US07802563B2
Air/fuel imbalance monitoring systems and methods for monitoring air/fuel ratio imbalance of an internal combustion engine are disclosed. In one embodiment, an oxygen sensor is sampled above cylinder firing frequency and a ratio of data from at least one window over a total number of windows is determined. The approach can be used to indicate imbalances between engine cylinders.
US07802561B2
A valve has a piezo actuator, a valve element, a valve body and a valve seat. At a predeterminable point in time, the valve element is controlled by a discharging process of the piezo actuator from a position in which it rests against the valve seat to a predetermined position located at a distance from the valve seat. The discharging process is divided into a first discharging period during which a predetermined first amount of electrical energy is discharged from the piezo actuator, a subsequent holding time period during which the piezo actuator is not controlled, and a subsequent second discharging period during which a predetermined second amount of electrical energy is discharged. The holding time duration and/or the first discharging period are/is adapted according to the course of a value that is not characteristic of the oscillation behavior of the piezo actuator during the holding time period.
US07802553B2
A method to control combustion in an HCCI engine, to mitigate effects of combustion chamber deposits is detailed. The method comprises applying a specific surface coating to a combustion chamber surface. The surface coating has thermal properties substantially similar to the combustion chamber deposits. The thermal properties preferably include a) thermal conductivity, b) heat capacity, and c) thermal diffusivity. Applying a surface coating results in a reduction of combustion variability due to variation in combustion chamber deposits, and an improvement on combustion stability at low loads due to reduced heat loss. A preferred thermally insulating surface coating includes thermal parameters of a heat capacity in a range of 0.03×106 J/m3-K to 2.0×106 J/m3-K; a thermal conductivity in a range of 0.25 W/m-K to 2.5 W/m-K; and, a thermal diffusivity in a range of 1×10−7 m2/s to 8×10−6 m2/s.
US07802545B2
A valve timing controller has the drive circuit which performs a feedback control of the energization to the electric motor based on the target rotation speed and the actual rotation speed of the electric motor, and rotates the electric motor to the target rotation direction. An invalid switch part of the drive circuit suspends the feedback control at the time of change of the target rotation direction.
US07802538B2
A method of forming a graded dielectric layer on an underlying layer including flowing a mixture of a silicon-carbon containing gas, an oxygen containing gas and a carrier gas through a showerhead comprising a blocking plate and a faceplate to form an oxide rich portion of the graded dielectric layer, where the silicon-carbon containing gas has an initial flow rate, flowing the silicon-carbon containing gas at a first intermediate flow rate for about 0.5 seconds or longer, where the first intermediate flow rate is higher than the initial flow rate, and flowing the silicon-carbon containing gas at a fastest flow rate higher than the first intermediate flow rate to form a carbon rich portion of the graded dielectric layer.
US07802526B2
A customizable returnable rack system for shipping products is provided. The system includes a plurality of racks (10), wherein each rack (10) is selectively displaceable between a collapsed position and an upright position. The racks (10) are adapted to be stacked upon one another in either the collapsed or upright position. The system further includes a first removable dunnage structure (22) couplable to a rack (10) and configured to receive a first type of product and a second removable dunnage structure (22) couplable to a rack (10) and configured to receive a second type of product.
US07802525B2
A multi-fold door for an enclosed railcar comprising a first panel, a second panel and a third panel is disclosed. The first panel is pivotally attached to the second panel at an edge of each panel and the third panel is pivotally attached to the second panel at an edge of each panel. A posterior edge of the first panel is attached to a corner post of an end of the enclosed railcar by hinges that are positioned externally to the enclosed railcar.
US07802519B2
A method for production of an infrared area emitter which can be used for defense against guided missiles with infrared homing heads, for example for ships. According to the invention, an aerosol cloud which is emissive in the infrared range is produced by the reaction of a first primary aerosol composed of an aqueous solution of an electron acceptor with a second primary aerosol composed of an aqueous solution of an electron donor in order to produce the infrared area emitter. The use of primary aerosols such as these leads to emission at 3-5 and 8-14 μm, and does not produce any visual signature either.
US07802517B2
The present invention relates to a method of patterning molecules on a substrate using a micro-contact printing process, to a substrate produced by said method and to uses of said substrate. It also relates to a device for performing the method according to the present invention.
US07802502B2
An improved tool for attenuating vibration in a disk brake rotor during the machining (or facing) thereof using a disk brake lathe is described. In its most basic form, embodiments of the tool comprise a pair of substantially linear and parallel spaced apart legs that are fixedly coupled together by way of a coupling section proximate their proximal ends and have opposing pads attached to the opposing distal ends. An adjustable clamping mechanism is also provided through which the distance between the legs can be varied and/or the biasing force applied against opposing brake rotor surfaces can be varied by way of the legs acting through the pads.
US07802496B2
A plier type stripper tool is provide for stripping sheathed cable of the type having a three spaced insulated power conducting wires, a ground wire disposed among the insulated wires and a sheath surrounding the wires. In one embodiment, the stripper tool includes a pair of levers having jaw, boss and handle portions. The stripper tool may further include a pivot joining the boss portions to enable relative movement of the levers about the pivot between open and closed portions. The jaw portions each have blade sections for coactively circumferentially cutting a cable sheath when the levers are moved from the open to the closed position. Each blade section has a set of three aligned cutting parts of a cutting edge, including a first cutting part disposed at an acute angle with respect to a longitudinal axis of the tool, a second cutting part disposed at an acute angle with respect to the longitudinal axis of the tool, and an arcuate cutting part disposed between the first cutting part and the second cutting part.
US07802488B2
The invention relates to a telescopic actuator comprising a cylinder in which a main rod is mounted to slide telescopically along a sliding axis between a retracted position and an extended position. The actuator includes an auxiliary rod mounted to slide telescopically in the main rod along said sliding axis between a retracted position and an extended position, the actuator including controlled retaining means for retaining the auxiliary rod in the retracted position inside the main rod.
US07802484B2
A compact vibratory flowmeter (200) for measuring flow characteristics of a multi-phase flow material at a flow material pressure of greater than about 10 pounds-per-square-inch (psi) is provided according to an embodiment of the invention. The compact vibratory flowmeter (200) includes one or more flow conduits (301), at least two pickoff sensors (308), and a driver (309). The compact vibratory flowmeter (200) further includes a maximum water drive frequency in the one or more flow conduits (301) that is less than about 250 Hertz (Hz) and an aspect ratio (L/H) of the one or more flow conduits (301) that is greater than about 2.5. A height-to-bore ratio (H/B) of the one or more flow conduits (301) is less than about 10 and a bowed flow conduit geometry includes end bend angles Θ of between about 120 degrees and about 170 degrees.
US07802482B2
The present invention provides a diaphragm attaching structure of an electrostatic capacity type pressure gauge which can achieve an improvement of a measuring precision by inhibiting a poor weld and a heat strain from being generated while restricting an increase of a cost with an easy manufacturing.The present invention is a diaphragm attaching structure of an electrostatic capacity type pressure gauge in which a diaphragm for receiving a fluid pressure is provided in a tensional manner on one end of a tubular case, and a fixed side electrode for picking up a deflection displacement of the diaphragm as a change of an electric capacity is provided within the tubular case on a side opposite to a pressure receiving surface of the diaphragm, wherein an outer peripheral edge portion of the diaphragm is formed thicker than a center portion thereof, and the thick outer peripheral edge portion is thermally molten to be welded and firmly attached to an end surface portion around the opening on the one end of the tubular case.
US07802479B2
A stirring apparatus includes an acoustic wave generating unit that is provided in a vessel keeping a liquid and generates an acoustic wave toward the liquid, the liquid being stirred by the acoustic wave; a driving unit that drives the acoustic wave generating unit; a detecting unit that detects a reflected power reflected from the acoustic wave generating unit; and a determining unit that determines a presence of an abnormality based on the reflected power detected by the detecting unit. The determining unit determines the presence of the abnormality when a difference between an in-operation reflected power which is reflected from, during an operation, the acoustic wave generating unit and a reference reflected power of the acoustic wave generating unit at a same driving frequency exceeds a predetermined value.
US07802474B2
An accelerometer is provided for a fiber optic laser. Strain applied to the fiber optic laser results in an emission wavelength shift. The fiber optic laser is joined to a transducer and extends laterally across said transducer. Acceleration of the transducer in a predefined direction causes strain in said fiber optic laser. The transducer can have many possible designs. There is further provided a system for sensing acceleration which includes a pumping laser and a distributor joined to the fiber optic laser. Return signals from the fiber optic laser are provided to an interferometer and analysis circuitry. In the absence of a transducer, the system can operate as a strain sensor.
US07802471B2
A liquid level sensor device (10) includes a liquid level sensor element (14), a capacitance-to-voltage converter (16), and a controller (18). The liquid level sensor element (14) comprises (i) at least two sets of N conductive electrodes (22) and (ii) M sense lines (S1-S7), where M is greater than or equal to N within each set of the at least two sets of conductive electrodes. Each of the M sense lines couples to select ones of the N conductive electrodes of the at least two sets of conductive electrodes to form a number of L sets of parallel coupled conductive electrodes, where L equals M. The capacitance-to-voltage converter (16) periodically measures a capacitance of the L sets of parallel coupled conductive electrodes for each of the M sense lines. The controller (18) establishes initial measured baseline capacitance values for each of the L sets of parallel coupled conductive electrodes and an initial liquid level height value. The controller (18) also detects transitions in the measured capacitance of the L sets of parallel coupled conductive electrodes. Responsive to the detected transitions corresponding to incremental changes in measured capacitance values, the controller updates the liquid level height value.
US07802470B2
An ultrasonic liquid level detector for use within a shielded container, the detector being tubular in shape with a chamber at its lower end into which liquid from in the container may enter and exit, the chamber having an ultrasonic transmitter and receiver in its top wall and a reflector plate or target as its bottom wall whereby when liquid fills the chamber a complete medium is then present through which an ultrasonic wave may be transmitted and reflected from the target thus signaling that the liquid is at chamber level.
US07802461B2
In leak detection, the signal generated by a test gas is superposed by interferences which fade as the vacuum generation in a container proceeds. Depending on the negative slope of the volume signal (MS), a lower indication limit (AG) is calculated. Upon activation of a zero function, the volume signal (MS) is not reduced to zero but only to the level of the indication limit (AG). Any exceeding of the indication limit is identified as a leak. Thus, the maximum sensitivity of the leak detection is guaranteed at any time.
US07802457B2
An electrohydraulic forming (EHF) tool and a method of forming a sheet metal blank in an EHF operation. The tool may include a pair of electrodes and may be filled with a liquid. A high voltage discharge may be produced between the electrodes in a manner that induces a shockwave within the fluid. The shockwave may produce sufficient force within the liquid to form the blank against a die.
US07802444B2
An ice crusher is attached to an ice dispenser or to a combined ice and beverage dispenser. The ice crusher occupies minimal space in order to fit the dispenser into an existing space on a serving counter or in a beverage dispensing area. The ice crusher may also elevate the ice. In embodiments using this technique, the outlet of the ice from the ice crusher is higher than the ice inlet. As the ice flows from a source of ice, such as an ice bin, the ice is elevated while it is being crushed. The ice then flows from the outlet of the ice crusher down an ice chute or other outlet of the ice crusher, into a cup or container as desired. Other embodiments convey the ice without lifting it, and still other embodiments dispense either crushed or cubed ice, as the consumer may select. In one embodiment the selected crushed ice or cubed ice are both dispensed though the same ice dispensing chute. A retrofit kit may be used to add an ice crusher to an existing ice dispenser, or to an existing combined ice and beverage dispenser.
US07802443B2
A self-contained air conditioner unit incorporates an energy recovery ventilator portion that brings about several changes of room air per hour with outdoor fresh air. There is an outdoor air intake plenum which furnishes the fresh air and the condenser air for the condenser coil, and a return air plenum. Air from the room return air plenum is HEPA filtered and conducted to the evaporator coil and evaporator fan, and is supplied back into the conditioned space. The energy recovery ventilator has a counterflow heat exchanger core situated between the return air plenum and the fresh air intake plenum, as well as two ventilation fans, one (or both) of which may be of variable or multiple speed. By controlling the fan speeds, it is possible to produce a neutral pressure, a positive or overpressure, or a negative or underpressure in the conditioned space. The unit can be wheeled into place and installed easily by personnel without special training. The unit can be scaled up in size and capacity for a larger room or whole house applications, or scaled down for smaller rooms or window mounting.
