A tire puncture repair apparatus may include a handle, a puncture repair screw, and an integral neck between the handle and the puncture repair screw. The puncture repair screw may include a screw head, a cylindrical shaft extending from the screw head opposite the neck, a partially threaded and solid cone that uniformly narrows from the shaft to a tip opposite the shaft, and a conic-helical thread coiled about the cone between the tip and the shaft. The diameter of the shaft may be approximately equal to the diameter of the cone at the widest point of the cone. The thread on the cone may include an angled ridge and may be coiled around the cone from the intersection of the shaft and the cone to before tip of the cone.
US09126369B2

Described are methods of making a paint roller using preformed strips or core material made from a compound of polypropylene and calcium carbonate having between 5% and 66% calcium carbonate by weight. One or various compounds may be used to form portions of one or multiple components that make up the paint roller, including, for example, the thermoplastic strips, adhesives and/or the backing of a composite cover material. The materials can be assembled in a continuous manufacturing process.
US09126358B2

A method of improving the appearance of foaming injection molding product includes closing the moving mold and the fixed mold and setting a clamping force on the closed mold, wherein a mold cavity is formed between the moving mold and the fixed mold. The method proceeds by inflating the mold cavity with high pressure and high temperature gas until the air pressure in the mold cavity reaches 2-25 MPa and the temperature of the high pressure and high temperature gas is between 60-200° C., then injecting molten resin that contains foaming agent into the mold cavity while continuously inflating high pressure and high temperature gas. After injection completed, stopping inflating high pressure and high temperature gas and simultaneously releasing pressure, wherein the step of releasing pressure includes the step of opening the mold.
US09126356B2

Discussed are a roll mold, a method for fabricating the same and a method for fabricating a thin film pattern using the same, to prevent dimensional variation of the mold and simplify the overall process. The method for fabricating a roll mold includes providing a substrate provided with a master pattern layer, sequentially forming a mold surface layer and a solid suffer layer on the substrate provided with the master pattern layer to provide a flat panel mold, forming an adhesive resin layer on the base roller aligned on the flat panel mold, and rolling the base roller provided with the adhesive resin layer over the flat panel mold to adhere the flat panel mold to the base roller through the adhesive resin layer.
US09126345B2

A domestic appliance includes a functional action unit which has at least one movably arranged member, and a generator configured to generate electric energy at the location of the functional action unit. The generator is associated with the movably arranged member, and employs movement of this member in a process of generating electric energy. The generator includes a permanent magnet and an electric coil, where the magnet may be mounted on the movably arranged member. By having the generator at a location inside the functional action unit, it is possible to have one or more electric components at a location inside this unit without the need for external electric connections.
US09126340B2

A system for handling a bead apex comprises a first jaw having open and closed states, which is configured to engage a first surface of a bead apex in the closed state. The system further comprises a second jaw having open and closed states, and a plurality of grippers coupled to the second jaw. Selected ones of the plurality of grippers are configured to engage a second surface of the bead apex in the closed state of the second jaw. Further, at least one of the plurality of grippers comprises a tapered end surface.
US09126338B2

Provided is a method of driving a system for a robot including obtaining scan data which includes information about at least one of a coordinate and a direction of the robot, estimating a plurality of location changes of the robot by matching a plurality of consecutive scan data pairs of the obtained scan data, generating a path of the robot by connecting the estimated location changes, estimating a position of a corrected instantaneous center of rotation (ICR), and correcting the plurality of consecutive scan data pairs based on the corrected ICR.
US09126326B1

An attachment device configured to be attached to opposed sides of an automotive creeper is disclosed herein. The attachment device includes: a first generally L-shaped member, a second generally L-shaped member, a connecting member slidably coupling the first generally L-shaped member to the second generally L-shaped member, and at one least pair of securement devices configured to respectively attach the first and second generally L-shaped members to the automotive creeper. In one or more embodiments, a width of the attachment device is selectively adjustable so as to accommodate a plurality of different automotive creepers having varying widths. An automotive creeper system and a mechanics chair using the attachment device are also disclosed herein.
US09126324B2

A knife includes a knife blade and an ergonomic knife handle carried by the knife blade, the ergonomic knife handle including a knife handle frame having at least one finger opening sized and configured to accommodate at least one finger of a user.
US09126309B2

The present invention includes methods and apparatus for controlling the abrasion of a tire surface. Particular embodiments provide an abrading tool for abrading a surface of a tire, the tool comprising means for rotating an abrading wheel, an abrading wheel rotatably attached to the means for rotating, and a depth guide secured to the means for rotating, wherein the depth guide includes a pair of freely rotatable, spaced apart guide wheels. Further embodiments include a depth guide configured for use with an abrading tool which includes a abrading wheel and a means for rotating the abrading wheel, the depth guide comprising a mounting member securable to the means for rotating and a pair of freely rotatable, spaced apart guide wheels rotatably attached to the mounting member. Particular embodiments further include a method for preparing a portion of a tire for repair.
US09126307B2

An impact baffle for a jet cutting tool and a method to operate the baffle in conjunction with the jet cutting tool are described, the baffle with an impact layer and an laterally extended sensing layer to trigger a control signal for interrupting a cutting operation of the jet cutting tool after the impact layer is pierced by the jet cutting tool.
US09126303B2

Disclosed is a method for production of a laminate polishing pad which comprises a reduced number of steps and is excellent in productivity rate, and which causes no detachment between a polishing layer and a cushion layer and can prevent the groove clogging caused by a slurry or the like. Also disclosed is a laminate polishing pad produced by the method. A method for production of a laminate polishing pad, comprising the steps of: preparing a cell-dispersed urethane composition by a mechanical frothing process; ejecting the cell-dispersed urethane composition onto a cushion layer continuously while feeding the cushion layer; curing the cell-dispersed urethane composition while controlling the thickness of the composition evenly to form a polishing layer made of a polyurethane foam, thereby producing a long laminate sheet; and cutting the long laminate sheet.
US09126300B2

In a machine tool which includes a rotary shaft configured to allow a tool or a workpiece to be attached thereto, a driving unit for causing the rotary shaft to rotate is regulated to change a rotation speed of the rotary shaft in such a manner that the rotation speed oscillates with a given amplitude and a given period with respect to a given mean rotation speed, so that chatter vibrations can be suppressed. A parameter display control unit configured to cause a display device to display parameter information related to predetermined parameters for changing at least one of the mean rotation speed, the amplitude and the period is provided so that the parameters can be changed based upon the parameter information displayed in the display device.
US09126292B2

A method and portable device for modifying or coating a surface of turbine components in the field includes an ESD torch electrically connected with ESD equipment. The ESD torch includes an inert gas source, vibration source, and electrode disk of conductive material. The electrode disk is disposed within the ESD torch, shielded by an inert gas and coupled with the vibration source. The electrode disk is rolled over the surface, which actuates the electrode disk and deposits the conductive material from the electrode disk onto the surface of the workpiece to form the compositionally controlled protective coating. The compositionally controlled protective coating deposited by the electrode disk forms a metallurgical bond with the surface of the workpiece to prevent erosion of the workpiece.
US09126290B2

A system for rapidly assembling solar receiving tubes and solar energy systems comprises a welding station is described. The welding station provides for rapidly assembling solar receiver tubes by welding together two or more solar receiving tubes and comprises means for receiving and restraining solar receiver tubes and a welding station comprising an orbital or a rotational weld head.
US09126281B2

A device for supplying a shielding gas to a welding torch, the device including a cylinder 1 for holding the shielding gas, a valve operatively connected to the cylinder for selectively permitting flow of gas from the cylinder, a regulator for controlling the pressure of the gas flow from the cylinder, and a guard assembly 2 coupled to the cylinder 1 and adapted to protect the valve and regulator from external forces, wherein a flow meter 4 incorporated into the guard assembly 2, the flow meter being adapted to receive the nozzle 5 of a welding torch and measure the flow rate of the gas therein.
US09126278B2

A reusable template for simultaneously forming a plurality of cooling passages in a component for use in a turbine engine includes a first surface defining an electrode entry surface, a second surface opposed from the first surface and defining a component mating surface, and a plurality of electrode passages pre-formed in the template and extending from the first surface to the second surface. The second surface of the template has a shape that corresponds to an outer surface of the component such that the template is capable of being snugly positioned against the outer surface of the component. During an electro-discharge machining operation, a plurality of electrodes are simultaneously inserted through the pre-formed electrode passages in the template and into the component while supplying an electric current to the electrodes to remove material from the component so as to form the cooling passages therein.
US09126271B2

An embedded sensor or other desired device is provided within a completed structure through a solid-state bonding process or through a dynamic bonding process. The embedded sensor or other desired device is provided on a substrate through any known or later-developed method. A cover is then bonded to the substrate using a solid-state bonding process or a dynamic bonding process. The solid-state bonding process may include providing heat and pressure to the substrate and the cover to bond the substrate and the cover together. The dynamic bonding process may include heating a bonding agent and distributing the heated bonding agent between the substrate and cover to bond the substrate and the cover together.
US09126269B2

A multilayer blown film with improved strength or toughness comprising a layer comprising a metallocene polyethylene (mPE) having a high melt index ratio (MIR), a layer comprising an mPE having a low MIR, and a layer comprising a HDPE, and/or LDPE. Other embodiments have skin layers and a plurality of sublayers. At least one sublayer includes an mPE, and at least one additional sublayer includes HDPE and/or LDPE. The mPE has a density from about 0.910 to about 0.945 g/cm3, MI from about 0.1 to about 15, and melt index ratio (MIR) from about 15 to 25 (low-MIR mPE) and/or from greater than 25 to about 80 (high-MIR mPE). A process is related to supplying respective melt streams for coextrusion at a multilayer die to form a blown film having the inner and outer skin layers and a plurality of sublayers, wherein the skin layers and at least one of the sublayers comprise mPE and at least one of the sublayers comprise HDPE, LDPE or both. Draw-down, blow-up ratios and freeze-line distance from the die are controlled to facilitate a high production rate.
US09126267B2

The present invention relates to a rod-shaped tool holder (1) having a length (I) for the attachment of at least one machining cutting bit (2). The tool holder (1) is configured for being clamped at a first end (4) and has a second free end (3) and optionally a secondary support between the clamping point (4) and the at least one cutting bit (2). In operation, the tool holder oscillates in higher order bending oscillations about at least one node (6) located on a curvilinear axis (x) extending from the first end. The at least one cutting bit (2) is positioned substantially at the node (6) in a distance from the free end (3), towards the first end (4).
US09126265B2

In a steel ladle used for handling molten steel, a precast ladle barrel ring forms part of a refractory structure that covers the bottom wall and side wall of the steel ladle. The precast ladle barrel ring is comprised of a monolithic annular ring formed of a high-temperature, cast refractory. The annular ring further includes means for positioning the precast ladle barrel ring in a steel ladle.
US09126262B2

In a twin roll continuous caster, the casting nozzle in the continuous casting apparatus is arranged such that the outlet passages and/or tapered walls in the main portion within the casting nozzle provide flow of molten metal downwardly converging toward the nip between the casting rolls of a twin roll caster. The casting nozzle having a reservoir portion for directing molten metal converging toward the triple point region to inhibit the washing of shells forming on the casting surfaces of the casting rolls.
US09126260B2

In a method of processing a substrate in accordance with an embodiment, a trench may be formed in the substrate, imprint material may be deposited at least into the trench, the imprint material in the trench may be embossed using a stamp device, and the stamp device may be removed from the trench.
US09126254B2

Apparatus for the application of spacer elements on plates, including means for feeding the spacer elements in the form of a band, at least one member for cutting the band and for applying the spacer elements, formed by the cutting, on a plate.
US09126248B2

Provided is an asymmetric rolling method including: entering a to-be-rolled material having a first surface and a second surface between a first roll and a second roll that has a greater diameter than that of the first roll and a rotary angular speed that is different from that of the first roll while the first surface and the second surface respectively contact the first roll and the second roll, followed by rolling, and entering the rolled to-be-rolled material between a third roll and a fourth roll that has a greater diameter than that of the third roll and a rotary angular speed that is different from that of the third roll while the first surface and the second surface respectively contact the fourth roll and the third roll, followed by rolling, wherein different shear stresses are applied to the first and second surfaces of the to-be-rolled material.
US09126247B2