US07802425B2
A method is provided for controlling and/or regulating the air pressure in a compressed air supply device for a utility vehicle. At least one pressure value in the compressed air supply device and/or in vehicle components connected to the compressed air supply device is recorded. A humidity value representing the humidity content in an air filter unit associated with the compressed air supply device is determined. A clutch connecting a drive to a compressor is opened. A discharge valve of the compressed air supply device is opened when the pressure value is above a predetermined minimum value and the humidity value exceeds a predetermined threshold value. The clutch is opened and the discharge valve remains closed when it is indicated that the clutch can be engaged, the pressure value reaches a predetermined cutting-off pressure, and the humidity value is below the predetermined threshold value.
US07802422B2
Method of assisting regeneration of a depollution device (1) associated with an oxidation catalyst (2) and integrated in an exhaust line (3) of a motor vehicle diesel engine (4), in which a common ramp supplies fuel to the cylinders of the engine, by shifting the engine (4), through modification of engine operation control parameters and use of fuel post-injections into the cylinders, among four strategies of regeneration of the depollution device (1), the first called normal engine operation strategy, the second called level 1 strategy, the third called level 2 strategy and the fourth called over-calibrated level 2 strategy, enabling different thermal levels to be achieved in the exhaust line, with looping back of the strategies, until detection of a request for stopping the regeneration.
US07802418B2
A method and apparatus for production of a yarn, by plying, twisting or covering several basic yarns, subjected to a prior transformation, is provided. At least one of the basic yarns is different from the others and/or is subjected to a different prior transformation. The prior transformation may be carried out in parallel in the same machine, by independent transformation members able to be independently controlled. A slackening of yarn tension resulting from the prior transformation to give the desired tension at an assembly point is carried out on yarn feeding devices. Routing of the yarns is achieved by guide members towards the point of assembly, where the staple yarns are combined and arranged in parallel. A bobbin receives the assembled yarns in a device, constituting or associated with a positive feed device operating without slippage with relation to the yarn. The yarn bobbin with assembled yarns is then placed on a spindle of a twisting machine for a second double plying, twisting, or covering process.
US07802404B2
A dome connector including a hub portion and at least one pair of strut portions. The at least one pair of strut portions attached to and extending from the hub portion. Each of the strut portions has an upper end, a lower end and an intermediate region between the upper end and the lower end. The intermediate region has a greater thickness than the upper end and the lower end.
US07802396B2
An animal deterring device has a carrier with first and second conductive traces that are separated by an arc suppressor. Most typically, the arc suppressor is configured to eliminate short circuiting of the device when exposed to fog, dew, rain, or animal excrements while at the same time to allow an animal to contact both conductive traces at the same time.
US07802379B2
An article of footwear including different cleat sizes is disclosed. The article of footwear includes cleats of a first size along the medial side of the outsole and cleats of a second size along the lateral side of the outsole. The cleats also include spherical indentations along their tips. The outsole also includes an internal structural plate with notches associated with the cleats.
US07802373B1
A shaft has upper and lower ends and an intermediate extent. A putter head simulator includes a horizontal lower plate having upper and lower surfaces, a mirror attached to the upper surface of the lower plate, and a vertical coupling plate extending upwardly from the upper surface of the lower plate. An angular adjustment assembly is for varying the angular relationship between the shaft and the simulator. A shaft length adjusting assembly is for varying the length of the shaft.
US07802370B2
An antenna feed angular alignment tool for an antenna feed and method of use. The tool having a body with a bore between a first end and a second end; a capsule, retained within the bore, having a first material and a second material enclosed within a cavity of the capsule. Coupling feature(s) integral with the body, proximate the first end are configured to rotationally couple with the antenna feed. The first material and the second material having different densities are movable within the capsule, indicating when the capsule and thereby the tool are aligned with a horizontal plane.
US07802361B2
Disclosed herein is a Ball Grid Array (BGA) package board. The BGA package board includes a first external layer on which a pattern comprising a circuit pattern and a wire bonding pad pattern is formed, a second external layer on which a pattern comprising a circuit pattern and a solder ball pad pattern is formed, an insulating layer formed between the first and second external layers, a first outer via hole to electrically connect the first and second external layers to each other, and a solder resist layer formed on each of the first and second external layers, with portions of the solder resist layer corresponding to the wire bonding pad pattern and the solder ball pad pattern being opened. The solder ball pad pattern is thinner than the circuit pattern of the second external layer.
US07802356B1
A method for manufacturing a resonator is presented in the present application. The method includes providing a handle substrate, providing a host substrate, providing a quartz substrate comprising a first surface opposite a second surface, applying interposer film to the first surface of the quartz substrate, bonding the quartz substrate to the handle substrate wherein the interposer film is disposed between the quartz substrate and the handle substrate, thinning the second surface of the quartz substrate, removing a portion of the bonded quartz substrate to expose a portion of the interposer film, bonding the quartz substrate to the host substrate, and removing the handle substrate and the interposer film, thereby releasing the quartz substrate.
US07802354B2
A multi-layered support structure of an open magnetic resonance imaging (MRI) system, configured to provide high permeability to a magnetic flux from a source of a magnetic field, includes a first multi-layered support structure, a second multi-layered support structure and at least one third support structure, connecting the first multi-layered support structure and the second multi-layered structure.
US07802353B2
A method of producing a razor head that includes the steps of providing a guard member having a lower surface and including securing pins protruding from the lower surface, securing a blade unit onto the guard member, providing a cap member, and securing the cap member onto the guard member, independently of the blade unit. A razor head having such features is also provided.
US07802344B2
A plastic shim that has a hole for fixing the shim to a wide variety of objects. The shim may also be breakable for use with smaller applications, while also being usable for larger applications without breaking. In a preferred embodiment, each of the breakable sections has a hole for a screw or nail, so that each of the breakable sections is separately affixable.
US07802340B2
A cleaning tool 410 designed to be used with at least one cleaning implement/replaceable dusting sleeve/cleaning mitt or cleaning pad 11 is disclosed. The cleaning tool 410 includes a telescoping support 409 comprised of a plurality of telescopingly received shafts or sections (412, 413, 414, 415) wherein one of the shafts is an I-beam 415. The shafts 412, 413, 414 and 415 may be freely extended into a locked fully extended position 401 and released via depression of a first engaging projection 439. A primary support head 416 and secondary support head 418 are pivotally mounted to a forward mount 440 and releasably locked together.
US07802330B2
Products and materials providing disposable protective covering for beds and pillows.
US07802320B2
An improved helmet padding includes a multi-layered liner including an innermost layer consisting of a comfort liner designed to engage the head of the user, and having an outer surface covered by an inner surface of a relatively low density foam layer. The relatively low density foam layer consists of a first region of relatively uniform thickness with an outer area from which a multiplicity of protuberances extend radially outwardly. The radially outward layer of the inventive padding consists of a layer of relatively high density foam. The outer layer includes a plurality of recesses corresponding to the protuberances of the inner layer and sized to snugly receive the conical protuberances therewithin. The outer surface of the outer foam layer is shaped and configured to engage the outer shell of a helmet in which it is installed.
US07802316B2
The present invention relates to a glove (1) affording protective function against poisonous and/or noxiant agents, the glove (1) comprising two mutually connected glove sections (2, 3) which are constructed of different materials. The first glove section (2) is formed according to the present invention of a polymer-based material which is at least essentially impervious to chemical poisonous and/or warfare agents or at least retards their passage and is at least essentially gas and water impervious. The second glove section (3) being formed of a textile sheetlike filtering material which prevents or at least retards the passage of poisonous and/or noxiant agents and is at least essentially gas and water vapor pervious. The present invention's glove (1) combines good wear comfort with high protection against highly concentrated poisonous and/or noxiant agents.
US07802315B2
A hockey glove having a thumb member comprising a top layer and a bottom layer affixed together at their respective peripheries for defining a cavity, a thumb pocket for receiving the thumb, and a rigid thumb skeleton enclosed in the cavity, the rigid thumb skeleton comprising a first section for covering at least partially the proximal phalanx of the thumb, a second section for covering at least partially the middle phalanx of the thumb and a third section for covering at least partially the distal phalanx of the thumb, wherein the second section comprises a proximal slot extending between first and second ends and a distal slot extending between first and second ends. The rigid thumb skeleton further comprises a proximal pin passing through the proximal slot of the second section and a distal pin passing through the distal slot of the second section. In use, when the second section pivots relative to the first section towards the closed position, the proximal pin abuts the second end of the proximal slot to prevent overbending of the thumb, and when the third section pivots relative to the second section towards the closed position, the distal pin abuts the first end of the distal slot to prevent overbending of the thumb; and when the second section pivots relative to the first section towards the open position, the proximal pin abuts the first end of the proximal slot to prevent hyperextension of the thumb, and when the third section pivots relative to the second section towards the open position, the distal pin abuts the second end of the distal slot to prevent hyperextension of the thumb.
US07805760B2
The branch origin address and branch destination address of a branch instruction (jmp instruction) are stored, a judgment is made as to whether or not a call instruction for calling an instruction code group for executing an external command is associated with the branch destination address, a judgment is made as to whether or not the call destination address is between the branch origin address and the branch destination address if the call instruction is associated with the branch destination address, and information indicating that malicious code was detected is generated if the call destination of the call instruction is between the branch origin address and the branch destination address.
US07805757B2
Techniques are disclosed for centralized control of one or more attributes associated with a communication session in a network containing firewalls. By way of example, a technique for controlling an attribute associated with a communication session in a data communication network includes the following steps. The attribute associated with the communication session is monitored at a first computing device, wherein the first computing device includes a functionally centralized controller. The first computing device determines which computing devices in the data communication network are to be made aware of the monitored attribute. At least one of the computing devices to be made aware of the monitored attribute includes a firewall. The first computing device sends a message to each computing device identified in the determining step.
US07805752B2
Techniques are disclosed for implementing dynamic endpoint compliance policy configuration. In one embodiment, a security service is provided that automates endpoint compliance policy configuration. A customer identifies its deployed client security products, and specifies the desired level of security. This security product and level information is used by the security service to generate endpoint compliance policies tailored to that customer's current network and/or security scheme. The security service can incorporate data obtained from early warning services that deliver timely and actionable security alerts into its policy generation process. In this way, the security service can provide endpoint compliance policies that protect its customers' machines from the very latest threats at any moment in time.
US07805751B1
The present invention provides a method and device that can easily configure an entertainment system automatically or semi-automatically. The reconfiguration of the entertainment system can be achieved by cycling through the possible configurations of the entertainment system (i.e. different combinations of operational states of the components that make up the entertainment system) by changing various operational states of certain components until an operable configuration is found. The invention may be implemented in any component of the entertainment system including a set-top-box, satellite receiver or a remote control.
US07805723B2
A virtual machine monitor can be used to commence virtualization of computer memory at runtime. The virtual machine monitor can also be used to devirtualize computer memory at runtime.
US07805721B2
A system and method for automating the migration of configuration settings and data from computer systems running the Windows® operating system to computer systems running the Linux® operating system. The method utilizes data from one or more sources to create the configuration of the target system, and translates between settings related to the Windows® systems and Linux® systems involved. As a result, it simplifies the otherwise complex and time-consuming task of migrating from one server to another, specifically when migrating between two operating systems that provide similar functionality but are configured in distinctly different ways.
US07805713B2
One aspect of the invention is a transaction processing system comprising a software service operable to receive a transaction request and to generate a first object associated with the transaction request. An object generator may convert the first object into a first document written in a self-describing language. A document generator may convert the first document into a first transaction message according to a schema associated with a first transaction type determinable from the first document.
US07805710B2
Subject program code is translated to target code in basic block units at run-time in a process wherein translation of basic blocks is interleaved with execution of those translations. A shared code cache mechanism is added to persistently store subject code translations, such that a translator may reuse translations that were generated and/or optimized by earlier translator instances.
US07805707B2
System and method for allowing embedded devices, even with a limited amount of CPU power and limited memory, to run code more efficiently by eliminating all or most of the runtime checks, while retaining the benefits of runtime checks. The runtime checks may be moved or duplicated to an outside application running on a remote computer. The outside application can prepare the runtime checks for execution at the embedded system. The embedded system may receive pre-validated code and store it inside custom cache for later execution using a check-less, or check-limited, runtime on the embedded device.