An outer panel for a pillar of a vehicle includes a central portion, flanges at opposite sides thereof for bonding to an inner panel, and opposite side portions between the central portion and the flange portions in a transverse sectional shape, wherein each of the side portions located at opposite sides of the central portion has a collision energy absorbing section having a thickness that is smaller than that of the central portion.
US09126241B2

A cleaning apparatus (10) comprises a drive arrangement (16). A discrete holding means (12) is mountable on the drive arrangement. The holding means comprises a flexible elongate cleaning member (14) and a housing (18) for housing at least a portion of the elongate cleaning member. The cleaning apparatus further includes a transmission arrangement (20) for transmitting drive from the drive arrangement to the elongate cleaning member.
US09126232B2

A method of masking part of a surface of a wall of a gas turbine component including at least one area having cooling holes defined therein, the method including applying a viscous curable masking compound to the part of the surface over an entirety of each of the at least one area, including blocking access to the cooling holes from the surface by applying the masking compound over the cooling holes without completely filling the cooling holes with the masking compound, and forming a respective solid masking element completely covering each of the at least one area and the cooling holes defined therein by curing the masking compound.
US09126231B2

An insulation pattern-forming method includes forming an organic pattern on a substrate. A space defined by the organic pattern is filled with an insulating material. The organic pattern is removed to obtain an inverted pattern formed of the insulating material. The inverted pattern is cured. An insulation pattern-forming method includes forming a first organic pattern on the substrate. A space defined by the first organic pattern is filled with an insulating material. An upper surface of the first organic pattern is exposed. A second organic pattern that comes in contact with the upper surface of the first organic pattern is formed. A space defined by the second organic pattern is filled with the insulating material. The first organic pattern and the second organic pattern are removed to obtain an inverted pattern formed of the insulating material. The inverted pattern is cured.
US09126223B2

A dispensing module and method of dispensing an adhesive includes a dispenser body assembly having a liquid supply passage, a nozzle member having a liquid passageway, a valve element, and a valve seat. The liquid passageway includes a discharge passageway defining an outlet, a first converging surface, a bore, and a shoulder positioned between the first converging surface and the bore. The valve element extends along an axis within the liquid passageway and has a bulbous end portion movable along the axis between an open position and a closed position. The bulbous end portion has a valve needle smaller than the bore to inhibit obstruction to the discharge passageway for adhesive flowing thereto. The valve seat seals against the bulbous end portion in the closed position such that a region of the valve needle projects into the discharge passageway for inhibiting clogging of the adhesive proximate to the outlet.
US09126220B2

An exemplary paint material switching path includes first and second valve elements, each having an inlet and an outlet, and a hollow cylindrical intermediate piece arranged between the outlet of the first valve element and the inlet of the second valve element. The inlet of the first valve element is configured to be connected to a continuously pressurized paint material supply, and a manifold channel which is configured to be pressurized and into which the outlet of the second valve element opens. Furthermore, components are provided for measuring the pressure prevailing in the hollow cylindrical intermediate piece and an evaluation device for detecting leaks in at least one of the two valve elements based on the measured pressure with respect to time for a given pressure difference between the inlet of the first valve element and the outlet of the second valve element at the beginning of the leak detection.
US09126210B1

Fuel-air premixing is the accepted technology for reducing NOx emissions from combustors and burners. In view of this complex burner-nozzle designs involving multiple swirlers have been designed and developed. I have developed a high-premixing fuel-air nozzle that involves micro-fabricated porous swirl panels with distributed fuel injection. The design and fabrication of the fuel injector has been completed, the injector assembly has been set up in a combustor test-rig, and a variety of tests have been undertaken. The tests have clearly established that compared to a traditional solid swirler with a premixing length the micro-fabricated swirl injector-assembly lowers the Lean Blowout Limit, enhances mixing and volumetric heat release, and for the same temperature levels as the solid swirler, reduces NOx levels.
US09126208B2

A centrifugal separator comprises a bowl rotating in use around an axis of rotation. The axis of rotation extends in a longitudinal direction, and a radial direction extends perpendicular to the longitudinal direction. A base plate provided at one longitudinal end of the bowl, said base plate having an internal and external side, an outlet opening being provided in the base plate. A casing is projecting at the outlet opening on the external side of said base plate, said casing comprising a casing side, a normal to said casing side extending at an acute angle relative to a circumferential direction of the bowl at said casing and a discharge opening is provided in said casing side. The discharge opening is radially outwardly limited by a weir with an overflow edge and said discharge opening extending radially inwardly to a position above a highest intended level of liquid in the bowl.
US09126205B2

An apparatus and method for sensor and control system, which automatically adjusts a product splitter position of a full-scale spiral. An electrical conductivity-based automation system is described and claimed herein and has been successfully developed and demonstrated as illustrated herein. The system includes a sensor and a microprocessor based and controlled servo or gear motor that is utilized to adjust the splitter of an operating coal/mineral spiral based on the readings of the sensor. The device as described and claimed herein converts a traditional coal spiral to an automated system for controlling the splitter thereby giving the spiral unit the ability to automatically adjust a key process variable, i.e., its splitter position, in real time as and when the feed coal or other mineral property changes to maintain the performance of the spiral at the optimum level.
US09126201B2

The present invention provides a method and apparatus for amplifying a nucleic acid sequence by polymerase chain reaction (PCR). The method comprises placing a PCR sample in a container which is heated by only a single heat source that provides a high temperature for denaturation in the bottom of the PCR sample, while annealing and extension automatically occur in different regions of the PCR sample due to the convection induced by a temperature gradient descending from the bottom of the PCR sample to the surface of the PCR sample.
US09126199B2

A hanging drop plate and a method of cultivating cells or of producing molecular aggregates in at least one liquid volume that adheres to a drop contact area of such a hanging drop plate. The hanging drop plate has a body with a first surface and a second surface that is essentially coplanar to the first surface. The second surface has a drop contact area for adherently receiving a liquid volume. The drop contact area is distinguished from a surrounding area by a relief structure that prevents spreading of the liquid volume on the second surface of the body. The body has at least one conduit that mouths into the drop contact area from the direction of the first surface of the body. A liquid volume is applied to the drop contact area through a communicating conduit. Cells and/or molecules can be introduced into this liquid volume.
US09126198B2

A technique capable of making an object move and transporting it without generation of a current, and extracting mechanical work. As a result of diligent effort, the present inventors have found that by arranging two electrodes for generating an electric field for a dielectric body of a micrometer-size or the like in an insulating fluid such as oil, such that the central axes of the two electrodes are not aligned, and applying an electric field (for example, constant electric field), the dielectric body can be transported three-dimensionally at will, and as a result, mechanical work can be extracted.
US09126195B2

The present invention provides cationic exchange resin that maintains a high exchange speed of polyvalent ions in addition to monovalent ions without agglomeration occurring in spite of surface coating even when mixed bed ion-exchange resin is used.
US09126192B2

A sol includes metal oxide nanoparticles and stabilizer ions dispersed in an aqueous liquid. The nanoparticles include a metal selected from the group of platinum, palladium, rhodium, iridium, ruthenium and osmium and the molar ratio of metal: stabilizer ions is at least 0.7. A method of preparing supported catalyst materials includes contacting the sols with support materials.
US09126191B2

Embodiments of present inventions are directed to an advanced catalyst. The advanced catalyst includes a honeycomb structure with an at least one nano-particle on the honeycomb structure. The advanced catalyst used in diesel engines is a two-way catalyst. The advanced catalyst used in gas engines is a three-way catalyst. In both the two-way catalyst and the three-way catalyst, the at least one nano-particle includes nano-active material and nano-support. The nano-support is typically alumina. In the two-way catalyst, the nano-active material is platinum. In the three-way catalyst, the nano-active material is platinum, palladium, rhodium, or an alloy. The alloy is of platinum, palladium, and rhodium.
US09126177B2

Methods and systems for acoustically treating material using a continuous process in which material may be caused to flow in a continuous or intermittent fashion into/out of an acoustic treatment chamber where the material is exposed to focused acoustic energy. The methods and systems may be arranged to permit continuous processing for extended periods while an acoustic energy source operates at a relatively high power output. Treatment chambers may include features such as an acoustic window, a heat exchanger, inlet/outlet flow arrangements, an inspection window, insert elements that define a treatment volume size or shape, etc. Treatment system configurations relating to arrangements of a treatment chamber relative to an acoustic source and coupling medium, material flow paths, and others are provided.
US09126168B2

A structure and method are provided for adding a catalyst bed platform to an existing reactor without welding to the structural portion of the reactor walls. The structure is constructed from components that can be passed through an existing opening in a reactor. The structure allows a catalyst bed in an existing reactor to be divided into catalyst beds with a reduced length to diameter ratio.
US09126164B2

Described is a method of reducing liquid composition errors in a low-pressure mixing pump system. Packets representing the switching intervals of each component of the desired fluid mixture are provided to an intake of the mixing pump system. For each packet, a switching time associated with at least one of the components in the packet is modulated. Modulated switching times are based on time offsets that are specifically selected according to the undesirable frequency characteristic of an intake response of the mixing pump system. The average of the volumes contributed by the packets thus modulated is equal to a component volume that achieves a desired proportion of the component in the output flow of the mixing pump system. Modulated switching times enable the reduction or elimination of composition error in the output flow of the mixing pump system.
US09126162B2

An apparatus for positioning a functional device, wherein the apparatus has a main body, a carrier element that can be disposed on the main body to receive the functional device, positioning stops, which are mounted displaceably to clamp the functional device, an actuating device which is adapted such that, by actuating the actuating device, the positioning stops can be transferred between an operating state engaging the functional device and an operating state releasing the functional device, and a force transmitting element which is adapted to transmit an actuating force from the actuating device to the positioning stops, wherein the actuating device and the force transmitting element are coupled in such a manner that, in the operating state engaging the functional device, the force transmitting element transmits a functional device force of the functional device to the actuating device in such a manner that the actuating device remains in a rest position with respect to the carrier element, in spite of the action of the transmitted functional device force.
US09126155B2

This invention relates to self-cross-linkable and self-cross-linked aromatic polyimide polymers, their membranes and methods for making and using these polymers and membranes. The self-cross-linkable aromatic polyimide polymer described in the present invention comprises both hydroxyl functional groups and carboxylic acid functional groups. The self-cross-linked aromatic polyimide was formed via heating the self-cross-linkable aromatic polyimide polymer at ≦300° C. The self-cross-linked aromatic polyimide membranes exhibit high selectivity in separation of mixtures of gases and liquids.
US09126152B2

A polybenzoxazole (PBO) membrane from a self-cross-linked aromatic polyimide polymer membrane is provided. These membranes are useful in the separation of gas mixtures. The PBO membrane is made by fabricating a self-cross-linkable aromatic polyimide polymer membrane comprising both hydroxyl functional groups and carboxylic acid functional groups; cross-linking the polymer to form a self-cross-linked aromatic polyimide polymer membrane by heating the membrane at 250° to 300° C. under an inert atmosphere; and thermal heating the self-cross-linked aromatic polyimide polymer membrane at a temperature from about 350° to 500° C. under an inert atmosphere to convert the self-cross-linked aromatic polyimide polymer membrane into a PBO membrane. A membrane coating step may be added by coating the selective layer surface of the PBO membrane with a thin layer of high permeability material.
US09126151B2

An object of the present invention is to provide a hydrogen separation material resistant to thermal shock, excellent in hydrogen separation characteristic and applicable to a hydrogen separation membrane, etc. and a manufacturing method thereof, as well as a hydrogen separation module and a hydrogen production apparatus comprising the same.In the hydrogen separation material, a silica glass membrane is formed on a porous support having a linear expansion coefficient of 2×10−6/K or less. The manufacturing method for the hydrogen separation material includes a porous support forming step of forming a porous support comprising porous silica glass and a silica glass membrane forming step of forming a silica glass membrane on the surface of the porous silica glass. The hydrogen separation module comprises the hydrogen separation material and a steam reforming catalyst. The hydrogen production apparatus comprises the hydrogen separation module.
US09126149B2