US07805706B1
In a three-tier ERP implementation, multiple servers are interconnected through one or more network infrastructure. Users may observe poor performance due to the complexity and the number of interconnected components in the implementation. Herein is devised a process for tuning the software component by applying tuning techniques to the OS, SAP application and Database Management System software. For each component, the process identifies potential tuning opportunities of various subcomponents. The process is iterated numerous times through all software components while applying the tuning techniques to derive the most optimal performance for the ERP implementation.
US07805700B2
A method for determining a surface in a material is described. During this method, arrival times of a wavefront at a first depth in the material are calculated using an Eikonal equation. Note that the first depth is proximate to an outer surface of the material. Next, arrival times of the wavefront at a second depth in the material are calculated using the Eikonal equation and the calculated arrival times at the first depth. Then, the surface in the material is determined based on the calculated arrival times at the first depth, the calculated arrival times at the second depth, and a given time interval. Note that arrival times at a given depth in the material, which includes the first depth or the second depth, are calculated by directly determining a steady-state solution of the Eikonal equation.
US07805699B2
A method and apparatus for determining how well a photolithographic model simulates a photolithographic printing process. A test pattern of features is printed on a wafer and the shape of the printed features is compared with the shape of simulated features produced by the model. A cost function is calculated from the comparison that quantifies how well the model simulates the photolithographic printing process.
US07805696B2
A method, system, and computer program product for a faster identification of available reference designators (ARDs) in a design automation system. An ARD utility detects a selection of one or more selected component types for placement on a circuit schematic. A list containing one or more unavailable reference designators (URDs) is sorted through to identify one or more ARDs from the list of URDs. A list of ARDs is then generated, from which a pre-determined portion of ARDs are reserved. The reserved list of ARDs is then outputted for selection by a user.
US07805682B1
Techniques for editing a list of items are disclosed and may be used advantageously in portable devices without the drag-and-drop utility. According to one aspect of the present invention, a highlighting bar is provided to facilitate the selection of the item(s), the selected item(s) are then moved to a desired position, and released thereto to produce an edited list, all of which are achieved by using a finger pointing sensor (e.g., a scroll wheel) and one or more designated keys or buttons.
US07805678B1
Video clips are depicted both in an overall layer and in a set of individual tracks, or rows. The user can cause the display to be expanded or collapsed, as desired, so as to reveal or hide the individual tracks. Video clips are fully editable in either the expanded or collapsed viewing modes. When the collapsed mode is in effect, bars representing individual video clips are still visible, and can be individually selected and manipulated. When the expanded mode is in effect, separate tracks are shown for each individual clip, but the overall layer remains visible, and the individual video clips also remain visible, selectable, and manipulable within the overall layer.
US07805675B2
A method, system, and computer program product for re-creating events occurring within a Web application is provided. The method includes receiving a request to perform an action from a client system accessing the Web application over a network. The method also includes generating a log file for the client system and recording the request and a timestamp of the request in the log file. The method further includes collecting client system information, executing the request, and recording the client system information and request execution details in the log file. Upon the occurrence of a triggering event, the method includes generating scripts to re-create the request and the request execution details, executing the scripts within the Web application and the operating environment of the client system that is re-produced using the client system information, and recording and evaluating results of execution of the scripts to identify any issues or evaluate client system experiences with the Web application.
US07805662B2
An ECC decoder for correcting a coded signal received, which includes a syndrome calculation and errata evaluation device to receive a code word of the coded signal for performing a syndrome calculation to thereby output a syndrome polynomial, and to receive an erasure and errata evaluator polynomial and an errata position for performing an errata evaluation to thereby output an errata and erasure value and correct the coded signal; a key equation solving device to receive the syndrome for generating an erasure and errata locator polynomial and the erasure and errata evaluator polynomial; and an errata position search device to receive the erasure and errata locator polynomial for searching and outputting the errata position. Evaluating the errata and erasure value and calculating the syndrome are performed in pipeline, thereby sharing the hardware and relatively reducing the hardware cost.
US07805661B2
A method of encoding and transmitting at least one short length data in a wireless communication system is provided. More specifically, a user equipment (UE) attaches at least one error detection code to the at least one short length data. Thereafter, the UE encodes for error correction the short length data and the attached error detection code using at least one block encoder. Here the short length data and the attached error detection code are independently encoded. Lastly, the UE transmits the encoded short length data and the encoded error detection code.
US07805654B2
To provide an LDPC decoder, to which SPA is applied, and a method wherein decoding characteristics are improved by reducing the ratio of a message from a check node within messages sent to the same check node. In a decoding device that decodes a received LDPC code by repeating the passing of messages between a plurality of check nodes and a plurality of bit nodes corresponding to a check matrix in each iteration, the order of message computation at a cluster in an iteration out of at least two iterations that have a before-and-after relationship in time and the order of message computation at a cluster in another iteration are varied.
US07805653B2
An order-ensemble searching unit classifies a distribution of reception signals at each bit position of a modulation symbol, and searches an order ensemble of a parity check matrix that minimizes an SNR threshold value. A code generating unit generates a parity check matrix and a generation matrix, based on the order ensemble obtained as a search result.
US07805638B2
A debug network on a multiprocessor array having multiple clock domains includes a backbone communication channel which communicates with information nodes on the channel. The information nodes store and access information about an attached processor. The nodes are also coupled to registers within the attached processor, which operate at the speed of the processor. A master controller solicits information from the information nodes by sending messages along the backbone. If a message requires interaction with a processor register, the node performs the action by synchronizing to the local processor clock.
US07805636B2
A data processing system and computer program product for analyzing data from a crash of the data processing system. A portion of the memory in the data processing system is preserved in response to the crash of the data processing system. The data processing system is rebooted with an environment suited for analyzing trace data in the portion of the memory.
US07805625B1
A method includes providing power to on-die combinatorial circuitry of an integrated circuit (IC) from an external power supply regulator during an active mode of the IC. A state of the on-die combinatorial circuitry of the IC is moved into on-die storage of the IC. Power to the on-die combinational circuitry is disabled during a low power mode of the IC by disrupting power supplied from the external power supply regulator to the IC. A power feedback signal from an internal portion of the IC is provided to the external power supply regulator.
US07805617B2
A data communication unit receives encrypted digital data via a network and records the digital data on a primary recording medium. The digital data, having been encrypted in different encryption methods according to the distributors, include attribute information indicating the encryption methods. The encryption method of the digital data is determined and the encrypted data is decrypted by an appropriate decryption unit. Identification information of a secondary recording medium or a playback apparatus is obtained according to whether the secondary recording medium is removable from the playback apparatus. A controller selects an encryption unit among a plurality of encryption units according to the obtained identification information. The selected encryption unit creates an encryption key according to the identification information and re-encrypts the digital data. A recording unit records the digital data on the secondary recording medium. An accounting unit charges according to accounting information in the attribute information.
US07805615B2
A device uses a user authentication factor to generate a decryption key for use in asymmetric cryptography. An encryption key is generated from the decryption key using a one-way function.
US07805609B2
A method of charging for secure data management and item authentication. The method includes charging an initiation fee to a customer to create an entry for an item owned or manufactured by the customer. The entry may include (i) information associated with the item, and (ii) information about a security feature associated with that item. The method also includes charging an annual maintenance fee to maintain the entry for the customer; and charging an authentication fee each time the customer requests authentication of the item. The method may also include charging a lease fee to a customer for each secure reader the customer leases, where a secure reader is required to request authentication of an item.
US07805597B2
A link based system including a plurality of processors is reset when transitioning from a slower speed to a higher speed mode during a booting process. One processor may coordinate the simultaneous establishment of link resetting of a plurality of other processors. In one embodiment, the processors may operate beginning with the farthest processor to reset their local links. Each processor sets its local links and if it determines, based on the speed of the link that the link has already been reset, it moves on to the next link.
US07805595B2
A data processing apparatus has processing circuitry for performing processing operations including high priority operations and low priority operations, events occurring during performance of those processing operations. Prediction circuitry includes a history storage having a plurality of counter entries for storing count values, and index circuitry for identifying, dependent on the received event, at least one counter entry and for causing the history storage to output the count value stored in that at least one counter entry, with the prediction data being derived from the output count value. Update control circuitry modifies at least one count value stored in the history storage in response to update data generated by the processing circuitry. The update control circuitry has a priority dependent modification mechanism such that the modification is dependent on the priority of the processing operation with which that update data is associated.
US07805594B2
The present invention relates to a multithread processor, and this multithread processor comprises a plurality of register windows each provided for each of threads and capable of storing data to be used for instruction processing in an arithmetic unit, a work register capable of mutually transferring data with respect to the plurality of register windows and the arithmetic unit and a multithread control unit for controlling data transfer among the plurality of register windows, the work register and the arithmetic unit on the basis of an execution thread identifier for identifying the thread to be executed in the arithmetic unit. This enables conducting the multithread processing at a high speed.
US07805588B2
A processing system may include a memory configured to store data in a plurality of pages, a TLB, and a memory cache including a plurality of cache lines. Each page in the memory may include a plurality of lines of memory. The memory cache may permit, when a virtual address is presented to the cache, a matching cache line to be identified from the plurality of cache lines, the matching cache line having a matching address that matches the virtual address. The memory cache may be configured to permit one or more page attributes of a page located at the matching address to be retrieved from the memory cache and not from the TLB, by further storing in each one of the cache lines a page attribute of the line of data stored in the cache line.
US07805578B2
A data processor apparatus and memory interface comprises a memory, a plurality of memories, an interface for controlling access to the memories by a device, and an identifier identifying at least a memory location in one memory and a memory location in another memory. The interface is responsive to the identifier to condition the memory locations for receiving data and/or for transferring data therefrom. This arrangement eliminates the need for a dedicated broadcast bus from the array controller to each processor unit (PU), which thereby enables the area/space required to accommodate the data processor to be significantly reduced.
US07805577B1
An integrated circuit comprises a plurality of tiles. Each tile comprises a processor, and a switch including switching circuitry to forward data received over data paths from other tiles to the processor and to switches of other tiles, and to forward data received from the processor to switches of other tiles. The integrated circuit further comprises one or more memory interface modules including circuitry to access an external memory, each memory interface module coupled to a switch of at least one tile. At least some of the tiles are configured to send a message to a memory interface module to determine whether previous memory transactions associated with a tile have been completed.
US07805575B1
A multicore processor comprises a plurality of cache memories; a plurality of processor cores, each associated with one of the cache memories; and a plurality of memory interfaces providing memory access paths from the cache memories to a main memory, at least some of the memory interfaces providing access paths to the main memory for multiple of the cache memories. Each of the memory interfaces is associated with a corresponding portion of the main memory, and includes a directory controller for the portion of the main memory.
US07805573B1
Systems and methods for storing stack data for multi-threaded processing in a specialized cache reduce on-chip memory requirements while maintaining low access latency. An on-chip stack cache is used store a predetermined number of stack entries for a thread. When additional entries are needed for the thread, entries stored in the stack cache are spilled, i.e., moved, to remote memory. As entries are popped off the on-chip stack cache, spilled entries are restored from the remote memory. The spilling and restoring processes may be performed while the on-chip stack cache is accessed. Therefore, a large stack size is supported using a smaller amount of die area than that needed to store the entire large stack on-chip. The large stack may be accessed without incurring the latency of reading and writing to remote memory since the stack cache is preemptively spilled and restored.
US07805571B2
The invention is directed towards a system and method that utilizes external memory devices to cache sectors from a rotating storage device (e.g., a hard drive) to improve system performance. When an external memory device (EMD) is plugged into the computing device or onto a network in which the computing device is connected, the system recognizes the EMD and populates the EMD with disk sectors. The system routes I/O read requests directed to the disk sector to the EMD cache instead of the actual disk sector. The use of EMDs increases performance and productivity on the computing device systems for a fraction of the cost of adding memory to the computing device.
US07805570B2
The subject application is directed to a system and method for secure document processing. A removable storage, such as a flash drive, magnetic storage, IC card, is installed in document processing device. A selected document processing operation, such as copying, scanning, and the like, is then performed. Data files resultant from the selected document processing operations are directed to the removable storage for being stored temporary, instead of being sent to the storage inherent to the document processing device. Data files temporary stored in the removable storage are then deleted.