A method and system for treating water in order to desalinate the water where the system and method includes a reverse osmosis or distillation unit for producing a first concentrate and at least partially desalinated water. The first concentrate stream is directed to a first demineralization unit which utilizes nanofiltration membranes to treat the first concentrate stream so as to produce a permeate and a second concentrate stream. The second concentrate stream is directed to a second demineralization unit that includes an ion exchange device which in turn treats the second concentrate stream by producing a stream of at least partially demineralized water and third concentrate stream. The stream of at least partially demineralized water is mixed with the stream of at least partially desalinated water produced by the reverse osmosis or distillation unit.
US09126145B2

De-polluting, self-cleaning coating compositions are disclosed which comprise an organic binder having dispersed therein photocatalytic titanium dioxide particles substantially in anatase form which have an average crystallite size between about 1 nm and about 150 nm and which preferably have photocatalytic activity in the presence of visible light. Advantageously, the coatings of the invention do not require pre-activation to achieve high initial photocatalytic activity against pollutants in the air, such as NOx compounds.
US09126137B1

A polymer nanocomposite for separating a target gas from a second gas in a gas mixture includes: (a) a matrix formed from a modified polymer, and (b) nanoparticles incorporated in the matrix, the nanoparticles being functionalized to have a stable interaction with the matrix. The modified polymer has a backbone including (i) a polymer having a selectivity for the target gas over the second gas, and (ii) functional groups covalently linked to the polymer (i) as part of the backbone. The functional groups are capable of further increasing the selectivity of the modified polymer by interacting with the target gas and/or with the second gas.
US09126135B2

A filter system includes a housing having an inlet opening surrounded by a sealing surface, an outlet opening. The housing may be rotational molded or be configured to be nestable with additional housings for shipping purposes. The system may also be configured such that the filter to be mounted therewith can be placed interior to the filter housing during shipment. A V-bank filter or a single-header box filter is positioned in the inlet opening, has a flange in general alignment with the sealing surface, and a plurality of filter media sections projecting away from the flange and into the housing interior. A seal is disposed between the flange of the V-bank or single-header box filter and sealing surface. A pre-filter, such as a panel filter, may be provided upstream from the primary filter.
US09126131B2

An air filter for a ventilation system of a motor vehicle has a filter frame and a filter medium fastened in and surrounded by the filter frame. The air filter can be inserted along its two-dimensional extent into a receiving slot and is sealed, at least along the inserted regions of the filter frame, between the filter frame and walls of the insertion slot. To allow the filter to be installed in the ventilation system in as force-free and simple a manner as possible, the filter frame has, in the end side facing the insertion direction, at least one guide slot which is oriented in the insertion direction.
US09126125B2

The present invention relates to the recovery of alcohols, in particular ethanol, from a crude ethanol product obtained from the hydrogenation of acetic acid using a reduced energy process. The crude ethanol product may be fed to a distillation column in which a substantial portion of the water is removed with the acetic acid in the residue. Additional water may be removed by using a pressure swing adsorption unit, molecular sieve, and/or membrane. Ethanol extraction may also be used to reduce the ethanol concentration in the recycle streams.
US09126122B2

The presented cell phone-enabled doll companion allows a child novel ways to self-select and self-execute applications while requiring no intervention or supervision from the parent. Further, it provides learning, entertainment and safety by integrating cell phone communication, education, entertainment, alert and monitoring systems. While providing a convenient means of communication between the child and parent, the system allows surveillance of a child's real-time environment, GPS monitoring and SIDS/health monitoring. The functionality and the physical elements of the system are programmable through installation of applications downloadable from an application store. Various options for parental access to a configuration interface to modify settings and download applications are provided, including via a cell phone, a website, customer service call center and/or the doll companion touch screen.
US09126117B2

A server device is connected with a player terminal that displays a game screen including a game content arrangement area in a manner capable of communicating information. The server device includes: a storage unit configured to store a plurality of pieces of game content including special game content; an arrangement unit configured to arrange game content in the game content arrangement area; a determination unit configured to determine whether the special game content is included in a plurality of pieces of game content; and a grant unit configured to grant a part of game content selected from the plurality of pieces of game content, or all of game content to a player when the special game content is not included, and to grant only a part of game content selected from the plurality of pieces of game content to the player when the special game content is included.
US09126114B2

An input terminal device of one example includes a CPU, and the CPU transmits operation data to a game apparatus executing game processing in response to an operation by a user. Furthermore, when a TV remote control button provided to the input terminal device is operated, the CPU sets a TV control mode capable of operating a television, to thereby display a TV remote controller image on an LCD of the input terminal device. By using this image, the user inputs operation data of the television.
US09126112B2

A display device for a gaming machine according to an embodiment of the present invention includes: a shutter assembly configured to cover and uncover the display panel at least in part, the shutter assembly including a first sliding door configured to move along a guide; and a driving unit configured to drive the first sliding door.
US09126107B2

A server includes a request receiving unit that receives request information from a terminal, a request processing unit that generates next screen information for displaying a next screen on the terminal in accordance with the received request information, a next screen transmitting unit that transmits the generated next screen information to the terminal, a judgment unit that judges whether the next screen information has been transmitted to the terminal, a presentation screen generation unit that, when it is judged that the next screen information has not been transmitted to the terminal, determines reward conditions regarding a predetermined reward based on a screen transition status in the terminal, and generates lottery presentation screen information for displaying a lottery presentation screen on the terminal based on the reward conditions, and a presentation screen transmitting unit that transmits the generated lottery presentation screen information to the terminal.
US09126106B1

A wagering game system and its operations are described herein. In some embodiments, the operations can include monitoring gaming-related events at a wagering game machine of the wagering game system to detect a promotion trigger event. The operations can also include determining information associated with the promotion trigger event, and providing the information associated with the promotion trigger event to a promotional content server of the wagering game system to cause the promotional content server to select promotional content based, at least in part, on the information associated with the promotion trigger event. The operations can further include receiving the promotional content from promotional content server in response to said providing the information associated with the promotion trigger event to the promotional content server, and presenting the promotional content at the wagering game machine.
US09126097B2

Systems and methods herein provide a snowboard rider with a manner for carrying a snowboard more easily to and from a lift. In one embodiment, a system includes at least one grasping means (e.g., a handle or a strap) affixed to a top surface of a snowboard. The system also includes an attachment means for affixing the grasping means to the top surface of the snowboard. The grasping means allows a snowboarder to grab the snowboard to carry the snowboard and more easily transport it. The grasping means may also allow the snowboarder to perform certain tricks (e.g., by grabbing the grasping means in air).
US09126088B2

An activity meter includes a body movement detecting unit, a display unit, a target activity amount acquiring unit, an accumulated activity amount calculation unit, an excess activity amount calculation unit, a converted value calculation unit that calculates a converted value representing an excess amount of activity by dividing burned calories corresponding to the excess amount of activity by a unit calorie count, where a standard calorie count of a predetermined food is the unit calorie count, and a display operation control unit that controls a display operation of the display unit such that the display unit displays a measurement result using the converted value.
US09126083B2

Multi-piece golf balls containing a dual-core structure are provided. The core structure includes an inner core (center) comprising a foam composition, preferably foamed polyurethane. The outer core layer is preferably formed from a non-foamed thermoplastic composition such as ethylene acid copolymer ionomer. Preferably, the specific gravity (density) of the foam inner core is less than the density of the outer core layer. The ball further includes a cover of at least one layer and may include at least one casing layer. The core structure and resulting ball have relatively good resiliency.
US09126076B2

A fitness power generation bicycle includes: a bicycle gymnastic device, comprising a main frame and a drive sprocket pin-jointed with the main frame; a generator located on the main frame, comprising a shaft and a driven sprocket fixed on the shaft; a chain connecting the drive sprocket with the driven sprocket; a battery electrically connected with the generator for storing an electric energy from the generator; and an inverter electrically connected with the battery for adjusting an output current of the battery. The above-mentioned fitness power generation bicycle combines the fitness with power generation, which not only makes the user take exercise, but also stores the energy from the exercise, thereby achieving the environmental protection.
US09126072B2

A free weight system for collecting and transmitting exercise related data from a free weight device includes a free weight handle assembly having a gripping portion and a weight receiving portion, one or more weight plates positionable on the weight receiving portions, and a data collecting mechanism at least partially enclosed within an internal cavity of the free weight handle assembly. The data collecting mechanism includes a weight identification mechanism that identifies the weight of the one or more weight plates.
US09126067B2

A safety assembly for containers and conduits for combustible fluids comprises a casing that contains an extinguishing substance and is crossed by a thermolabile conduit. The conduit is open to the outside through an outlet hole and is open to the inside of a container or a conduit, through an inlet hole.
US09126061B2

Antioxidant cosmetic skin care compositions formulated to combat conditions associated with free radical damage and oxidative stress are provided. The compositions contain effective amounts of one of several active agents, including an agent derived from one or more of the plant species: Lycium barbarum, Punica granatum, Vitis vinifera, Aspalathus linearis, and Camellia Sinensis as well as cosmetically acceptable carriers. These cosmetic compositions find use in improving the appearance of aged or damaged skin.
US09126050B2

Energy is transmitted noninvasively to a patient using electrode-based stimulation devices or magnetic stimulation devices that are designed to non-invasively stimulate nerves selectively. The devices produce impulses that are used to treat atrial fibrillation, by stimulating a vagus nerve of a patient. The devices are also used to forecast the imminent onset of atrial fibrillation and then avert it by stimulating a vagus nerve.
US09126044B2

In various method embodiments for operating an implantable neural stimulator to deliver a neural stimulation therapy to an autonomic neural target, the method comprises using the implantable neural stimulator to deliver the neural stimulation therapy to the autonomic neural target, and evaluating an evoked response to the neural stimulation bursts. The neural stimulation therapy includes a plurality of neural stimulation bursts where each neural stimulation burst includes a plurality of neural stimulation pulses and successive neural stimulation bursts are separated by a time without neural stimulation pulses. Evaluating the evoked response includes sensing the evoked response to the neural stimulation bursts where sensing the evoked response includes sensing at least one physiological parameter affected by the neural stimulation bursts, comparing the sensed evoked response against a baseline, and determining if the evoked response substantially returns to the baseline between neural stimulation bursts.
US09126043B2

A patient feedback device for communicating with a programming device of an electrical stimulation system. The device includes a housing, a sensor, a controller, and a communication port. The sensor is supported by the housing and generates a sensor signal in response to an action from the patient. The controller is supported by the housing and is in operative communication with the sensor. The controller receives the sensor signal and sends information to the communication port based on the sensor signal. The communication port is connected to the housing and is in operative communication with the controller. The communication port receives information from the controller and wirelessly transmits a communication signal to the programming device of the electrical stimulation system.
US09126039B2

Systems and methods of use for guiding the flow of energy through a subject to stimulate tissue.
US09126033B2

Several embodiments of a battlefield defibrillation system (2) comprising external defibrillator (6) and at least one electrode (8) connected thereto are described. The system includes direct cardiac access (8), or indirect subcutaneous electrodes (30). The direct cardiac access electrodes (26) engage the heart muscle directly via the intercostal space. Indirect subcutaneous electrodes are positioned under patient's skin. Several design features are implemented to aid precise electrode positioning and facilitate system operation by an untrained personnel.
US09126025B2

Various methods for optimizing coating of medical devices, such as balloon catheters are disclosed. One method configures catheter balloon folds based on balloon diameter and volume. Other methods include using a specifically-sized protective sheath, using a vacuum, using pressure, pulling the balloon through a coating solution, using at least one spacer or a wick between at least one fold for metering a therapeutic coating into the folds of the balloon, placing an intermediate layer between the balloon and the therapeutic coating, placing a soluble film having a therapeutic agent around the catheter balloon or inside the folds, and any combination thereof. Balloon catheters and catheter balloons having a specific folding configuration, a specifically-sized protective sheath, an intermediate layer, or a soluble film are also disclosed.
US09126019B2