US07805561B2
A single instruction, multiple data (“SIMD”) computer system includes a central control unit coupled to 256 processing elements (“PEs”) and to 32 static random access memory (“SRAM”) devices. Each group of eight PEs can access respective groups of eight columns in a respective SRAM device. Each PE includes a local column address register that can be loaded through a data bus of the respective PE. A local column address stored in the local column address register is applied to an AND gate, which selects either the local column address or a column address applied to the AND gate by the central control unit. As a result, the central control unit can globally access the SRAM device, or a specific one of the eight columns that can be accessed by each PE can be selected locally by the PE.
US07805560B2
Methods and apparatus for translating messages in a computing system are disclosed. In particular, a disclosed method for converting messages in a computer system includes receiving a command message from a processing unit where the message is defined according to a transport protocol that utilizes command messages using an address to communicate commands to devices in the computer system. The command message is translated to an interface standard by mapping the address into an address field of a packet constructed according to the interface standard. Corresponding apparatus that perform the methods are also disclosed.
US07805548B2
A method, medium and system for setting a transfer unit in a data processing system. The method comprises setting a transfer unit in a data processing system which repeatedly performs a process of transmitting data stored in a first memory to a second memory in a predetermined transfer unit, processing the transmitted data stored in the second memory, and transmitting the processed data to the first memory. The method includes computing overhead on the data processing system according to the size of each of a plurality of data units available as the transfer unit; and setting a data unit, which corresponds to a minimum overhead from among the computed overheads, as the transfer unit. Accordingly, it is possible to set an optimum transfer unit according to an environment of a data processing system in order to improve the performance of the data processing system.
US07805542B2
Embodiments disclosed herein provide for an apparatus and method for input/output management in a mobile environment. One embodiment includes a mobile unit comprising at least one processor, a data bus interface and a computer readable memory persistently storing a unique hardware identification. The mobile unit can receive a wireless signal and, based on the wireless signal, communicate a set of data across the data bus. The persistent unique hardware identification of the mobile unit is used to restrict access to data received at the mobile unit via the wireless signal.
US07805540B1
The method and system for reprogramming instructions for a switch includes programming a redirection memory to associate a routing parameter set in a routing memory for the switch with a first line card. The routing parameter set includes a plurality of routing parameters to be provided to the switch to service the first line card. In response to an event initiating activation of a second line card in place of the first line card, the redirection memory is reprogrammed to associate the routing parameters set in the routing memory with the second line card.
US07805539B2
When multimedia data made up of a plurality of related files is transferred to a data receiving apparatus, a single data object that includes the plurality of related files is generated in a format supported by the data receiving apparatus. This data object is then transferred to the data receiving apparatus, and therefore the data receiving apparatus can confirm the relationship between the plurality of files.
US07805536B1
Forwarding liveness, such as the ability of an interface to send and receive packets and forwarding capabilities of the interface, is determined. The determined forwarding liveness may be sent in a single message, allowing forwarding liveness information to be sent more frequently which permits fast detection of failures. The message may also include aggregating liveness information for multiple protocols.
US07805528B2
A user interface apparatus, a device controlling apparatus and a method thereof are disclosed. The user interface apparatus includes: a button input unit for sensing activation of a button; a wireless communication unit for transferring a control message through a wireless network to control electronic appliances; and a controlling unit for sensing a button activation pattern, creating the control message with the button activation pattern and user information, and transmitting the control message to a device controlling apparatus through the wireless communication unit to control corresponding electronic appliances according to a time/environment based user pattern.
US07805524B2
A display control apparatus, a display control program and a display control method can prevent re-controlling of a CGI from taking place as a result of updating a web browser. The display control apparatus includes a CGI processing section that executes a CGI process and outputs the outcome of the CGI process in response to a CGI request received from the client, an address shifting section that connects the apparatus to a link address different from the address connected by the client to issue the CGI request according to the CGI request and an output section that outputs display information for displaying predetermined information according to the outcome of the CGI process output from the CGI processing section to the client for whom the address to be connected is shifted by the address shifting section.
US07805514B2
The principles of the present invention extend to accessing results of network diagnostic functions in a distributed system. A chassis allocates resources for performing a network diagnostic function directly to requesting computer system. The requesting computer system communicates directly with the allocated resources to initiate the network diagnostic function. The network diagnostic test continues to execute even if the requesting computer system subsequently malfunctions. Collected test results are stored at the chassis such that any network connectable computer system can access the collected test results. A monitoring computer system (which may or may not be the requesting computer system) requests collected test results corresponding to the network diagnostic function. The chassis identifies appropriate test results and returns the results to the monitoring computer system.
US07805511B1
Method and apparatus for automated monitoring and reporting of health issues for a virtual server is described herein. A virtual server may comprise virtual-server components distributed over two or more server systems, the components being used collectively to provide data-access service to client systems. A virtual server may further comprise virtual-server components that are distributed over one or more storage systems. Each server system of a virtual server may implement a health module that automatically monitors and reports health issues regarding the functions/operations or performance of the virtual server. In some embodiments, the health modules executing on the server systems work in conjunction to monitor and report on the virtual-server components (comprising physical and/or virtual components) of the virtual server. As such, the health modules provide convenient and automated monitoring and reporting of health issues affecting the virtual server in providing data-access service to a set of client systems.
US07805503B2
A method and apparatus for adding a node to a group of nodes is provided. Group capability data is stored in volatile memory of a group manager for a group. The group capability data identifies capability requirements for members of the group. The group manager provides notification services for members of the group. A request to add a particular node to a group is received. In response to receiving the request, a determination is made as to whether the particular node satisfies the capability requirements identified by the group capability data. Upon determining that the particular node does satisfy the capability requirements identified by the group capability data, the particular node is added to the group. The capability requirements for members of a group may initially be based on the capabilities of the first node that is added to a group.
US07805502B2
Automatically finding and using network services. An extensible framework is defined which allows any network service, new or old, to be defined. A base schema is defined that defines existing network services, and extension schemes may also be defined which are specific to new network services. A vendor can define the schemas in XML, as well as using software plug-ins and configuration data. The information is stored on a network provider's server. Clients can browse the network providers server for available services. Any available services can be accepted. When this happens, a form is provided to the client; the client fills out the form; and returns it. The information on the form is associated with the XML schemas and used to select and automatically configure the network service.
US07805499B2
An RFID edge server can associate with multiple RFID readers at a location. The RFID edge server can include an application server using a Web Services Reliable Messaging to transfer RFID data.
US07805496B2
A method for simulating a computer system includes defining a set of building blocks including models of components of the computer system. The set of building blocks is interconnected to produce a topological model of the computer system. A client transaction model is derived based on historical data, for generating simulated client requests to be processed by the topological model. A resource requirement model is produced based on the topological model and on the historical data, the resource requirement model simulating a resource utilization of the components of the computer system responsively to the generated client requests. A performance metric of the computer system is estimated by simulating the computer system using the simulated client requests and the resource requirement model.
US07805495B2
In one embodiment, a method for transferring web browser data between web browsers includes collecting browser data pertaining to a first web browser, packaging the browser data into an intermediate format, and storing the packaged data for a subsequent import into a second web browser.
US07805493B2
A service proxy processing method is used with a network service system in which a service providing device connected over a network for performing predetermined capability processing can communicate with a plurality of client devices for performing network connection capability processing for recognizing connection status of each service providing device over a network. Each service providing device has a proxy process step of specifying a specific communications capability in response to a communications capability request from any client device when a predetermined service providing process is not performed in a predetermined period, allowing any service providing device in a network to perform as a proxy a communications process based on the specified specific communications capabilities, and making a transition to a network sleep status not recognized by a client device in the network.
US07805487B1
A system, method and apparatus for facilitating communication among a number of distributed clients in a distributed network is disclosed. A user, such as through a personal digital assistant device, may select one or more instant messages for transmission to one or more other users in the network. The instant messages may be sound instant message and/or text instant messages. During messaging, message status indicators provide users with the status of their respective messages. In one embodiment, the messages may be deemed to be either pending or received as distinguished by a pending status indicator and a received status indicator.
US07805479B2
Montgomery multiplication can be computed quickly by using carry save adders and parallel multipliers. We present an enhanced technique for very fast Montgomery multiplication that can be used for RSA calculations. This invention utilizes a scalable bit word implementation, suitable for very large bit encryptions. Such designs can be deployed on mid-level FPGAs that have dedicated multiplier logic, on ASICs, or on custom circuits. To our knowledge, our technique yields some of the fastest RSA encryption times to be reported, having area requirements similar to related work. Such circuits can be ideal for increased security in sensitive communication fields.
US07805477B2
The present invention relates to computing circuits and method for running an MPEG-2 AAC or MPEG-4 AAC algorithm efficiently, which is used as an audio compression algorithm in multi-channel high-quality audio systems, on programmable processors. In accordance with the present invention, the IMDCT process which takes large part of the amount of the operations in implementation of an MPEG-2/4 AAC algorithm can be performed in efficient. In addition, while the architecture of the existing digital signal processor is still used, the performance can be improved by means of the addition of the architecture of the address generator, Huffman decoder, and bit processing architecture. After all, to design and change the programmable processor is facilitated.
US07805469B1
Methods and computer program products that provide for extracting a portion of a file system for use as an independent file system and merging a file system into another file system are presented. One or more storage objects containing data from a multi-volume file system can be extracted from the multi-volume file system. One or more storage objects containing a first file system can be merged with one or more other storage objects containing a second file system, thus forming a merged file system.
US07805465B2
A method, system and article of manufacture for managing metadata associated with a data abstraction model abstractly describing data in a database. One embodiment provides a method of managing metadata describing objects of a data abstraction model with logical fields that define abstract views of physical data in a database. The method comprises traversing a logical tree structure representing the data abstraction model. The logical tree structure has a plurality of nodes, each representing a logical field or a category of logical fields of the data abstraction model. The method further comprises identifying metadata describing logical fields or categories represented by the plurality of nodes. The identified metadata is stored in a queryable database. A user is allowed to query the database to identify objects in the data abstraction model that may be used to construct an abstract query.
US07805460B2
Generating and using a high-speed, scalable, and easily updateable data structure are described. The proposed data structure provides minimal perfect hashing functionality while intrinsically supporting low-cost set-membership queries. In other words, in some embodiments, it provides at most one match candidate in a set of known arbitrary-length bit strings that is used to match the query.
US07805453B2
Content is received by a device through a port and is analyzed based on a set of predetermined criteria to determine if it matches the characteristics of the device and/or the preferences of a user. The content characteristics are recognized by analyzing the content itself or from tags attached to, associated with or embedded into the content. Acceptable content is then rendered to the user.
US07805451B2
Attribute mapping information is stored, in which a superclass of an associated class in an integration-source ontology already associated with an integration-destination ontology, an attribute of the superclass, and an integration destination attribute of a class in the integration destination are associated with each other. An integration target class in the integration source is specified to acquire an attribute of a superclass of the integration target class. An associated class having the shortest distance from the integration target class is specified, to specify an integration-destination-associated class associated with the specified associated class. An inheritance relation is followed from the integration-destination-associated class to specify a class having the integration destination attribute corresponding to the attribute in the mapping information as a position where the class associated with the integration target class is present.
US07805450B2
A system determines the geographic range of a search query. A search query may include local intent which influences the results and advertisements that are displayed in response to the search query. The geographic range associated with the local intent may vary depending on the search query. The geographic range may be determined using probabilistic models that analyze historical searches to determine the geographic range of search queries.
US07805445B2
Methods, systems and computer program products for simplifying complex data stream problems involving feature extraction from noisy data. Exemplary embodiments include a method for processing a data stream, including applying multiple operators to the data stream, wherein an operation by each of the multiple operators includes retrieving the next chunk for each of set of input parameters, performing digital processing operations on a respective next chunk, producing sets of output parameters and adding data to one or more internal data stores, each internal data store acting as a data stream source.
US07805442B1
Cartographic data is represented using polynomial splines. To improve representation accuracy and reduce storage requirements, a database storing data points (shape points and nodes) is converted into a database of spline control points. The spline control points are computed by fitting a polynomial spline to the geographic features using a least squares approximation. The control points associated with each geographic feature are stored in a computer-usable database. The geographic features can be displayed by computing the spline functions using the stored control points.
US07805441B2
A system and method to facilitate expansion, disambiguation, and optimization of search queries over a network wherein an original query received from a user is parsed to obtain at least one query term. A plurality of keywords related contextually to one or more query terms are further retrieved from a database. Finally, a set of modified queries is generated, each modified query further comprising at least one query term and at least one retrieved keyword.
US07805433B2
Cube functions may be used to obtain data from a multidimensional database. The cube functions may be contained within one or more cells of a spreadsheet. These cube functions behave similarly to the standard functions that may be included within a spreadsheet. Exemplary cube functions include obtaining: a cube member, a cube value, a cube set, a ranked member, a KPI, a member property and a count relating to a set. The cube functions within the spreadsheet may access the cube data from one or more multidimensional databases. Using the cube formulas in individual cells allows the user to add/delete rows and/or columns from within the spreadsheet.
US07805430B2
Disclosed is a method, system, and computer readable medium for evaluating a string input for a name. Exemplary embodiments categorize the words within the input string into different fields and using relationships between the different fields provide more accurate search results during a name search.
US07805421B2
System and methods are provided for applying a dimensionality reduction process to a data set. The method includes obtaining a data set including a first set of variables and identifying collections of the first set of variables for replacement by a second set of variables. The method also includes replacing the collections of the first set of variables with the second set of variables and eliminating the first set of variables from the data set.
US07805420B2
Versioning and concurrency control architecture of data operations on data of a data source by multiple independent clients of a user. Data operation messages between the clients and the data source are intercepted and tracked for serialization control to a data view instance of the data source. The architecture can be located as an always-on centrally-located system (e.g., mid-tier), accommodate data operations that include create, read, update, delete, and query (CRUDQ) against data sources, and provides support for distributed transactions, locking, versioning, and reliable messaging, for example, for data sources that do not expose such capabilities. A hash is employed for version control and to control changes at the data source. The central system also provides logic for the individual CRUDQ operations, and granular error classification to enable retries whenever possible.
US07805412B1
Parallel reconstruction of file components following a failure of one or more of the storage devices is implemented in the context of a storage system that includes a plurality of storage devices for storing file components and a plurality of metadata managers. A storage device having one or more unrecoverable read errors requiring reconstruction is identified. A metadata manager which will serve as a scheduler, and a plurality of metadata managers which serve as a plurality of workers, are identified. The plurality of workers includes metadata managers other than the scheduler. A scheduler service running on the metadata manager identified as the scheduler is used to construct a list of file components from the storage device affected by the one or more unrecoverable read errors requiring reconstruction. The scheduler service assembles a work list corresponding to each of a plurality of the workers. The work list for each worker includes a subset of file components from the list requiring reconstruction. The scheduler service instructs each worker to reconstruct data contained in the subset of file components on the work list of said worker. In response to the instructions from the scheduler service, the plurality of workers operates in parallel to reconstruct the data contained in the file components requiring reconstruction.
US07805408B2
Conflicts detected during synchronization of replicas are enumerated and resolved according to a specified policy, comprising conditions and actions or simply a specified action. Specified actions may be drawn from a set of standard actions and custom actions may also be composed. The conflicts are enumerated and resolved in logical groups. A logical group is a collection of one or more item envelopes, each comprising entities, such as items, links, and/or extensions. In an example configuration, both constraint-based conflicts, such as a name collision, and non-constraint-based conflicts are handled via the same application programming interface.
US07805407B1
System and method for the dynamic configuration of replicated database servers. Embodiments may provide a mechanism to dynamically and automatically replace lost server nodes with a pool node to maintain a necessary or desired level of replication. Some embodiments may provide a mechanism or mechanisms to dynamically and automatically increase the number of server nodes to meet an increase in demand, and to dynamically and automatically decrease the number of server nodes during periods of decreased demand. To maintain consistency among the database replicas, some embodiments may provide a mechanism or mechanisms for synchronizing the database replicas on the server nodes. In one embodiment, the nodes may be peer nodes in a peer-to-peer network, and the pool nodes may be a peer group.
US07805405B2
Extensible reconfigurable media appliance for security and entertainment captures images digitally for storage. Digital effects and filters are applied to incoming video stream on-the-fly or to video data stored in memory. Digital effects and filters are dynamically stored, modified, updated or deleted, providing extensible reconfigurable effects studio. Digital media appliance communicates wirelessly with other media appliances, computers, security systems, video storage, email, chat, cellular services or PDAs to provide seamless integration of captured video stream.
US07805402B2
A system implementable using a programmable processor includes a plurality of pre-stored commands for building an inventory of audio, musical, works or audio/visual works, such as music videos. A plurality of works can be collected together in a list for purposes of establishing a play or a presentation sequence. The list can be visually displayed and edited. A plurality of lists can be stored for subsequent retrieval. A selected list can be retrieved and executed. Upon execution, the works of the list are presented sequentially either audibly or visually. The works can be read locally from a source, such as a CD, or can be obtained, via wireless transmission, from a remote inventory. If desired, establishment of a predetermined credit can be a pre-condition to being able to add items to the list for presentation.
US07805399B2
The present invention is directed towards providing a partial dual-encrypted stream in a conditional access overlay system. The headend equipment includes an aligner, identifier, and remapper (AIR) device (615) that receives a clear stream and one or two encrypted streams, where the two encrypted streams have been encrypted by two different encryption schemes. The AIR device (615) identifies critical packets associated with the clear stream and subsequently allows two encrypted streams to pass and drops the critical packets of the clear stream. A multiplexer (640) then combines a percentage of the non-critical packets of the clear stream and the critical packets of the two encrypted streams to provide the partial dual-encrypted stream.
US07805392B1
Pattern matching in a plurality of interconnected processing engines includes: accepting a stream of input sequences over an interface and storing the input sequences; storing instructions for matching an input sequence to one or more patterns in memory accessible by a first set of one or more processing engines, and storing instructions for matching an input sequence to one or more patterns in memory accessible by a second set of one or more processing engines; distributing information identifying selected input sequences to the first and second sets of processing engines; and retrieving the identified input sequences to perform pattern matching in the first and second sets of processing engines.
US07805389B2
Herein disclosed an information processing apparatus including converting means and retrieval means, wherein the converting means converts content feature quantities using functions adapted to convert a plurality of feature quantities attached to a plurality of pieces of content so that the distance between pieces of content defined by the plurality of feature quantities coincides with the distance suited for a user-entered similarity relationship between the plurality of pieces of content, the functions being further adapted to map the pieces of content laid out in a feature quantity space defined by the plurality of feature quantities into a new feature quantity space by the conversion of the plurality of feature quantities, and wherein the retrieval means retrieves similar pieces of content based on converted feature quantities.
US07805387B2
This invention deals with a morphological genome for design applications. This genome encodes all forms. It comprises a finite set of morphological genes, where each gene specifies a distinct group of morphological transformations defined by a group of independent topological, geometric or other parameters. The morph genes and their parameters are mapped within an integrated higher-dimensional framework with each parameter represented along an independent vector in higher-dimensional Euclidean space. Each distinct number associated with a parameter or a group of parameters is represented by a distinct point in this space referenced by its higher-dimensional Cartesian co-ordinates which represent the genetic code for the specific form being mapped. The morph genome can be used as an interactive design tool to generate known and new forms for applications in all design fields as well as for fabricating these forms when linked with digital fabrication devices within an integrated computational environment.
US07805384B1
There is disclosed a printer control system and method for abstracting the data flow to a printer, or other device, and for using the abstracted information for controlling additional processes with respect to the printer. In one embodiment, the abstracted information is used to print envelope information, such as addressee and/or a postage indicia. The postage indicia can be either generated from the abstracted data or the indicia itself can be abstracted from the data stream. In another embodiment, the process to be controlled is as downline process, such as a folding operation or the printing of information related to the original printed document.
US07805380B1
The present invention relates to systems and methods for optimizing water allocation. In particular, the present invention relates to systems and methods for establishing and querying a database of information for projecting and optimizing water distribution within a county, city or state and providing useful output as a result of such queries. The system and method also provide for exchange of water rights and the output of data in a useful form, such as a map, graph, list, summary or chart. The system and method also provide for water planning based on consideration of various parameters.
US07805373B1
A system and method are provided for synchronizing playback of media content on multiple playback devices utilizing Digital Rights Management (DRM) encoding. In general, multiple playback devices or users of those playback devices are associated to form a virtual group. A virtual group (VG) control function operates to synchronize advertisement (ad) slots within media content provided to the playback devices in the virtual group utilizing DRM encoding.
US07805372B2
A method and system for controlling access to a plurality of secure computer networks using a secure registry system is disclosed. The secure registry system includes a database containing selected data of a plurality of users each authorized to access at least one of the plurality of secure computer networks. The method and system facilitate receiving authentication information from an entity at a secure computer network, communicating the authentication information to the secure registry system, validating the authentication information at the secure registry system, receiving from the secure registry system an indication of whether the entity is authorized to access the secure computer network, and granting the entity access to the secure computer network when the authentication information of the entity corresponds to one of the plurality of users.
US07805370B2
A supplemental financial transaction processing system operates with a primary system to provide financial transaction processing services to a client system which has established a secure session with the primary system. A secure web services system receives a transaction request identifying the primary system and: i) assigns a unique redirect URL to the transaction request, and ii) returns the unique redirect URL to the primary system. The primary system provides the unique redirect URL to the client system. The supplemental transaction server: i) provides a web document object to the client system; ii) receives a post of the financial transaction from the client system; and iii) performs at least one of: i) writing the financial transaction to a transaction database; or ii) forwarding the financial transaction to a processing system distinct from the supplemental transaction processing system.
US07805369B2
A computerized system is established through a network to help business organizations conduct and manage their businesses with anti-financial crimes provisions according to the government regulations and laws, e.g., the Bank Secrecy and the USA PATRIOT Act, and to enable financial institutions to monitor and manage these business organizations with confidence in compliance with the regulatory requirements and applicable laws.
US07805365B1
A system and method are provided which accept orders from customers located at distributed locations, manages the ordering process by presenting a consolidated invoice to the seller, allows the seller to indicate which items are being paid along with a reason code for items for which payment is being withheld, accepts a consolidated payment, and allocates that payment to the appropriate selling subsidiary. In general, one or more orders are received from a buyer in which each of the orders corresponds to at least one seller subsidiary. The orders are consolidated into a consolidated invoice. The consolidated invoices are then made available to the buyer. An indication is received from the buyer as to which of the orders a payment is being approved. The payment, once received, is allocated to a corresponding at least one seller subsidiary for which the payment has been made.
US07805363B2
The present invention generally relates to financial data processing, and in particular it relates to lender credit scoring, lender profiling, lender behavior analysis and modeling. More specifically, it relates to rating lenders based on data derived from their respective consumers. Also, the present invention relates to rating consumer lenders based on the predicted spend capacity of their consumers.
US07805362B1
A method of assessing money-laundering risk of an individual includes gathering geographic information, personal information, and product information regarding the individual, determining a risk value of the geographic information, a risk value of the personal information, and a risk value of the product information, weighting each of the geographic information risk value, the personal information risk value, and the product information risk value, and summing the weighted risk values to yield a money-laundering risk score.
US07805351B2
Techniques, including computer-implemented methods, systems, and apparatus, for establishing a contractual relationship between two parties based on a segregated contract participation unit. The techniques include offering to a set of potential investors, on an electronic exchange, a segregated contract participation unit to purchase an economic participatory interest associated with a specific aspect of an issuer operation, and upon purchase of the segregated contract participation unit by a specific investor of the set of potential investors, establishing a contractual relationship between the issuer and the specific investor that binds the issuer to execute a set of obligations according to terms specified in the segregated contract participation unit.
US07805350B2
In accordance with one aspect of the present invention, a method is disclosed for valuing at least one bond having a nominal lifetime, the bond having estate put and call options and a cash flow value. The method includes the steps of decomposing the bond into a plurality of pieces, the plurality of pieces equal to the number of years of the nominal lifetime of the bond, valuing the estate put, call option, and cash flow of each piece based on an expected mortality rate, and aggregating the estate put, call option, and cash flow values of each piece to determine an aggregate value, wherein the value of the bond is equivalent to the aggregate value. A system also is disclosed for implementing the steps of the method of the present invention to determine the value of the bond.
US07805349B2
A framework is presented that can be used to create and execute software applications that include a user interview. The framework includes run-time engines and a data repository. The run-time engines include an interview driver. The data repository includes interview instructions and model information. The interview driver generates or modifies an instantiated data model by using the interview instructions and model information to obtain information from a user. The model information includes a meta-model, a data model, and an instantiated model. Once an instantiated model has been created, it can be used to generate an application-specific document, such as a tax form. A transformer and application logic are used to generate an instantiated application-specific model. The instantiated application-specific model and the document renderer are used to generate an application-specific document.