A body (2) for a catheter or sheath is disclosed. The body (2) includes strips (8, 10) formed longitudinally from the proximal (6) portion of the body (2) to the distal (4) portion of the body (2). The strips are formed of different materials. The strips can have different radiopacities, or can be splittable/peelable. The splittable/peelable body comprises a peel mechanism longitudinally extending along its respective length. The peel mechanism can be formed by longitudinally extending regions of interfacial bonding between first and second longitudinally extending strips of polymer material. A region of stress concentration extends along the region of interfacial bonding. The stress concentration facilitates the splitting of the body (2) along its peel mechanism. The polymer material of the first strip (8) can have a greater amount of radiopaque filler than the polymer material of the second strip (10). Each strip forms at least a portion of an outer circumferential surface of the body (2).
US09126018B1

Disclosed is an arterial access sheath for introducing an interventional device into an artery. The arterial access sheath includes an elongated body sized and shaped to be transcervically introduced into a common carotid artery at an access location in the neck and an internal lumen in the elongated body having a proximal opening in a proximal region of the elongated body and a distal opening in a distal region of the elongated body. The internal lumen provides a passageway for introducing an interventional device into the common carotid artery when the elongated body is positioned in the common carotid artery. The elongated body has a proximal section and a distalmost section that is more flexible than the proximal section. A ratio of an entire length of the distalmost section to an overall length of the sheath body is one tenth to one half the overall length of the sheath body.
US09126017B2

A needle guard clip assembly has a clip and a spring, the clip having a first wall with a needle passage therethrough, a generally parallel second wall, a strut connecting the two walls, and a heel extending from the first wall. The walls, strut, and heel are an integral piece. The spring is associated with and extends from the first wall.
US09126008B2

The present invention discloses a catheter and method of using a catheter with two balloons and at least one inlet opening located on the proximal end of the catheter. The two balloons are adapted to retain the catheter within the body cavity and facilitate the flow of gases and fluids into one or more inlet openings. The invention also provides inlet openings located at different levels of the catheter tube to allow for complete drainage of fluid from the body cavity. The unique design of the present invention provides complete drainage of a body cavity and reduces damage and trauma to the body cavity.
US09126007B2

A catheter balloon with integral non-distending regions having a plurality of layers which wind around the balloon material and overlap to form an angle of between 45 and 90 degrees relative to each other upon inflation, and methods of making the non-distending regions are provided.
US09126003B2

A cuff-equipped tube formed by providing a cuff to the outer periphery of a flexible tube, the cuff being expanded by introducing an operation fluid thereinto or being contracted by discharging the operation fluid therefrom. The cuff is provided with a cuff affixing portion expanded outward by the introduction of the operation fluid thereinto, and also with one mounting portion and the other mounting portion that are mounted to the outer peripheral surface of the tube. The connecting portions of the cuff affixing portion and the one mounting portion is affixed in a constricted shape to the outer peripheral surface of the tube, and the connecting portions of the cuff affixing portion and the other mounting portion is affixed in a constricted shape to the outer peripheral surface of the tube.
US09126001B2

Various embodiments of the present disclosure provide systems, methods and devices for respiratory support. As one example, a ventilation system is disclosed that includes a computer readable medium including instructions executable by a processor to receive a measured pressure value and a net flow value. A patient effort value is calculated based on a relationship between patient effort, the measured pressure value and the net flow value. The instructions are further executable to calculate a gas delivery metric that varies as a function of the patient effort value. Gas is then caused to be delivered consistent with the gas delivery metric.
US09126000B2

An artificial ventilation apparatus includes: a connecting portion which is connected to a respiratory system of a patient; an inspiratory circuit which is a flow path for flowing a gas from a ventilator to the connecting portion; an expiratory circuit which is a flow path for guiding a gas exhausted from the connecting portion to an exhaust portion of the ventilator; an expiratory valve which blocks a flow of a gas from the exhaust portion toward the connecting portion; a carbon dioxide concentration sensor which is disposed in a circuit that is provided at a downstream side of the expiratory valve and which detects a carbon dioxide concentration; and an alarm outputting unit which outputs an alarm based on an output of the carbon dioxide concentration sensor.
US09125999B2

Dry powder inhaler dose counters capable of making a display move swiftly between digits, in contrast to the progressive movement that occurs in simple gearing mechanisms.
US09125990B2

The present invention relate to a method and corresponding apparatus for just in time mixing of a solid or powdered formulation and its subsequent delivery to a biological body. In some embodiments, a powdered formulation is maintained in a first chamber. A bi-directional electromagnetic actuator is in communication with the chamber. The actuator, when activated, generates a pressure within the first chamber. The pressure results in mixing of the powdered formulation and a diluent in time for delivering into the biological body.
US09125987B2

Structures and protocols are presented for configuring an unmanned aerial device to perform a task, alone or in combination with other entities, or for using data resulting from such a configuration or performance.
US09125981B2

Fluid and power cartridges, including a housing with at least one side wall and an end wall, a needle, a power source carried by the housing and positive and negative power contacts associated with the housing and operably connected to the power source, and apparatus including such fluid and power cartridges.
US09125979B2

Methods are provided for associating a specific one of two or more distinct fluid transfer ports of a patient with a given fluid transfer event of fluid from a parenteral fluid delivery device. Aspects of the methods include establishing a fluid transfer connection between the parenteral fluid delivery device and the patient via one of the two or more distinct fluid transfer ports and transmitting a fluid transfer signal between the parenteral fluid delivery device and a patient associated identifier using the patient's body as a signal conduction medium. Association may result in identification of the fluid transfer port that will be, is being or has been employed for the given fluid transfer event. Also provided are systems for practicing methods of the invention.
US09125975B2

A storage assembly is removably connectable to a drug delivery device. A first chamber is disposed in the housing. A plurality of penetrating members are stored in the first chamber. A second chamber is disposed in the housing for storing the plurality of penetrating members after being used in an injection. A transfer drum disposed in the housing transfers one of the penetrating members from the first chamber to an injection position and from the injection position to the second chamber following an injection.
US09125967B2

The present invention provides a highly-sintered fluorapatite glass-ceramic comprising a high Ca/Al or Sr/Al mole-ratio, that possesses a microstructure that induces apatite/bone deposition.
US09125963B2

A wound dressing for covering a wound includes a textile layer woven by polyacrylonitrile-based activated carbon fiber, and an absorbent layer provided on one side of the textile layer away from the wound. The activated carbon fiber is produced by polyacrylonitrile oxidized fiber in a moisturized carbon dioxide atmosphere at the temperature of 700° C. to 1200° C. for 1 to 60 minutes. The material of the absorbent layer is cotton, alginate, poly vinyl alcohol, or a combination thereof. The water absorbing ability of the absorbent layer is superior to that of the textile layer. Because the textile layer does not produce dust and can keep dry, the hard-to-heal wounds can be prevented.
US09125960B2

A portable gas transfer device for sterilization at a sterilization site includes: a housing; a pressurized gas canister held by the housing; a first passageway in fluid communication with the pressurized gas canister and configured to supply pressurized pre-sterilization gas from the pressurized gas canister to the site; a gas discharge canister held by the housing; and a second passageway in fluid communication with the gas discharge canister and configured to supply post-sterilization gas from the site to the gas discharge canister. Additional related devices, systems and methods are provided.
US09125957B2

An appliance for disinfecting hand-held devices each having a surface that is contacted manually when the device is in use, composed of: a source of disinfecting radiation; and a conveyer system operative to convey the devices past the source with the top and/or bottom surfaces of each device facing the source, wherein the conveyor system is composed of a plurality of hollow, transparent rollers; and the source of disinfecting radiation includes a plurality of lamps, each housed in a respective one of the transparent rollers.
US09125946B2

The present invention provides compositions and methods for the targeted delivery, release and/or formation of a drug compound at a target site(s) within the body of an individual, such as a diseased and/or inflamed tissue in the body of the individual. These compositions may comprise a halogenated phenol ring cleavably linked to a core structure of a drug compound. Due to the variety of substituents that may be utilized in forming the different types of linkages, numerous examples of drug compounds linked to a halogenated phenol ring are proposed. The present invention further provides compositions comprising halogenated phenol starting compounds that do not undergo cleavage during a dehalogenation reaction to form a drug compound in a targeted tissue when administered to an individual. Methods of administering these non-cleaving compounds are further provided.
US09125944B2

Provided are a BAB-type tri-block copolymer including a polylactic acid (A) that is a hydrophobic block and polyethylene glycol (B) that is a hydrophilic block, a method of preparing the BAB-type tri-block copolymer including synthesizing a polylactic acid (A)-polyethylene glycol (B) di-block copolymer by a ring opening polymerization of a lactic acid monomer using a hydroxyl group of polyethylene glycol (B) as a polymerization initiator; and synthesizing a BAB-type tri-block copolymer by reacting the AB-type di-block copolymer with polyethylene glycol (B) including at least one carboxyl group at one or more terminals thereof in the presence of a coupling agent and a catalyst, and a drug delivery system using the BAB-type tri-block copolymer.
US09125942B2

The present invention provides compositions and methods for the synthesis of conjugates of paramagnetic metal ions and nanodiamonds, and uses thereof. In particular, the present invention provides synthesis of paramagnetic metal-nanodiamond conjugates and methods using such compositions as molecular imaging probes.
US09125937B2

The present invention relates to the compound of formula (I): in which R1 represents a hydrogen atom, an optionally labelled halogen, a radionuclide or a Sn[(C1-C4)alkyl]3 group, Ar represents an aryl group or a heteroaryl group, R9 represents a hydrogen atom, a (C1-C4)alkyl group or forms together with the group R1—Ar a ring fused with the Ar group, A represents a group of formula (β) or (δ): R3 and R4 independently represent a hydrogen atom, a (C1-C6)alkyl group, a (C1-C6)alkenyl group or a group of formula (γ): —Y—Z—W—R11  (γ) wherein R11 represents an optionally labelled halogen, a radionuclide, an aryl or heteroaryl group optionally substituted by an optionally labelled halogen, a radionuclide, a —NO2 group, a —NR5R6 group, a —N+R5R6R7X− group, or a —OSO2R12 group, and their addition salts with pharmaceutically acceptable acids. The present invention also relates to pharmaceutical compositions comprising them and to their use in diagnosis, in particular with SPECT or PET imaging and in therapy of melanoma via targeted radionuclide therapy.
US09125936B2

Ginger extract compositions containing 25 to 30% b.w. [6]-gingerol, 5 to 10% b.w. [8]-gingerol, 5 to 10% b.w. [10]-gingerol, 1.5 to 4% b.w. [6]-shogaol, 0.3 to 1.3% b.w. [8]-shogaol, 0.03 to 1% b.w. [10]-shogaol and 0.01 to 1% b.w. zingerone, with the amount of gingerols totaling 35 to 50% b.w. and the amount of shogaols totaling 1.5 to 6% b.w.
US09125930B2

The present invention concerns a nucleotide aptamer having the sequence 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
US09125929B2

The invention provides a method of reducing injury to cells, tissues or organs of a body following trauma by administering a composition to the body following trauma, including: (i) a potassium channel opener or agonist and/or an adenosine receptor agonist and (ii) a local anaesthetic. Also provided is a composition for reducing injury to cells, tissues or organs of a body following trauma including: (i) and (ii). The composition may be hypertonic.
US09125915B2

The invention provides a method of inhibiting binding between acetylated histone and a bromodomain-containing protein in a mammal, as well as a method of shrinking or killing of cancer cells expressing a bromodomain-containing protein or inhibiting the growth of cancer cells expressing a bromodomain-containing protein in a mammal. The methods involve administering an effective amount of (S)-2-[4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]-N-(4-hydroxyphenyl)acetamide or a dihydrate thereof to the mammal.
US09125908B2

1-[2-(2,4-dimethylphenylsulphanyl)phenyl]piperazine exhibits potent activity on SERT, 5-HT3 and 5-HT1A and may as such be useful for the treatment of cognitive impairment, especially in depressed patients.
US09125906B2

Compositions and methods of using cells derived from umbilical cord tissue, to stimulate and support angiogenesis, to improve blood flow, to regenerate, repair, and improve skeletal muscle damaged by a peripheral ischemic event, and to protect skeletal muscle from ischemic damage in peripheral vascular disease patients are disclosed. In particular, methods of treating a patient having a peripheral vascular disease with umbilical derived cells and fibrin glue are disclosed.
US09125897B2