US07805348B2
Methods and system for performing an investment portfolio activity. A record associated with a security is stored. The record includes two or more data fields each associated with a respective security attribute, and each data field is associated with a single data value. A request to add a new data field to one of the security attributes is received, and the new data field is associated with a new data value. A customized record associated with the security is created, which includes the new data field and the new data value, and an order to perform an investment portfolio activity associated with the security is received. The investment portfolio activity is executed using the new data value included in the customized record.
US07805345B2
In accordance with the teachings described herein, computer-implemented lending analysis systems and methods are provided. A pre-processing module may be used to organize loan applicant data into a plurality of applicant groups based on one or more demographic factors, wherein a protected class is identified from the plurality of applicant groups. An index generation module may be used to calculate a plurality of disparity indices for the protected class by comparing lending-related data for the protected class with lending-related data for one or more control groups selected from the applicant groups. An indicator generation module may be used to calculate one or more singular indicators for the protected class by comparing the disparity indices with one or more reference indices. The indicator generation module may be further used to calculate a global indicator as a function of a plurality of singular indicators.
US07805340B2
Disclosed are methods, systems, and computer program products for performing an on-demand book balance to physical balance reconciliation process for liquid product. The method can include receiving an indication that a delivery of product is about to occur at a retail facility. Based on the received indication, and optionally while fuel is dispensed from one or more storage tanks, a first book balance to physical balance reconciliation can be initiated for one or more storage tanks at the retail facility prior to receiving a delivery of liquid product. Following completion of the first book to physical balance reconciliation, an amount of liquid product as indicated on a delivery document is delivered and then the system automatically performs a second book to physical reconciliation process to identify one or more discrepancies between the amount of liquid product in the storage tanks and a physical amount of liquid product actually delivered.
US07805319B2
One embodiment of the present invention relates to systems and methods for detecting harmful and/or hazardous ingredients that may cause an allergic reaction, interfere with the effectiveness of a prescription drug, exacerbate symptoms associated with a chronic illness, and/or cause another undesired reaction.
US07805314B2
A method and apparatus to quantize/dequantize frequency amplitude data and a method and apparatus to audio encode/decode using the method and apparatus to quantize/dequantize the frequency amplitude data. The method includes calculating and quantizing power of frequency amplitudes for each of a plurality of bands constituting an audio frame, normalizing frequency amplitude data for each of the bands using the quantized power, and quantizing a first one of even-numbered or odd-numbered data among the normalized frequency amplitude data. The method may further include interpolating frequency amplitude data that corresponds to a second one of the even-numbered or odd-numbered frequency amplitude that is not quantized from among the normalized frequency amplitude data using the quantized first one of the even-numbered or odd-numbered data, and quantizing an interpolation error corresponding to a difference between the second frequency amplitude data that is not quantized and the interpolated frequency amplitude data.
US07805307B2
A system for the automated conversion to audio of text displayed on a surface.
US07805301B2
A reliable full covariance matrix estimation algorithm for pattern unit's state output distribution in pattern recognition system is discussed. An intermediate hierarchical tree structure is built to relate models for product units. Full covariance matrices of pattern unit's state output distribution are estimated based on all the related nodes in the tree.
US07805300B2
An apparatus, a method, and a machine-readable medium are provided for characterizing differences between two language models. A group of utterances from each of a group of time domains are examined. One of a significant word change or a significant word class change within the plurality of utterances is determined. A first cluster of utterances including a word or a word class corresponding to the one of the significant word change or the significant word class change is generated from the utterances. A second cluster of utterances not including the word or the word class corresponding to the one of the significant word change or the significant word class change is generated from the utterances.
US07805294B2
When a sound presence/absence detector (12) detects a sound absence interval, a non-modulated carrier signal is outputted in an area used to transmit speech data that are included in transmission data having a frame structure and that correspond to the sound absence interval. That is, an FSK modulator (14) causes a transmitting circuit (15) to output the non-modulated carrier signal from a wireless communication apparatus (100) in the area used to transmit the speech data corresponding to the sound absence interval. In the meantime, a four-level FSK modulated wave signal is outputted in the areas other than the one of the sound absence interval. A non-modulation discriminating data for allowing the sound absence interval to be determined are included in an area of channel identifying information included in the transmission data having the frame structure, and allow a communication terminal apparatus at the receiving end to avoid any unstable operations. The present invention is suitable for narrowed bands of communication paths and reduces the affections on adjacent channels.
US07805293B2
A voice band correcting apparatus in which the signal level of limit bands is amplified by a correction filter, the signal level of a correction signal supplied is compared by a level detector to a preset level, and the result of decision is sent as level information to a coefficient controller, where the signal level is adjusted in a controlled manner. The high-quality broadband signal may be obtained on correction without degrading the quality of a communication signal ascribable to excess amplification.
US07805292B2
An apparatus for transcoding an audio signal between a CELP-based coder and a hybrid coder includes a source bitstream unwrapper configured to receive a source bitstream, extract one or more CELP compression parameters from the source bitstream, and construct an audio signal vector from the source bitstream while maintaining the one or more extracted CELP compression parameters. The apparatus also includes a frame interpolator coupled to the source bitstream unwrapper and a compression parameter converter coupled to frame interpolator. The compression parameter converter is configured to calculate output compression parameters from at least one of the interpolated compression parameters or the one or more extracted CELP compression parameters. Additionally, the apparatus includes a destination bitstream wrapper coupled to the compression parameter converter and a mapping parameter tuner coupled to the frame interpolator. The mapping parameter tuner is configured to select one or more parameters for use by the compression parameter converter.
US07805287B1
System, methods and apparatii are provided for emulating the performance effect on network traffic flow traversing a node in a communications network. According to one illustrative embodiment, a method of emulating the performance effect on network traffic through a node is provided that includes generating foreground traffic through the node; simulating background traffic at the node; determining an effect of the background traffic on the foreground traffic; and making a forwarding decision with respect to the foreground traffic based on the effect.
US07805279B2
Factories (102-104) have host computers (107) for monitoring industrial equipment (106). Each host computer (107) is connected to a management host computer (108) on a vendor (101) side through the internet (105). The host computer (107) on the factory side detects occurrence of a trouble of the industrial equipment (106) and notifies the vendor side of status information representing a trouble state. In response to this, the host computer (108) on the vendor side notifies the factory side of response information representing a countermeasure against the trouble state.
US07805277B2
To provide a step number measuring apparatus in which a reduction in electric power is intended by a simple constitution, and which can correspond to plural movements. A CPU calculates a moving motion pitch on the basis of a detection signal from sensors that a switching circuit has selected, calculates the moving motion pitch by performing a processing having been selected from among plural kinds of processings, which have been stored in a memory, on the basis of the detection signal from the sensors that the switching circuit has selected, calculates the moving motion pitch by selecting the other processing among the plural kinds of processings when both the moving motion pitches differ, and performs a step number measurement by the selected processing when both the moving motion pitches become the same.
US07805275B2
A traveling direction measuring apparatus including 3-axes acceleration detecting means for detecting acceleration, and acceleration data acquiring means for repeatedly obtaining 3-axes acceleration data, said 3-axes acceleration varying with walking of a pedestrian, the traveling direction measuring apparatus including means for calculating, when the pedestrian is walking with holding said traveling direction measuring apparatus in a generally fixed attitude, gravity acceleration by averaging acceleration data sets during several steps obtained by said acceleration data acquiring means, means for calculating frequency components corresponding to duration of one step of the acceleration data sets projected on a plane perpendicular to the calculated gravity acceleration, and means for estimating a moving direction of the pedestrian seen from a terminal coordinate system associated with said traveling direction measuring apparatus according to frequency components.
US07805272B2
A sensing circuit includes a first sensing element, a second sensing element, a reduction unit, a storage unit, a specifying unit and a detection unit. The reduction unit reduces the amount of the energy applied to the second sensing element. The storage unit stores a degradation characteristic of the sensing element. The specifying unit specifies a rate of degradation. The detection unit detects the amount of the energy on the basis of the rate of degradation.
US07805268B2
A bicycle component calibration device and method are provided that assist the user in determining that an adjustment was made. Basically, when a calibration command in inputted to indicate a selected adjustment amount in a selected adjustment direction, the bicycle component (e.g., a derailleur) initially moves farther than the selected adjustment amount in a first direction by an adjustment indicating amount in response to the calibration command, and then subsequently moves the bicycle component in a second direction to the selected adjustment position in which the second direction is opposite to the first direction. The adjustment indicating amount is greater than the selected adjustment amount of the calibration command. Finally, the selected adjustment position is set as an adjusted position of the bicycle component.
US07805267B2
The present invention relates to verification of a transmission margin of various transmission lines transmitting a signal such as a high-speed digital signal and ensures improved verification accuracy. A transmission margin verification apparatus according to the present invention is configured with a measurement unit (e.g., LSI tester 4, network analyzer 6, pulse generator 8, oscilloscope 10) operable to measure a transmission loss and a leading edge waveform of pseudo transmission lines (e.g., transmission lines 56, 62, 66) corresponding to a target device 44 to be verified, and a calculation unit (tester controller 12) operable to reference the transmission line loss and the leading edge waveform measured by the measurement unit, calculate a transmission waveform of the target device, and associate the transmission waveform with a mask of the target device to calculate a transmission margin of the target device.
US07805262B2
A utility meter having a temperature compensation function provides advantages such as improved time keeping accuracy. According to an exemplary embodiment, a utility meter includes at least one sensor for detecting an ambient temperature at a location corresponding to a component such as a crystal oscillator that enables a time keeping function of the meter, and generating an output signal representative of the detected ambient temperature. A device such as a digital signal processor adjusts at least one clock maintained by the time keeping function of the meter in dependence upon the output signal from the at least one sensor.
US07805259B2
A method for detecting an operation malfunction of a leakage inspector causes the leakage inspector to execute a calibration process and an inspection process. The calibration process seals air inside a first device serving as a reference device and measures changes in pressure over two time intervals. The inspection process seals air inside a second device to be checked for a leak and measures changes in pressure over two time intervals. A ratio is calculated from these measured changes in pressure and the ratio is used to determine whether an operation malfunction occurs in the leakage inspector.
US07805256B2
A method of processing time-discrete measured values, which can be described in their time characteristic by a first exponential function which has a first time constant, the method comprising the steps of: detecting a first measured value and storing the first measured value, detecting a second measured value and storing the second measured value according to a defined time interval with respect to the detection of the first measured value, filtering the first measured value and second measured value by calculating a sum of the first measured value and a weighted difference between the second measured value and the first measured value, thereby generating time-discrete output values which can be described in their time characteristic by a second exponential function having a second time constant different from the first time constant, and outputting the output values is disclosed.
US07805245B2
A method of implementing a fault-tolerant-avionic architecture in a vehicle includes using parity logic to monitor the functionality of at least three non-fault-tolerant inertial measurement units during a parity check and calculating a threshold from expected inertial measurement unit performance during a parity check. If a failure of an inertial measurement unit is detected based on the calculated threshold, then the method further includes identifying the failed inertial measurement units based on a direction of a parity vector in parity space. Each inertial measurement unit comprises at least one triad of sensors.
US07805231B2
A vehicle crash sensing system and method are provided for sensing a vehicle crash event. The system includes a linear acceleration sensor located on a vehicle for sensing linear acceleration along a first sensing axis and generating a linear acceleration signal. The system has linear crash sensing logic for determining a crash event along the first sensing axis as a function of the sensed linear acceleration. The system also has signal processing circuitry for processing the linear acceleration signal and generating a processed linear acceleration signal. The system has an angular rate sensor located on the vehicle for sensing an angular roll rate of the vehicle about a second sensing axis and generating a roll rate signal. The system further includes rollover crash sensing logic for determining a rollover event of the vehicle about the second sensing axis as a function of the processed linear acceleration signal and the roll rate signal.
US07805227B2
A method for tracking assets within a rail yard, the method comprising: creating a track layout database for the rail yard, the track layout database providing a map of rail tracks and switches within the rail yard, wherein the track layout database includes machine readable data identifying discrete locations of the rail tracks and switches of the rail yard, each discrete location corresponding to a geographical position of a portion of a rail track or switch; associating rail yard processing steps with portions of the track layout database; receiving a geographical position signal corresponding to an asset within the rail yard; comparing the geographical position signal to the machine readable data of the track layout database in order to identify the location of the asset within the map; and presenting a graphical representation of the location of the asset on the map along with the yard process steps associated with the track section occupied by the asset, wherein the geographical position signal is received within a time period to allow the graphical presentation to be used in a management decision corresponding to the asset.
US07805224B2
A vehicle control system and method for facilitating operation of a vehicle by a driver with a potentially debilitating condition. At least one sensor provides sensor data corresponding to at least one of a vehicle condition or a driver condition. A database includes potentially debilitating condition data and symptoms data corresponding thereto. A central processing unit is in data communication with the database and the at least one sensor. The central processing monitors the operation of the vehicle by the driver based on the sensor data and the database.
US07805220B2
A robot cleaner is described that cleans a room using a serpentine room clean and a serpentine localized clean. Sensors can include an object following sensor, a stairway detector and bumper sensors.
US07805219B2
A carrier robot system and a control method for a carrier robot enabling teaching even when an operator cannot approach a teaching position for wafer conveyance are provided. In a carrier robot system comprising a robot which has a placement portion for placing an object presenting a low-profile form thereon and carries the object and a robot controller for controlling the robot, a jig mounted on the placement portion of the robot and having an image pickup member, an image processing portion for processing an image picked up by the image pickup member, and a superior control portion for controlling the robot controller and image processing portion from a superior position are provided.
US07805216B2
A medicament dispensing cabinet is comprised of a frame, at least one controller, and a plurality of drawers each movably carried by the frame and each defining a plurality of dispensing cells. A plurality of removable dispensing devices is provided with each one carried by one of the dispensing cells. Each of the dispensing cells further comprises a motor for providing rotary motion to one of the removable dispensing devices in response to the controller, a sensor operating in conjunction with the controller for counting medicament dispensed from one of the removable dispensing devices, a chute for receiving medicament dispensed from one of the removable dispensing devices and a chute gate for controlling access to the chute. The cabinet may additionally comprise a chute gate release responsive to the controller for controlling the chute gate and a chute gate sensor connected to the controller and responsive to the position of the chute gate. The cabinet may be used in conjunction with a number of processes including dispensing, secure-pickup (insuring the person picking up the dispensed medicament is authorized to do so), back-end verification (verifying the identity of the person picking up the dispensed medicament), a process for removing a dispensing device from a drawer, and a process for inserting a dispensing device into a drawer.
US07805215B2
A programming device programs a machining control program to be used on a numerical control device for machining an object. A setting unit sets an axial direction of the tool with respect to the data on the machining-target area and sets a deepest position of a tip of the tool with respect to the data on the machining-target area. An extracting unit extracts a surface-machining-target area of the object from the data on the machining-target area based on the set axial direction of the tool, the set deepest position of the tip, and the data on the machining-target area.
US07805214B2
A grasp state judging system capable of satisfactorily judging the grasp state in which an object to be grasped is held by grasping means. The grasp state judging system is characterized in comprising a plurality of RFID tags that are mounted on an object to be grasped and that transmit the corresponding position ID; a plurality of RFID antennas (14) that are mounted on a glove (10) and that receive the position IDs; a grabbing pattern storage unit (48) for storing a condition for the position IDs received by the RFID antennas (14) with respect to the grasp states in which the object to be grasped is held by the glove (10); and a grasp state judging unit (44) for judging the grasp state in which the object to be grasped is held by the grasping means on the basis of the position IDs received by the RFID antennas (14) and the conditions stored in the grabbing pattern storage unit (48).
US07805210B2
A server is arranged to distribute at least one stream of audio data corresponding to an audio signal to two or more speakers across a network. Each speaker includes a respective clock for regenerating the audio signal from the audio data. For each speaker, the server determines a relative rate of the speaker clock to a real time rate; and for each stream of data provided to a speaker, the server determines from a respective relative rate, respective samples of the audio signal to be altered in accordance with said relative rate. The streams are altered accordingly and transmitted across the network.
US07805209B2
A contact-less safety device, i.e., a safety device operating without contact has an interface for the transmission of output signals to connectable appliances for signal processing. The output signals from the individual sensors of the safety device operating without contact can be transmitted separately via the interface.
US07805203B2
A method is provided that includes surgically implanting an electrode device having a cuff and one or more electrodes mounted in the cuff, by placing the electrode device around a nerve such that the electrodes face the nerve. Conductive solution is introduced into the electrode device such that the solution is in contact with both the electrodes and the nerve. During implantation of the electrode device, an impedance is measured between one or more of the electrodes and an electrical contact point in electrical communication with the electrode device. Responsively to the impedance measurement, it is determined whether the electrode device is correctly sized for the nerve, and, if not, the electrode device is removed and another electrode device having a different size is implanted. Other embodiments are also described.
US07805199B2
An apparatus and method for adjusting the performance of an implanted device based on data including contextual information. Contextual information, including operational and performance data concerning the implanted device as well as the patient with the implanted device, is stored by a portable electronic device. In one embodiment, the portable electronic device is adapted for battery operation and includes a personal digital assistant (PDA). The portable electronic device is adapted for use as an interface to conduct wireless communications with the implanted device. In one embodiment, the portable electronic device interfaces with a clinical programmer for use by a physician.
US07805193B2
A method and device for delivering ventricular resynchronization pacing therapy in conjunction with electrical stimulation of nerves which alter the activity of the autonomic nervous system is disclosed. Such therapies may be delivered by an implantable device and are useful in preventing the deleterious ventricular remodeling which occurs as a result of a heart attack or heart failure. The device may perform an assessment of cardiac function in order to individually modulate the delivery of the two types of therapy.
US07805185B2
Cardiac monitoring and/or stimulation methods and systems that provide one or more of monitoring, diagnosing, defibrillation, and pacing. Cardiac signal separation is employed to detect, monitor, track and/or trend a patient's posture using cardiac activation sequence information. Devices and methods involve sensing a plurality of composite cardiac signals using a plurality of implantable electrodes. A source separation is performed using the composite cardiac signals, which produces one or more cardiac signal vectors associated with all or a portion of one or more cardiac activation sequences. A change in a patient's posture is detected using the cardiac signal vectors. Further embodiments involve sensing the plurality of composite cardiac signals during the patient's predominant cardiac rhythm before detecting the change in the patient's posture. Other embodiments involve discriminating between one of a postural related change and a cardiac rhythm related change using the cardiac signal vectors.
US07805180B2
Described herein is a medical imaging technique that includes directing ultrasound waves into a portion of a body of interest during at least a portion of a time period during which an MR imaging process is simultaneously performed on the portion of the body of interest such that the MR signal is altered by the application of the ultrasound waves. The ultrasound waves may be applied continually during the MR imaging process, or only during a portion thereof. The frequency of the ultrasound waves may be substantially the same as, or different than that of the MR signals. Images may be produced from only the MR imaging process or both the MR imaging process and the application of ultrasound waves prior to the imaging sessions.
US07805179B2
A method of examining cardiac electromagnetic activity over a heart for diagnosing the cardiac functions of the heart is disclosed. The method may include constructing a phase diagram of electromagnetic signals over a heart by collecting sets of time-dependent magnetic signals, determining the zeroth and the first derivations of each set of the magnetic signals at a given time, and categorizing the zeroth and the first derivations of the magnetic signals in either of the four phases: (+, +), (−, −), (+, −), (−, +). The method may also include monitoring a wave propagation of the magnetic signals.
US07805175B2
The present invention provides a microarray bioprobe device integrated with a semiconductor amplifier module, which integrates micro array biological probes and thin film transistors on a flexible substrate by Micro-Electro-Mechanical System (MEMS) processes and semiconductor processes. A signal from the microarray bioprobe device is amplified through a near amplifier to increase signal-to-noise ratio and impendence matching. The micro array biological probes of the present invention are produced on the flexible substrate such that the micro array biological probes can be disposed to conform to the profile of a living body's portion and improving contact between the probes and living body's portion.
US07805168B2
A portable digital device includes: a digital broadcast receiving unit receiving digital broadcasting information; a first display unit outputting the received digital broadcasting information; a first input unit controlling the first display unit; a second display unit, separated from the first display unit, outputting the received digital broadcasting information; a second input unit controlling the second display unit; and a digital broadcasting data converting unit converting the received digital broadcasting information for display on the first display unit or the second display unit and providing the converted digital broadcasting information to the first display unit or the second display unit.
US07805162B2
A method of printing content representative of an object on a print medium using a mobile telecommunications device, comprising the steps of: identifying an object using the mobile telecommunications device; receiving the print medium in a media feed path of the mobile telecommunications device; determining a print media identifier from the print medium using a sensor module of the mobile telecommunications device; and, printing content representative of the object on the print medium using a printer module of the mobile telecommunications device.
US07805155B2
A mobile terminal selects neighbor cell(s) to use in receiving a broadcast or multicast by deriving an estimate of cell quality for each neighbor cell; comparing the estimated quality with a minimum acceptable quality; and choosing those neighbor cells having the highest quality from the acceptable neighbor cells. The estimate of cell quality is based on a parameter of the difference between a common pilot channel transmit power and a secondary common control physical channel transmit power that is transmitted to the mobile terminal on a multimedia broadcast multicast control channel.
US07805153B2
A transmission power control system can establish synchronization by matching adjustment start timings while repeating adjustment periods even when start timings of transmission power balance adjustment are different due to fluctuation of transmission delay of control message from the control station to base station, and can increase circuit capacity by establishing balance of transmission powers between the base stations. In the transmission power control system the base station comprises control means for controlling initiation of a balance adjustment period for performing the balance adjustment from a frame number determined on the basis of frame number of the balance adjustment period.
US07805151B2
Provided, inter alia, is a system for generating substantially simultaneous alerts, in which a plurality of user devices is accessible via at least one publicly available network. Each such user device has installed on it an alert-based client. A server is configured to download identical alert information, including a message that has been encrypted, to the plurality of user devices. The alert-based clients are configured to receive the alert information and, in response: (i) to store the message in encrypted form until just prior to a specified delivery time; and (ii) to decrypt and deliver the message substantially at the specified delivery time. By virtue of the foregoing arrangement, substantially simultaneous delivery of the message to the user devices is achieved.
US07805150B2
In at least one embodiment, a mobile device detects proximity to a point on a route and determines whether an audio track is associated with the point. In response to detecting that the mobile device is proximate to the point and a determination that an audio track is associated with the point, the mobile device presents the audio track.
US07805138B2
An apparatus in one example has: a home network and at least one partner network; a mobile terminal associated with the home network; a high threshold for use when the mobile terminal roams from the home network to the partner network; and a minimum threshold for use when the mobile terminal roams from the partner network to the home network.
US07805134B2
An approach is provided wherein a lack of wireless connectivity between a wireless network device and a wireless network is detected, and the wireless network device connects to an administrator device over a separate wireless network. Network configuration data is transmitted from the administrator device to the wireless network device over the separate wireless network and based on the network configuration data the wireless network device attempts to reconnect to the wireless network.
US07805129B1
The present invention provides a system and method for recommending operational information, such as play lists or settings, for one or more devices associated with a local wireless network based on content information describing content stored on a number of user devices within the local wireless network. More specifically, a recommendation engine obtains the content information for a number of user devices within the local wireless network from either a central node or the user devices and analyzes the content information to recommend operational information for one or more devices associated with the local wireless network.
US07805126B2
A method for charging for services in a communication system comprises a charging entity. The method comprises a step of sending a first message to the charging entity. The method also comprises a step of generating a charging identity at the charging entity if it is determined that the first message does not include a charging identity.
US07805125B2
A system for managing emergency alarm messages in a wireless communications system is disclosed. A first subscriber is assigned an emergency alarm responder role to send an acknowledgement message and present information from a received emergency alarm message to a user of the first subscriber, when the first subscriber receives the emergency alarm message. A second subscriber is assigned an emergency alarm monitor role to present information from the received emergency alarm message to a user of the second subscriber.