The present invention relates to therapeutic protocols and pharmaceutical compositions designed to treat and prevent cancer. More specifically the present invention relates to a novel method of treating cancer using antagonists to the endothelin B receptor (ETB) or inactive mimic forms of endothelin-1. The pharmaceutical compositions of the invention are capable of selectively inhibiting the early events associated with the development of cancer. The present invention further relates to screening assays to identify compounds which inhibit ETB activation.
US09125893B2

The present invention relates to a highly concentrated solution preparation of antagonistic anti-CD40 antibody, in which occurrence of turbidity or insoluble foreign matter attributed to antibodies is suppressed to a level equivalent to that of the conventional low-concentration lyophilized preparation.
US09125890B2

The present invention relates to Von Willebrand (VWF) compounds as well as compositions suitable for treatment of blood clotting diseases. The present invention also relates to pharmaceutical compositions, freeze-dried or liquid, comprising (i) a Factor VIII molecule and (ii) a VWF compound.
US09125875B2

Use of the antimicrobial cathelicidin peptide II-37, N-terminal fragments of LL-37 or extended sequences of LL-37 having 1-3 amino acids in the C-terminal end, for stimulating proliferation of epithelial and stromal cells and thereby healing of wounds, such as chronic ulcers. The cytotoxic effect of LL-37 may be reduced by including a bilayer-forming polar lipid, especially a digalactosyldiacylglycerol, in pharmaceutical compositions and growth media comprising LL-37.
US09125872B2

A polyethylene glycol (PEG) aerogel particles having an average particle diameter not substantially above about 2μ, a volumetric porosity of greater than about 50%, and pore sizes capable of retaining drug molecules. A method for preparing such polyethylene glycol (PEG) aerogel particles includes initiating a catalyzed reaction using a catalyst of PEG forming ingredients to form PEG particles; partially drying the formed PEG particles under conditions to control pore size; and subjecting the partially dried formed PEG particles to CO2 supercritical extraction for form the PEG aerogel particles. Drug molecules include chemotherapeutic agents. The surface of the PEG aerogel particles are reactable with a variety of agents, for example, to selectively target tumors, protects irreversible damage to labile proteins, and protects degradation of sensitive drugs with subsequent loss of biological efficacy.
US09125861B2

Methods and compositions (such as pharmaceutical compositions) for treating influenza virus type A infections in human subjects include PAR2 agonists being administered to the subject. The PAR2 agonists include small organic molecules, antibodies, and aptamers. In addition, the PAR2 agonist may be a PAR2 activating peptide. Exemplary PAR2 activating peptides include SLIGRL (SEQ ID NO: 1) and SLIGKV (SEQ ID NO: 2).
US09125860B2

An oral care composition for treating or preventing calculus comprising an anticalculus agent and an antibacterial agent comprising a biphenol compound obtainable from Magnolia officinalis, wherein the composition is free of phosphate-containing anticalculus agents.
US09125842B2

The object of the invention is a ready to use coloring composition containing at least 0.02 wt % of at least one compound chosen from the group consisting of catechins, gallic acid, gallates, and mixtures thereof, together with a silver salt, and a product for simultaneous or timewise separate use comprising two components A and B.
US09125840B2

The present specification discloses fluid compositions comprising a matrix polymer and stabilizing component, methods of making such fluid compositions, and methods of treating skin conditions in an individual using such fluid compositions.
US09125833B2

The present invention is in the field of oral, abuse resistant pharmaceutical compositions of opioid agonists, extended release pharmaceutical compositions of opioid agonists and extended release abuse resistant pharmaceutical compositions of opioid agonists and the use thereof. The present invention is also directed to extended release pharmaceutical compositions and the use thereof for preventing or minimizing the risk of abuse and/or toxicity from either intentional or unintentional tampering. The present invention is further directed at a method of preventing or minimizing the risk of abuse and/or toxicity from either intentional or unintentional tampering.
US09125823B2

The present invention relates to a controlled release pharmaceutical or food formulation comprising at least one active pharmaceutical or food ingredient dispersed in a mixture of a glycogen with a polysaccharide, and the process for its preparation. The invention also relates to a slow release system represented by a mixture of a glycogen with a polysaccharide, and its use for the preparation of slow release pharmaceutical or food formulations.
US09125820B2

The present invention is related to uses of a composition comprising a pharmaceutically active component and a compound according to formula (I), wherein R1 and R2 are each and independently selected from the group comprising alkyl; n is any integer between 1 and 4; R3 is an acyl selected from the group comprising lysyl, ornithyl, 2,4-diaminobutyryl, histidyl and an acyl moiety according to formula (II), wherein m is any integer from 1 to 3 and Y− is a pharmaceutically acceptable anion.
US09125819B2

The present invention relates to an activated foam made of a natural or synthetic rubber or a synthetic resin, characterized in that the foam contains a zirconium compound and/or a germanium compound, and has a closed-cell structure, wherein the foam is used so as to directly or indirectly contact with a human body when a pharmaceutical agent is administered. The activated foam can be directly or indirectly contacted with a human body to facilitate blood circulation and promote the improvement of physical condition and the cure of diseases. It also has no adverse effect.
US09125815B2

The present invention relates to an agent for dyeing and/or bleaching keratinous fibers, comprising: a water-in-oil emulsion (A) comprising one or more basifying agents, water, one or more surfactants having an HLB of less than 8, chosen from oxyalkylenated and/or glycerolated nonionic surfactants, and from 30 to 70% by weight, with respect to the total weight of the emulsion (A), of one or more oils not comprising a carboxylic acid functional group, and a second composition (B) comprising one or more oxidizing agents, the total amount of oil(s) not comprising a carboxylic acid functional group in the mixture of the emulsion (A) and of the composition (B) representing at least 20% by weight, with respect to the total weight of the mixture of these two compositions. The present invention also relates to a method for dyeing and/or bleaching keratinous fibers employing such an agent and to a kit comprising it.
US09125812B2

The invention relates to glass ceramics based on the lithium metasilicate system (Li2OSiO2(Li2SiO3)), which are mechanically processible in a simple manner in an intermediate stage of the crystallization and, after complete crystallization, represent a high-strength, highly translucent and chemically stable glass ceramic.
US09125804B2

The invention relates to a solid or liquid pharmaceutical composition comprising botulinum neurotoxin complex (type A, B, C, D, E, F or G) or high purity botulinum neurotoxin (type A, B, C, D, E, F or G), and a surfactant. In particular the invention relates to a solid or liquid pharmaceutical composition comprising a crystalline agent.
US09125803B2

Disclosed are pharmaceutical products for providing pulses of at least one pharmaceutically active ingredient from a patient's stomach, or from a subsequent gastrointestinal site proximal thereto, for absorption thereof at a site(s) more distal in the gastrointestinal tract than the patient's stomach, or than the subsequent gastrointestinal site proximal thereto. The product comprises first, second, and third pharmaceutical dosage forms, each of which comprises at least one pharmaceutically active agent and a pharmaceutically acceptable carrier. The product is formulated such that at least two of the first, second, and third pharmaceutical dosage forms further comprise means for providing temporary gastric-retention of the at least two of the first, second, and third pharmaceutical dosage forms within the patient's stomach, or at the subsequent gastrointestinal site proximal thereto.
US09125801B2

Devices, systems and methods are disclosed for providing a direct visual indication of the relative inflationary condition of the balloon on a balloon catheter after insertion into the patient. In certain exemplary embodiments, a gastrostomy tube catheter is disclosed having a fluid feeding lumen and a balloon inflation lumen, a balloon communicating with the balloon inflation lumen, and an indicator strip having one end fixedly attached to the balloon and a free end movable along the length of the tube in accordance with the relative inflation and deflation of the balloon. The presence of the free end of the strip along an exposed portion of the gastrostomy tube serves as a direct visual indicator of a deflated condition of the balloon.
US09125798B2

Systems and methods are provided for determining whether and/or when a patient is taking his or her medication and, when appropriate, providing reminders and/or alerts to the patient to improve adherence to a medication regimen. In some embodiments, a medication container is provided that includes a capacitance sensor for sensing the contents of the medication container (e.g., pill count or quantity of liquid medication). The capacitance sensor may include interleaved or interdigitated electrodes oriented vertically, horizontally, or angularly (e.g., diagonally) relative to an axis of the medication container. Reminders and/or alerts to the patient may be triggered based at least in part on the contents of the medication container, when a cap of the container was last opened and/or closed, the location of the medication container, and/or the container's surroundings.
US09125797B2

A programmable system to visually indicate a predefined tablet to be consumed at a predefined time is provided. The programmable system includes a plurality of sections each corresponding to one of a plurality of tablets in a tablet strip, a wired interface or a wireless interface coupled to the plurality of sections. The wired interface or the wireless interface receives a set of instructions that include a set of sections and their corresponding times from a programming device. A memory stores the set of instructions. A timer tracks time and generates a message based on the set of instructions. A controller generates an electrical stimulus and communicates the electrical stimulus to a first section of the plurality of sections at a first time based on the set of instructions. The first section is modified visually at the first time in response to the electrical stimulus.
US09125786B2

The present invention is a device and method to manipulate soft tissues such as tendons using a manipulator that works in conjunction with an orthopaedic device, such as a brace. The manipulator can be an electro-mechanical device. The manipulation can alleviate symptoms of soft tissue dysfunctions such as carpal tunnel syndrome, wrist tenosynovitis and tendonitis, cubital tunnel syndrome, neck tendonitis, plantar fasciitis, and Achilles tendonitis. Manipulation alleviates the inflammation and pressure and the concomitant associated pain and other symptoms of the dysfunction. The manipulation, combined with the orthopaedic aspect of the device, allows the limb to rest and recover between manipulative treatments in a suitably stationary position.
US09125785B2

A patient support apparatus generally includes a base frame and a support deck supported on the base frame, the support deck comprising a seat portion. A segmented patient support surface is slidably coupled to the support deck. A lift system is coupled to the support deck and the segmented patient support surface. The lift system raises, lowers and tilts the support deck with respect to the base frame, and pivots a torso support segment of the support surface with respect to a leg support segment of the support surface. A foot plate assembly is removably positioned proximate a free end of the support deck, the foot plate assembly receiving a patient's feet when a patient is positioned on the segmented patient support surface thereby enabling the patient to slide the segmented patient support surface relative to the support deck.
US09125781B2

A novel technique for the fabrication of a casket dome lid from, for example, Smooth-One-Side (“S1S”) hardboard is disclosed. The invention is also directed to the fabrication of a casket lid which has a domed configuration both in the lateral and longitudinal directions of the lid. The method comprises the steps of providing a lid blank having a first end, second end, and a central region; providing a pair of diagonal voids oriented at corners of the first end of said blank and extending inward toward the central region; placing the lid blank in a vacuum fixture; and flexing the lid blank into a domed configuration via the vacuum fixture, such that the blank is domed in both a longitudinal and a transverse direction.
US09125780B2

An infant incubator including: an infant chamber in which an infant is placed; an air-supply passage for supplying supply-air to the infant chamber; and a heater equipment for heating the supply-air having a mount base which is mounted in the air-supply passage and a heater which is held to the mount base rotatably, wherein the heater has: a support part provided at a base end of the heater and supported by the mount base rotatably; and a heating part provided at a top end of the heater and heating the supply-air, and the heating part is formed by winding a heating-wire into a coil-shape and disposed so that an axial direction of the coil-shape is orthogonal to a flow direction of the supply-air passing through the air-supply passage.
US09125773B2

A disposable diaper has a central elastic member formed along the lengthwise direction L so that the absorber can be curved to be convex in the inward direction, and a pair of side slits formed along the lengthwise direction L so that the absorber can be curved to be convex in the outward direction. A thickness of the absorber at the central portion and at the side edge portions are smaller than a thickness of the absorber at the middle portions.
US09125767B2

Systems and apparatuses for administering reduced pressure treatment to a tissue site including a wound filler for positioning adjacent a wound site on a patient. The wound filler includes at least one strand having a plurality of nodes positioned along a length of the strand. The at least one strand has a charged state and an uncharged state. In the charged state, the at least one strand includes a stored energy that when released would deform or move the at least one strand. In the discharged state, the stored energy has been released. The wound filler further includes a removable sheath encasing the at least one strand. The at least one strand transitions from the charged state to the uncharged state as the removable sheath is removed.
US09125761B2

The present invention is directed to an endoscopic stent delivery device. The device includes an endoscope having an elongate shaft including a proximal end, a distal end, an outer wall and a longitudinal working channel through the elongate shaft defining an inner wall of the elongate shaft; a stent juxtaposingly disposed to a distal portion of the inner wall; and an inner tubular member slidably disposed within the working channel and having a stent holding member engaging an interior portion of the stent for releasably securing the stent to the distal portion of the inner wall. The device may further include a viewing device disposed at the distal end of the endoscope and/or an illuminating device disposed at the distal end of the endoscope.
US09125752B2

A urine collection apparatus is disclosed to include an expandable bag connected to a urinary catheter, the bag being adapted to receive urine expelled from the person using the apparatus. The apparatus also has a check valve associated with the bag, which opens to admit gas to the interior of the bag to equilibrate the pressure within the bag with the pressure of the surrounding atmosphere whenever a partial vacuum occurs in the bag.
US09125738B2

A prosthetic valve for replacing an atrioventricular heart valve comprises an annular body (2) on which valvular cusps are fastened and which is adapted to be inserted into a valve annulus (18) of the heart (20). The annular body has a plurality of anchor elements which are connected thereto on the ventricle side and optionally other anchor elements which are connected to the annular body on the atrium side. Said anchor elements extend radially outside the annular body and substantially parallel to its outer wall.
US09125729B2

A buoyancy-based cervical traction system has a floatation and a head rest supported by the flotation system. The head rest is adapted to support a person's head above the neck and apply traction to the neck when the person is in a body of liquid. The system has a position adjustment system adapted to allow selective adjustment of the position at which the person's head rest will be relative to an upper surface of the liquid when the person and the cervical traction system are in the liquid, the person's head is supported by the head rest, and the cervical traction system and person are floating in the liquid at equilibrium.
US09125726B2

A mechanism for removing a fluid-filled object from a patient. The apparatus includes a deflation tube with a puncture member at one end of the tube for piercing a hole in the object wall. The apparatus includes a retrieval mechanism slidable within the deflation tube lumen. The retrieval mechanism includes an expansion element that is expandable when positioned within the object from a first configuration with a dimension less than that of the deflation tube lumen to a second or deployed configuration with a dimension that is greater than an outer dimension of the puncture member. The expansion element contacts an inner surface of the inflatable object as the deflation tube and retrieval mechanism are withdrawn from the body cavity. The expansion element may be a T-bar, a foldable anchor, an inflatable member, or another expandable form.
US09125719B2

Absorbable polyester fibers, braids, and surgical meshes with prolonged strength retention have been developed. These devices are preferably derived from biocompatible copolymers or homopolymers of 4-hydroxybutyrate. These devices provide a wider range of in vivo strength retention properties than are currently available, and could offer additional benefits such as anti-adhesion properties, reduced risks of infection or other post-operative problems resulting from absorption and eventual elimination of the device, and competitive cost. The devices may also be particularly suitable for use in pediatric populations where their absorption should not hinder growth, and provide in all patient populations wound healing with long-term mechanical stability. The devices may additionally be combined with autologous, allogenic and/or xenogenic tissues to provide implants with improved mechanical, biological and handling properties.
US09125713B2

A dispenser includes a dispenser body and a sleeve carried by the dispenser body, wherein the sleeve includes a sleeve opening. A card, such as a business card, is repeatably moveable through the sleeve opening. The dispenser includes a dental floss recess for receiving dental floss. The sleeve covers the dental floss recess.
US09125710B2

Disclosed within is a dental restorative system including a dental abutment having a longitudinal axis, lingual and facial aspects, a base portion for engagement with a dental implant, and a tapered coronal portion. The dental abutment further includes an emergence profile portion between the base portion and the tapered coronal portion. The emergence profile portion includes at least a first concave surface and at least a first convex surface. The dental abutment may further include an interproximally sloping margin shoulder and a reduced terminal portion located at the upper end of the tapered coronal portion. Alternative embodiments of the dental abutment are also disclosed.
US09125703B2

A compressor/distractor system for operating on a spine is disclosed. The system includes two rod reducers which each advance a spinal rod into the shoulder portion of a pedicle screw. Each rod reducer includes an inner member, an outer member, and a pair of gripping members. Each outer member receives and advances the spinal rod into the pedicle screw. The outer member also includes a through slot which receives the proximal end of each of the pair of gripping members which may limit the longitudinal translation of the outer member with respect to the inner member. The compressor/distractor system may include a compressor/distractor device which has a compressing, a distracting, and a neutral configuration. A method for using the minimally invasive rod reducers with the compressor/distractor system to secure at least two pedicle screws in desired positions on a spinal rod is also disclosed.
US09125699B2

Systems for reducing a fracture in a bone, comprising a bone plate and a polyaxial fastener. In some examples the head of the polyaxial fastener has a deformable portion. As a fastener is inserted into an opening of a bone plate, threads located within the opening deform the deformable portion to secure the fastener in place at a desired angle within the opening. The head of the fastener also includes a bottom portion that bears against a portion of the opening to move the bone plate relative to the underlying tissue. A securing member or other structure may be included at the interface of the head and the deformable portion to secure the deformable portion to the head. At least one flute may be included on the deformable portion that provides a lead-in for the threads within the opening to cut into the deformable portion.
US09125696B2

The osteosynthetic device for the fixation of a bone or bone fragments has a longitudinal axis (6) and comprises a bone screw (1) with a shaft (2) bearing a thread (3), a front end (4) and a rear end (5), said thread (3) having a maximum outer diameter d; and a wing-like blade (7) with a leading end (8) being connected to the front end (4) of the bone screw (1) and a trailing end (9) being connected to the rear end (5) of the bone screw (1). The blade (7) is further provided with a coaxial longitudinal aperture (17) having a length I extending between the leading end (8) and the trailing end (9) and a width w≧d. Further the blade (7) is coaxially and rotatably mounted on said shaft (3) of said bone screw (1).
US09125690B2

A device and method for determining a position of a medical device or part of a patient's body uses first and second position detection devices to obtain first and second positions, respectively, of the medical device or part of the patient's body, wherein the first position detection device is separate from the second position detection device. A first priority is assigned to the first position and a second priority is assigned to the second position, wherein the first and second priority are based on at least one input variable, and the first and second priority define a first and second weight factor to be applied to the respective first and second position. The position of the medical device or part of the patient's body is determined from the combination of the first position and the first weight factor, and the second position and the second weight factor.
US09125675B2

A surgical template system for use in working on a bone comprises: a tool guide block comprising at least one guide aperture for receiving and guiding a tool to work on a bone; locating means comprising a plurality of locating members, each member having a respective end surface for positioning against a surface of the bone; and attachment means for non-adjustably attaching the tool guide block to the locating means such that, when attached, the member end surfaces are secured in fixed position with, respect to each other, for engaging different respective portions of the surface of the bone, and the at least one guide aperture is secured in a fixed position with respect to the end surfaces. Corresponding methods of manufacturing a surgical template system, methods of manufacturing locating means for a surgical template system, methods of fitting a prosthesis to a bone, surgical methods, and surgical apparatus are described.
US09125668B2

Devices, systems, and methods for performing ablation therapy on body tissue are disclosed. An example ablation device for treating body tissue includes an ionically conductive balloon and a radio-frequency electrode that delivers RF energy into a distal section of the balloon. The balloon is configured to transmit the RF energy in a direction distally towards a leading end of the ablation device. Multiple ablation electrodes on the device can be used for providing lesions of different size or shape.
US09125652B2

The disclosure relates to a drape with an opening and an attachment device on the first opening to affix the drape on a surgical microscope. The drape can include a second attachment device arranged on the opening to affix the drape on the surgical microscope.
US09125648B2

A coupling system includes an applicator tool and an attachment ring mounted on the applicator tool. Clips are contained within the applicator tool and are deployed through the attachment ring in order to anchor the attachment ring to biological tissue. When deployed, tips of the clips follow a curved trajectory through an annular cuff of the attachment ring and through the underlying tissue. The tips loop back out of the tissue and to a location where they are later trapped or clamped by the attachment ring. While the tips are trapped or clamped, the applicator tool cinches the clips by pulling rear segments of the clips. Thereafter, the applicator tool disconnects from the attachment ring which remains anchored to the tissue and serves as a coupling for a cannula. The cannula can have movable lock members that secure it to the attachment ring.
US09125645B1

An apparatus includes a housing, a drive gear assembly, and a drive arm. The housing defines a channel that receives a needle such that the needle is movable within the channel. The drive gear assembly is positioned within the housing and includes a first gear, a second gear, and a rack. The rack is translatable relative to the housing and is coupled with the first and second gears to rotate the first and second gears. The drive arm is coupled with the drive gear assembly and engages the needle to move the needle within the channel of the housing.
US09125634B2

A luminal cavity closing device can include a flexible shaft, a lid member, and a detachment mechanism. The flexible shaft extends in an axial direction. The lid member which is attached to a distal end of the shaft, can be rotated according to a torque transmitted from the shaft. Thus, a lock section can be thrust into a periphery of an opening of a luminal cavity formed in a living body lumen, to thereby lock the lid member to the periphery. The detachment mechanism can be configured to detachably attach the lid member to the shaft. The torque can be transmitted to the lid member, and the shaft can be detached from the lid member by the detachment mechanism while the lid member is locked to the periphery of the opening of the luminal cavity.
US09125631B2

Embodiments of the invention may be directed to apparatuses for securing and sealing tissue and related methods of use. The apparatus may include an outer housing defining a first lumen, an elongate member defining a second lumen, the elongate member being configured to be disposed in the first lumen, and a securing mechanism configured to secure tissue around a distal portion of the elongate member. The elongate member and the outer housing may be longitudinally moveable relative to each other.
US09125630B2

A patient monitoring system may be configured to acquire data signals relating to various physiological parameters of a patient. For example, the patient monitoring system may be used to determine or record a patient's blood pressure, heart rate, temperature, and/or other physiological parameters. The patient monitoring system may process the data signals and generate patient parameter information. The patient parameter information may be displayed on a display unit. The patient monitoring system may be configured to dynamically reconfigure a visual display of the patient parameter information based on the orientation (e.g., portrait or landscape) of the patient monitoring system. Additionally, the patient monitoring system may be configured to selectively enter a transport mode, in which the touch screen and/or user inputs are locked or partially locked. The patient monitoring system may automatically enter a transport mode when the display unit is rotated to a landscape orientation.
US09125627B2

A sensing insert device (100) is disclosed for measuring a parameter of the muscular-skeletal system. The sensing insert device (100) can be temporary or permanent. Used intra-operatively, the sensing insert device (100) comprises an insert dock 202 and a sensing module 200. The sensing module (200) is a self-contained encapsulated measurement device having at least one contacting surface that couples to the muscular-skeletal system. The sensing module (200) comprises one or more sensors (303), electronic circuitry (307), and communication circuitry (320). The electronic circuitry (307) operatively couples to the one or more sensors (303) to measure the parameter. A transmitter (309) transmits parameter measurements. An induction coil (1404) is coupled electromagnetically to a wireless energy source (1402). The induction coil converts electromagnetic energy waves to a signal that powers the sensing module (200). The signal includes information or data. The signal is demodulated to capture the data or information.
US09125616B2

A method includes obtaining both first inflow and first perfusion metrics for non-healthy tissue of interest, obtaining both second inflow and second perfusion metrics for healthy tissue of interest, and concurrently presenting both the first flow and perfusion metrics for the non-healthy tissue of interest and both the second flow and perfusion metrics for the healthy tissue of interest.
US09125614B2

An ultrasonic probe includes a piezoelectric element including a support body, a lower electrode layer, first and second piezoelectric layers, and an upper electrode layer. The support body has an opening section and a displacement section covering the opening section on one side of the support body. The lower electrode layer is disposed on the one side of the support body and continuously extending from an inside to an outside of the opening section when viewed in a plan view along a thickness direction of the support body. The first piezoelectric layer is disposed on the lower electrode layer and positioned inside of the opening section when viewed in the plan view. The upper electrode layer is disposed on the first piezoelectric layer. The second piezoelectric layer is disposed on the lower electrode layer and positioned outside of the opening section when viewed in the plan view.
US09125611B2

Disclosed herein is a mobile fluoroscopic imaging system, and methods of use. A table top imaging system can include a support, an x-ray source carried by the support, an x-ray detector carried by the support and positionable at a distance from the source; a primary x-ray propagation axis extending between the source and the detector. The distance between the source and the detector can be adjustable along the axis, and the axis can be angularly adjustable throughout an angular range.
US09125605B2

The calculation amount of the whole can be reduced. A biological signal measuring apparatus includes a biological signal measuring unit which measures a biological signal; and a calculation processing unit which performs calculation processes on the measured biological signal, wherein the calculation processing unit has: a first calculation processing unit which performs calculation processes required for calculating the biological signal, and which is independently controllable; and a second calculation processing unit which performs a specific calculation process, and which is independently controllable, and, when the first calculation processing unit satisfies given conditions, the second calculation processing unit is caused to perform the specific calculation process.
US09125580B2

An electrocardiography signal extraction method is performed on a processor of a computer system and includes receiving an electrocardiography signal, performing a time-frequency transformation on the received electrocardiography signal to generate a corresponding scalogram, selecting a predetermined R-pertinent scale, performing the time-frequency transformation at the selected predetermined R-pertinent scale to generate a R-pertinent summarized response, obtaining a R peak position, selecting a predetermined QRS-pertinent scale, performing the time-frequency transformation at the selected predetermined QRS-pertinent scale, obtaining a Q peak position and a S peak position of the electrocardiography signal by finding relative maximum negative responses before and behind the R peak position respectively, obtaining a QRSon position and a QRSoff position by finding relative minimum second derivatives of the responses before the Q peak position and behind the S peak position, respectively.
US09125576B2

A magnetically guided endoscopy capsule is separated from the surface of water with the aim of immersing the capsule completely in water, using the least possible magnetic force. A brief force curve (F_mag(t)) is thereby automatically generated on the capsule by a solenoid system, by one or more force pulses. Assuming that the capsule floats on the water surface at the start of the force curve, a force curve is applied generating an odd number of force pulses having a step profile. Each odd force pulse brings about at least a partial immersion of the endoscopy capsule in the liquid, and each even force pulse bring about at least a partial emersion of the endoscopy capsule out of the liquid.
US09125575B1

High resolution active matrix nanowire circuits enable a flexible and stretchable platform for probing neural circuits. Fabrication of such circuits includes forming an array of transistors using a semiconductor-on-insulator substrate. Electrically isolated arrays of vertically extending, electrically conductive wires are formed from a doped, electrically conductive layer within the substrate, each of the arrays of wires being electrically connected to a transistor in the array of transistors.
US09125574B2

Systems and methods for acoustic detection of coronary artery disease (CAD) and automated editing of heart sound data are provided.
US09125571B2

An x-ray imaging apparatus comprises a platform connected to a frame, a sliding bar, a detector mounted on the sliding bar, an x-ray source, and a control system. The x-ray source includes a collimator to generate an x-ray exposure window. The control system is configured to slide the detector along the sliding bar and synchronously move the collimator to direct the x-ray exposure window to the first detector. The x-ray exposure window movements are registered to the detector movements. The detector interfaces with a processor that processes x-ray image data received from the detector, and generates at least one x-ray image from the x-ray image data.
US09125569B2

An ABPI measurement system includes a cuff for each ankle and a cuff for each arm of a patient. Each cuff has first and second chambers. The four cuffs are applied to each limb (or finger or toe), each chamber is inflated simultaneously to a pressure until a Pneumo Arterial Plethysmography (PAPG) signal related to the arterial flow in the limb is detected at the chambers. The second chambers are then simultaneously inflated until the PAPG signals are extinguished in each limb, the inflation of the second chambers continuing for 10 mmHg to 20 mmHg above the extinguishing pressure. The second chambers are then deflated and the pressure in the second chamber at which the PAPG signal returns in the first chamber is recorded for each limb and this value of the pressure is used to calculate the ABPI. The ABPI is displayed or sent to a remote site.
US09125567B2

Apparatus is provided for reducing hypertension of a subject. A selective circumferential pressure applicator (60) includes at least two surfaces (61) that increase baroreceptor activity of the subject, by applying pressure to an artery (20) of the subject at two or more respective non-contiguous regions around the circumference of the artery, at a longitudinal site of the artery, such that between the non-contiguous regions, at the longitudinal site (a) there is at least one region (22) of the artery that is more relaxed than in the absence of the device, and (b) there is at least one region (21) of the artery that is more tense than in the absence of the device. A joint (63) couples the surfaces to each other. For at least a portion of the subject's cardiac cycle, the joint does not to contact the subject's artery. Other applications are also provided.
US09125563B2

An apparatus for electrically and mechanically coupling a connection portion of a sensor assembly with a connection portion of an interface cable is provided. The apparatus includes a frame having an EMI shielding material. The frame defines a first port operable to engage the connection portion of the sensor assembly and a second port operable to engage the connection portion of the interface cable. The frame includes attachment features operable to mechanically secure the connection portion of the sensor assembly and the connection portion of the interface cable relative to the frame. The frame is configured to provide a Faraday Cage around substantially all of the connection portion of the sensor assembly and the connection portion of the interface cable when the connection portions are in coupled configuration.
US09125558B2

A method for automating physiologic alerts with precedence order includes receiving at a mobile patient monitor interface, a first input expression indicative of a first parameter source for first patient parameters from a first medical device from a user. The method further includes receiving, at the mobile patient monitor interface, a second input expression indicative of a second parameter source for second patient parameters from a second medical device from a user. The method further includes modifying, at the mobile patient monitor interface, a precedence order of the first parameter source and the second parameter source. The method further includes evaluating, at the mobile patient monitor interface, a complex expression of the first patient parameters and the second patient parameters based on the precedence order to initiate display of at least one parameter, derived parameter, trend, or alert on a remote device.
US09125556B2

Systems and methods for performing robotic endoscopic surgical procedures, according to a surgical plan prepared on a preoperative set of three dimensional images. The system comprises a surgical robot whose coordinate system is related to that of fluoroscope images generated intraoperatively, by using a three dimensional target having radio-opaque markers, attached in a predetermined manner to the robot or to another element to which the robot is attached, such as the spinal bridge or an attachment clamp. The robot is mounted directly or indirectly on a bone of the patient, thereby nullifying movement of the bone, or a bone tracking system may be utilized. The coordinate system of the intraoperative fluoroscope images may be related to the preoperative images, by comparing anatomical features between both image sets. This system and method enables the endoscope to be directed by the robot along the exact planned path, as determined by the surgeon.
US09125552B2

A module for attachment to a medical instrument to scan the anatomy with a beam of radiation. The module comprising a housing suitable for insertion in the anatomy that includes a window and a fastener to attach the housing to a medical instrument, an oscillating reflector within the housing that directs a beam of radiation onto the anatomy, and a collector to receive radiation returned from the anatomy.
US09125541B2

A wash arm arrangement (20) for a dishwasher is disclosed which has a central arm (21) adapted to be rotatably connected with a first shaft (23) through which liquid under pressure is fed into said central arm during operation. A satellite arm (22) is rotatably connected with a second shaft (24) arranged on the central arm, and which is arranged separated a first radial distance rcs from the axis of rotation of the central arm. The second shaft supplies liquid to the satellite arm during operation. To provide the liquid to a washing area of the dishwasher, the satellite arm comprises at least one outer nozzle (25) for providing liquid to a washing area of the dishwasher. The centre of the outer nozzle is arranged at a second radial distance rn with respect to the axis of rotation for the satellite arm which is at least equal to the first radial distance rcs minus half the width of the nozzle in a radial direction, and at most equal to the first radial distance rcs plus half the width of the nozzle in a radial direction. Thereby, an alternative and improved wash arm arrangement which has a high coverage of the washing area is achieved.
US09125531B2

A grab bar is disclosed for use in a bathing area. The grab bar includes a longitudinal bar extending to a leg that includes a base configured to be secured to a wall. The leg includes a hole, and a fastener is receive in the hole and extends through the base to the wall. A seal is supported by the base and surrounds the hole to seal the grab bar relative to the wall. An insert is arranged in the hole for reinforcement and is in an interference relationship to the leg to provide a seal there with. A flexible washer is arranged between the fastener and the insert or leg to seal a head of the washer relative to the leg.
US09125514B1

A combination cookvessel and cookvessel-lid-and-handle device comprising a lid main portion having an offset handle member above the lid main portion. The offset handle member having a first end adjacent to and spaced above the lid edge, a gripping portion extending from the first end and over the lid main portion, a protrusion extending toward the lid main portion and engageable with the underside of the rim and a handle-connecting portion extending between the gripping portion and the lid main portion. The offset handle member suspends the cookvessel-lid-and-handle device on the rim above the open top of the cookvessel.
US09125507B2

A mail alert signaling device for use with a mailbox having a housing and door for receiving mail said device being attached at one of its ends to the exterior of the mailbox and having a signaling portion on the other end wherein an L-shaped member of the signaling portion reversibly couples with a lip portion on the mailbox to configure the device in standby mode, and when the door is opened die L-shaped member is dislodged from the lip portion thereby signaling mail delivery.
US09125481B2

A massage brush (10) includes a base plate (12) that is curved in a rounded shape, a plurality of pressing protrusions (13) that protrude downward from the concave-shaped inner surface of the base plate (12), and a grip portion (20) that is connected to the center portion of the convex-shaped outer surface of the base plate (12). The base plate (12) is provided with a plurality of tongue-like sections (14) arranged at intervals in a circumferential direction and extending outward in a radial direction from the center portion of the base plate (12). The tongue-like sections protrude in a cantilever shape from base end portions (15) of the center portion by the presence of U-shaped through grooves (16) provided around the tongue-like sections other than the base end portions (15). The pressing protrusions (13) protrude downward from the tip portions of the tongue-like sections (14). A center portion pressing protrusion (17) is provided in the center portion of the base plate (12), and an auxiliary pressing protrusions is provided at an intermediate portion between adjacent pressing protrusions (13).
US09125471B2

A cosmetic container includes a bottle, a cap unit and a magnetic member. The bottle is adapted for accommodating a magnetic nail polish having magnetic particles. The cap unit includes a cap body that removably covers the bottle, and a finger support that is mounted on the cap body. The magnetic member is mounted on the cap unit and includes a magnetic patterning portion. The magnetic member is disposed such that the fingernail of a finger that is supported on the finger support is proximate thereto, such that the magnetic patterning portion is able to attract the magnetic particles of the magnetic nail polish applied on the fingernail so as to forma corresponding pattern.
US09125467B2

A canopy organizer for organizing objects on an elongated and vertical support is provided. The organizer comprises a first fabric wall and a second fabric wall. Both walls are in contact with each other along the edges so as to form a pocket. Then, a filling is within the pocket formed by the first and second nylon walls and a flap is attached to the first wall along the length of the cover. The flap is configured to interface with a determined area along the opposite edge of the nylon wall. The organizer includes at least one fastener configured to hold the cover around a cylindrical object, wherein one of the two walls is an outside wall and the other is the inside wall. A plurality of attachment elements are attached to the outside wall.
US09125461B2

A necklace that contains a gear assembly within a housing where gears of the gear assembly are rotated by a driving component. The driving component is a necklace chain where the chain, for example is a ball chain or a box chain that passes through openings in a housing wall and is configured to physically rotate gears.
US09125458B2

A female buckle member is configured to securely mate with a male buckle member and adjustably retain webbing through multiple directions. The female buckle member may include a housing having first and second ends and first and second sides. A base of the housing may include a base connected to opposed lateral walls and an upper wall. An insertion channel is defined between the base, the opposed lateral walls, and an upper wall. The housing may be symmetrical about longitudinal and lateral axes. The first and second ends of the housing may have the same size and shape. The first and second ends are configured to receive an insertion end of a male buckle member. The female buckle member may also include a plurality of web-retainers that define a first web-retaining channel configured to adjustably retain webbing extending between the first and second ends, and a second web-retaining channel configured to adjustably retain webbing extending between the first and second sides.
US09125433B2

A Fruit Pitter is disclosed where a plunger and shaft are slidably disposed within a generally cylindrical barrel. The shaft contains a pit engaging end that serves to cut and push a pit through a food item and expel the pit into a pit ejection chamber. The plunger is spring actuated for ease of operation. The food item rests in an opening in the barrel and remains there throughout the pit removal operation until a user removes the food item from the Fruit Pitter. The pit ejection chamber keeps the pit retained until it can be disposed of, and further serves to reduce splattering while the Fruit Pitter is in use.
US09125419B2

Disclosed herein is a Bacillus strain, Bacillus sp. isolate F727, that produces metabolites with pesticidal activities. Also provided are bioactive compositions and metabolites derived from cultures of Bacillus sp. isolate F727 capable of controlling pests; as well as methods of use of the strain and its metabolites for controlling pests.
US09125408B2

Disclosure is provided for methods of preventing, removing or inhibiting microbial biofilm formation or microbial infection in a plant or plant part thereof, including applying thereto a treatment effective amount of an aryl carbamate as described herein, or an agriculturally acceptable salt thereof. Methods of enhancing a microbicide (e.g., including a copper, antibiotic, bacteriophage, etc.) and/or plant defense activator are also provided, including applying an active compound as described herein. Compositions comprising an aryl carbamate compound as described herein in an agriculturally acceptable carrier are also provided, and in some embodiments the compositions further include a microbicide (e.g., including copper, antibiotic, bacteriophage, etc.) and/or a plant defense activator.
US09125403B2

Compositions, kits and methods using a cationic salt of a dioic acid to treat organic material, including wood and wood-containing material, are disclosed. The treatment may be supplemented with a second salt. Reductions in the rate and/or impact of water absorption, dimensional instability and living organism decay are achieved for organic materials.
US09125399B2

A method of protecting wood through enhanced penetration of wood preservatives includes providing a solution including (a) at least one amine oxide, (b) at least one organic wood preservative and (c) a non-borate buffering based agent. The solution has a pH of 5 to 12.4 and preferably about 7 to 10. The solution is applied to the surface of the wood after which, with or without intervening storage, the materials are activated to effect enhanced penetration of the organic wood preservative into the wood. One may effect application at a solution temperature of about 30° C. to 75° C. and preferably about 50° C. to 60° C. to effect activation at a higher temperature and high relative humidity. In a preferred practice, the wood may be heated before and/or after application of the solution. The solution is also disclosed as a product.
US09125392B2

The present disclosure relates to treating articles suspected of being infested with bed bugs using carbon dioxide.
US09125383B1

An aquarium acclimation device and method reduce stress and shock which may occur during transition of marine livestock including fish, invertebrates, corals, etc., from a store, online, or wholesaler, to an owner's aquarium. The acclimation device includes tubing, a squeeze bulb, a drip counter, and a rolling clamp. A “J” tube is hung over an edge of the aquarium with one end reaching into water in the aquarium and an opposite end hanging outside the aquarium. The squeeze bulb is connected to the outside end of the “J” tube for initiation of a flow of the aquarium water from the aquarium and a clear squeeze bulb may further provide the drip counter. The rolling clamp and drip counter allow a gradual, observable, and controlled flow for a gradual controlled transition to the aquarium environment.
US09125367B2

According to the invention, there is provided seed and plants of the hybrid corn variety designated CH624682. The invention thus relates to the plants, seeds and tissue cultures of the variety CH624682, and to methods for producing a corn plant produced by crossing a corn plant of variety CH624682 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH624682.
US09125364B2

According to the invention, there is provided seed and plants of the corn variety designated CV554829. The invention thus relates to the plants, seeds and tissue cultures of the variety CV554829, and to methods for producing a corn plant produced by crossing a corn plant of variety CV554829 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV554829 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV554829.
US09125362B2

According to the invention, there is provided seed and plants of the corn variety designated CV375432. The invention thus relates to the plants, seeds and tissue cultures of the variety CV375432, and to methods for producing a corn plant produced by crossing a corn plant of variety CV375432 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV375432 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV375432.
US09125359B2

According to the invention, there is provided seed and plants of the hybrid corn variety designated CH394502. The invention thus relates to the plants, seeds and tissue cultures of the variety CH394502, and to methods for producing a corn plant produced by crossing a corn plant of variety CH394502 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH394502.
US09125358B2

According to the invention, there is provided seed and plants of the hybrid corn variety designated CH841338. The invention thus relates to the plants, seeds and tissue cultures of the variety CH841338, and to methods for producing a corn plant produced by crossing a corn plant of variety CH841338 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH841338.
US09125346B2

A combine harvester has a cutting and conveyance device for crop, a threshing device for separating grain from the crop, a sieve system arranged in the longitudinal direction of the combine harvester, and a blower system comprising at least two blowers disposed upstream of the sieve system transversely to the longitudinal direction of the combine harvester and controlled independently of one another.
US09125345B2

A web wrap apparatus is provided and has a brake device that exerts pressure on a roll of a web material. In order to exert pressure even after the web material is cut, the brake device is locked by a retainer once the web is separated and is released by a feeder, when moving from a home position to a web feed position.
US09125343B2

An agricultural harvester includes a chassis and a feeder housing pivotally mounted to the chassis. The agricultural harvester is characterized in that an axle assembly is pivotally mounted to the feeder housing. A hydraulic actuator is coupled with the axle assembly for pivotally moving the axle assembly in upward and downward directions from the feeder housing. A road mode switch provides a first output signal indicative of a field mode and a second output signal indicative of a road mode. A controller is coupled with the road mode switch and the hydraulic actuator. The controller receives the second output signal from the road mode switch and controls the hydraulic actuator, whereby the hydraulic actuator provides a substantially constant down force between the axle assembly and a ground surface.
US09125340B2

A ride-on lawn mower includes a traveling vehicle body including an operator's seat, and a wheel post for supporting a steering wheel mounted forward of the operator's seat. The lawn mower further includes a mower apparatus connected to a front part of the traveling vehicle body, a roll-over protective structure mounted in a rear part of the operator's seat, and a front guard extending upward from the wheel post and forward of the steering wheel.
US09125338B2

An agricultural product distribution system is presented that includes an inductor box configured to receive agricultural product and conveyed air to combine the agricultural product and the conveyed air. The agricultural product distribution system also includes a removable baffle configured to control an amount of the conveyed air that flows into each port of the plurality of ports. Furthermore, the inductor box is configured to enable the removable baffle to be slidingly inserted into the inductor box, and the removable baffle comprises a tang configured to at least partially block insertion of the removable baffle into the inductor box while the removable baffle is oriented at an undesirable orientation.
US09131634B2

A radio frequency package on package (PoP) circuit is described. The radio frequency package on package (PoP) circuit includes a first radio frequency package. The first radio frequency package includes radio frequency components. The radio frequency package on package (PoP) circuit also includes a second radio frequency package. The second radio frequency package includes radio frequency components. The first radio frequency package and the second radio frequency package are in a vertical configuration. The radio frequency components on the first radio frequency package are designed to reduce the effects of ground inductance.
US09131629B2

A cooling apparatus for a motor vehicle having a drive which comprises two motors, of which one is an internal combustion engine and the other is an electric motor (3) which is connected to an inverter (2), which is connected to an electrical energy source (1), via electrical cables (4, 5). For the purpose of cooling the energy source (1) and the inverter (2), the latter are each equipped with at least one cooling element, which directly surrounds the energy source or inverter, for conducting a fluid coolant. The electrical cables (4, 5) are combined with at least two pipes which at one end are connected to the cooling elements of the energy source (1) and inverter (2) and at the other end are connected to a heat exchanger (7) in order to form a coolant circuit.
US09131624B1

An IT chassis, configured to house IT componentry, includes a forward portion having a forward portion width and a rearward portion having a rearward portion width that is narrower than the forward portion width. A first side of the rearward portion is configured to engage a first slide assembly having a first slide width. A second side of the rearward portion is configured to engage a second slide assembly having a second slide width. The sum of the rearward portion width, the first slide width and the second slide width is substantially equal to the forward portion width.
US09131618B2

Various technologies described herein pertain to racking equipment in a data center. A modular equipment rack system can include an upper track, a lower track, a vertical support, a power and network distribution unit, and a tray. The upper track and the lower track can respectively include incrementally spaced mounting locations at which the vertical support and the power and network distribution unit can be attachable. The tray can be attachable to the vertical support and the power and network distribution unit when the vertical support is attached to the upper track at a first upper mounting location and attached to the lower track at a corresponding first lower mounting location, and the power and network distribution unit is attached to the upper track at a second upper mounting location and attached to the lower track at a corresponding second lower mounting location.
US09131614B2

A method for manufacturing an embedded wiring board is provided. An activating insulation layer is formed. The activating insulation layer includes a plurality of catalyst particles, and covers a first wiring layer. An intaglio pattern and at least one blind via partially exposing the first wiring layer are formed on the activating insulation layer, in which some of the catalyst particles are activated and exposed in the intaglio pattern and the blind via. The activating insulation layer is dipped in a first chemical plating solution, and a solid conductive pillar is formed in the blind via through electroless plating. The activating insulation layer is dipped in a second chemical plating solution after the solid conductive pillar is formed, and a second wiring layer is formed in the intaglio pattern through the electroless plating. Components of the first chemical plating solution and the second chemical plating solution are different.
US09131612B2

An automotive alternator rectifying apparatus includes a circuit board that connects a positive-side rectifying element mounted to the positive-side heatsink and a negative-side rectifying element mounted to the negative-side heatsink to configure a bridge circuit. The circuit board includes a tubular lead guiding portion that includes a lead insertion aperture; and a terminal that is disposed so as to extend outward in an aperture direction of the lead insertion aperture from an exit edge portion of the lead insertion aperture, and to which is connected a lead that is subject to connection that is inserted through an entrance of the lead insertion aperture and that extends outward from an exit, and the lead insertion aperture is formed such that cross-sectional area thereof becomes gradually smaller from the entrance toward the exit.
US09131611B2

A wire of an embodiment includes: a substrate; a metal film provided on the substrate; a metal part provided on the metal film; and graphene wires formed on the metal part, wherein the graphene wire is electrically connected to the metal film, and the metal film and the metal part are formed using different metals or alloys from each other.
US09131609B2

A waterproof structure for an electronic device (60) includes: a case (130) which is disposed in a location in a vehicle (10) distant from a receiving antenna (61), which houses a processing unit (69) that processes location information, and which has a wiring hole (171) through which a wire (62) passes; a cylindrical part (172) which extends in the axial direction of the wire from the case in such a manner as to surround the wiring hole; a seal member (167) which is housed in a compressed state in the cylindrical part, and surrounds the wire; and a cap (160) which is attached to the case in an attachable/detachable manner, has a hole (168) through which the wire passes, and prevents the seal member from moving.
US09131604B1

A communications path may be formed from intertwined conductive paths. The intertwined conductive paths may be formed from one or more layers of conductive material in the dielectric stack of an integrated circuit. The dielectric stack may include metal layers, via layers, and a pad layer. The conductive paths may be formed from patterned conductive structures in the metal and pad layers. Vias in the via layers may be used to connect metal structures from multiple dielectric stack layers. The communications path may have segments in which the conductive paths run parallel to each other and may have cross-over regions in which the conductive paths cross one another without electrically connecting so that the paths twist about each other along their lengths. The communications path may be used to form a differential transmission line pair that distributes signals such as two-phase clock signals.
US09131602B2

The invention provides a printed circuit board for mobile platforms. An exemplary embodiment of the printed circuit board for mobile platforms includes a core substrate having a first side. A ground plane covers the first side. A first insulating layer covers the ground plane. A plurality of first signal traces and a plurality of first ground traces are alternatively arranged on the first insulating layer. A second insulating layer connects to the first insulating layer. A plurality of second signal traces separated from each other is disposed on the second insulating layer, wherein the second signal traces are disposed directly on spaces between the first signal traces and the first ground traces adjacent thereto.
Patent Agency Ranking