US07805124B2
Frequency pattern generator (1, 101, 201) for generating frequency pulses, said generator having a first local oscillator unit (2-1, 121, 221) for generating a first radio frequency carrier frequency signal (LO1), at least one second local oscillator unit (2-2, . . . 2-N, 122, 222) for generating at least one second radio frequency carrier frequency signal (LO2), a switching device (3, 103, 203) for passing on one of the radio frequency carrier frequency signals (LO1, LO2) or a zero signal (DC) in a manner dependent on a control signal (CTR), and a mixing stage (9, 109, 209, 212, 309) for mixing the signal (LO) that has been passed on by the switching device (3, 103, 203) with a mixing frequency signal (LF) to form a pulsed output signal (RFOUT), the pulsed output signal (RFOUT) having frequency pulses at a respective frequency (f1, . . . f8) and length (Tp) in a manner dependent on the control signal (CTR).
US07805111B1
Wireless system electromagnetic propagation or attenuation design or analysis is performed by determining (by calculation or empirically) the attenuation between all sets of grid points of a terrain. To make the information readily available, the results of the determinations are stored in computer memory. The information is stored in the form of bytes representing integer values of decibels, and the information is stored only for those grid points corresponding to a log-radial (log-polar) mapping. In order to use the data for analysis or design, the desired values are estimated from the log-radial mapping.
US07805109B2
A detachable earphone structure includes an earphone body and a transmitter detachable from the earphone body. The earphone body has an opening portion, a pair of connecting terminals installed in the opening portion and electrically connected to an internal circuit. The transmitter has a pair of contact terminals stored in the opening portion of the earphone body or detachably connected to the earphone body for electrically conducting the connecting terminal and the contact terminal through the contact of the connecting terminal with the contact terminal.
US07805104B2
An information reading device for reading identification information from a medium to which at least one magnetic element for generating a signal upon receiving a magnetic field is provided, which includes a plurality of detecting parts that detect a signal generated from the magnetic element according to the magnetic field applied to the medium, and an information reading part that reads information formed by the magnetic element based on a combination of detecting parts which have detected the generated signal.
US07805098B2
The development device of the present invention has a rotating shutter supported rotatably between a supply opening formed on a toner supply device and a receiving opening formed on a developing tank. The rotating shutter has an open section extending in the axial direction of the roller-shaped main section as well as opened in the direction perpendicular to the axial direction thereof, opening and shutting the supply opening in conjunction with attachment and detachment operation of the developing tank. The rotating shutter shuts the supply opening by covering the supply opening with the outer surface of the roller-shaped main section, and opens the supply opening by communicating the supply opening and the receiving opening through the open section. Thus, it is possible to prevent the leakage of toner even after repetitively performing the attachment and detachment operation of the developing tank.
US07805096B2
In a supply passage assembly having a toner passage arranged under a toner bottle for conveying toner supplied from the toner bottle to a developing unit arranged below, a toner conveying pipe for forming the toner passage is formed of an elastic material and a toner conveying pipe deforming member is arranged adjacent to the toner conveying pipe for elastically deforming the toner conveying pipe.
US07805087B2
An image forming apparatus includes a sheet conveying device configured to convey a sheet along a conveying path, a fixing roller configured to perform thermal fixing on the sheet having unfixed toner, a motor configured to rotationally drive the fixing roller, a first sheet detector disposed downstream from the fixing roller, a second sheet detector provided between the first sheet detector and the fixing roller and where the second sheet detector does not detect the sheet when the sheet is being properly conveyed, and a controller configured to perform motor stopping methods for stopping the driving of the motor, wherein the methods providing different motor stopping capabilities. When the first sheet detector is not detecting the sheet at a predetermined timing, the controller selects from the methods on the basis of a detection result of the second sheet detector.
US07805086B2
An image forming apparatus in which the consumption article can be attached to and detached from a main body has a controller, which reads first new/old information that is stored in a repetitively rewritable area of a memory provided on the consumption article and represents whether or not the consumption article is unused after manufacturing or after recycling and second new/old information that is stored in a once rewritable area of the memory and represents the number of times of recycling of the consumption article and controls the operation of the image forming apparatus on the basis of the first new/old information and the second new/old information.
US07805083B2
Method and apparatus for data recovery in optical transmission systems include parallel detection subcircuits for determining output values of sequentially provided optical data bits such that sequentially provided optical data bits are alternately processed by respective ones of the parallel detection subcircuits. For example, in one embodiment of the present invention, clock values to be used for timing provided to the first parallel detection subcircuit are 180° out of phase with clock values provided to the second parallel detection subcircuit, such that the first parallel detection subcircuit and the second parallel detection subcircuit alternately process input optical data bits according to odd valued clock signals and even valued clock signals. Furthermore, the outputs of the parallel detection subcircuits are connected crosswise to provide control signals for their parallel counterparts. In principle, various decisions are made using decision circuits and desired output values are selected based on the previously decided bits.
US07805081B2
Methods and systems for monitoring a plurality of different optical signals from a single source of such signals, where each such different optical signal is spatially separated from other such signals and directed to different detectors or locations upon a single detector, which direction is generally accomplished through the use of a small number of optical components and/or manipulations.
US07805080B2
An optical interconnect has a plurality of optical data sources, a plurality of optical data receivers, a diffractive optical element configured to diffract an optical beam from at least one alignment optical source to at least one sensor, and an aligning element configured to align optical beams from the optical data sources to said optical data receivers, according to readings from the sensor.
US07805079B1
Photonic signals are tagged with a pre-selected modification, such as a polarization signature to carry data across an obstructed path between sender and receiver. Communication authentication through polarization variation allows for Yuen-Kumar or entangled photon quantum communication protocols to propagate through environmental scattering media such as air, smoke, fog, rain, and water. While ultraviolet light photons are well suited as a carrier for quantum communication signals scattered in air, it is appreciated that visible wavelengths have longer propagation paths in water to convey non-line-of-sight data. A secure signal is scattered by the media and simultaneously communicated to a single recipient or multiple recipients exposed to scattered signal portions. A process of solving the scattering processes through a random scattering media is provided to reconstruct a quantum keyed message at a receiver. The scattering of the signal is utilized herein to provide non-line-of-sight and intentional short-range communication.
US07805073B2
Systems and methods for optical path protection for distributed antenna systems are provided. In one embodiment, a method is provided. The method comprises receiving an electrical uplink radio frequency signal; generating an uplink optical signal derived from the electrical uplink radio frequency signal; splitting the uplink optical signal for transmission on a primary uplink optical fiber and a secondary uplink optical fiber; combining any downlink optical signal received on a primary downlink optical communication medium and any downlink optical signal received on a second downlink optical communication medium in order to output a downlink optical signal; and generating a downlink radio frequency signal derived from the downlink optical signal.
US07805063B2
The invention teaches a speed control system for a brushless DC motor for a ceiling fan, comprising a power circuit 1, a microprocessor circuit 2, a power drive circuit 3, a speed regulation circuit, and a brushless DC permanent magnetic motor 5, wherein the input terminal of the power circuit 1 is connected to the output terminal 101 of an AC power source, the output terminal of the power circuit 1 serves to power the various circuits, the output terminal of the microprocessor circuit 2 is connected to the input terminal of the power drive circuit 3, the output terminal of the power drive circuit 3 is connected to the coil windings 501 of the brushless DC permanent magnetic motor, and the output terminal of the speed regulation circuit is connected to the input terminal of the microprocessor circuit 2. The speed control system of the invention provides the advantages of low energy consumption, low noise during the operation of the motor, and a stable operation at low speeds.
US07805061B2
A structure of navigation information for video data recorded on a recording medium and recording and reproducing methods and apparatuses using the structure. The method of recording video data in accordance with the present invention records video data on a recording medium with organizing the video data into navigation units and interleaving navigation units of different reproduction paths with one another in multiple reproduction path segments. An information entry is created for each navigation unit and the information entry comprises information indicating whether the associated-navigation unit is in a multiple reproduction path segment and information for identifying the reproduction path to which the associated navigation unit belongs.
US07805058B2
The present invention displays subtitles in a language desired by a user in a desired format. A text data decoder 121 decodes text subtitle data, supplies a character object to a character object buffer 122, and supplies attribute data to an attribute data buffer 123. The attribute data stored in the attribute data buffer 123 is changed on the basis of an operation input from the user. A font rasterizer 124 converts the character object into raster data on the basis of attribute specification read from the attribute data buffer 123 and acquired font data, and outputs the raster data. By detecting each character object bearing a bookmark on the basis of the attribute and using a bookmark buffer 125, character objects bearing the same bookmark ID are prevented from being repeatedly rasterized. The present invention is applicable to a playback apparatus.
US07805056B2
A method and apparatus provides a modified color stripe video copy protection signal. Normally, prior color stripe video copy protection signals include a color burst signal in which all cycles of subcarrier have an incorrect (i.e., non-normal) phase, thereby to provide copy protection effects on a video recorder. To improve playability, the present application provides a modified color stripe video copy protection signal which has no effect on a TV set. This modified color stripe signal comprises a color burst envelope that has cycles of normal phase as well as cycles of non-normal phase. On selected video lines, the modified color stripe signal incorporates a color burst signal consisting of two or more segments, with each segment having a predetermined phase. In another embodiment, the modified color stripe signal includes an expanded duration color burst envelope.
US07805054B2
An input signal is quantized into a quantization-resultant signal. The quantization-resultant signal is compressed into a compression-resultant signal. The compression-resultant signal is formatted into a formatting-resultant signal corresponding to a predetermined format for a digital recording disc. The formatting-resultant signal includes segments corresponding to user data areas prescribed in the predetermined format. The compression-resultant signal is placed in the segments of the formatting-resultant signal. The formatting-resultant signal is encoded into an encoding-resultant signal of a CD format. The encoding-resultant signal is recorded on a recording medium.
US07805052B2
A video recording apparatus for continuously presenting a main program to a user without a break while presenting a commercial. A main program buffer records a main program of a video signal in accordance with a temporal position of at least the main program or commercials in the video signal, and a commercial buffer records the commercials. A controller determines whether a current time is in a period to display a commercial, on the basis of at least the temporal position of the main program or the commercials in the video signal. A mixer mixes the main program and the commercials such that the main program is temporally continuously displayed in a full screen area and such that a commercial is displayed in a small area in the bottom right corner of the screen during a period in which the commercial should be displayed.
US07805033B2
The invention provides an optical mux/demux for an optical printed circuit board. The mux/demux comprises: a first waveguide formed on a support layer for carrying a wavelength division multiplexed optical signal; a separator/combiner for separating the wavelength division multiplexed signal into component signals of corresponding wavelengths or for combining component signals into the said wavelength division multiplexed signal; and plural second waveguides, each for receiving or providing one or more of the said component signals, wherein the separator/combiner is at a predetermined location relative to the waveguides.
US07805029B2
There is provided a feedback-controlled self-heat-monitoring fiber, including an insulator having a fiber length with at least one metal-semiconductor-metal thermal sensing element along the fiber length and disposed at a position in a cross section of the fiber for sensing changes in fiber temperature. An electronic circuit is connected to the thermal sensing element for indicating changes in fiber temperature. A controller is connected for controlling optical transmission through an optical transmission element, that is disposed along the fiber length, in response to indications of changes in fiber temperature.
US07805026B2
In one embodiment, an optical modulator has a Mach-Zehnder interferometer (MZI) and an optical resonator coupled, via a tunable optical coupler, to one of the MZI internal arms. The optical resonator induces in the MZI frequency-dependent optical losses characterized by a comb of spectral resonances. The coupling strength between the optical resonator and the MZI set by the optical coupler controls the magnitude of the loss due to the resonances, while one or more optical phase shifter located in the optical resonator controls the spectral position of the resonances. Either the optical coupler or the optical phase shifter, or both, can be tuned to adjust the modulator's radio-frequency response curve.
US07805022B2
The present invention allows a thumbnail display representing the outline of input images in a digital image printer to be made, in which it is determined whether an image is a first kind of image or a second kind of image, and if it is determined that the image is the first kind of image, a feature part of the first kind of image is enlarged in the thumbnail display to make the contents of image more understandable.Also, the invention allows a thumbnail display representing the outline of input images in a digital image printer to be made, in which it is determined whether an image is a character image or a gradation image, and if it is determined that the image is the character image, a part of the character image is enlarged in the thumbnail display to make the characters more understandable.
US07805021B2
A method to detect edges based on chrominance information alone or in combination with gray level values includes comparing chrominance values to a registration parameter based on chromacity measurements of a backing. To calibrate a system, a small scan obtains sample image data for the backing in the document feeder. Using the sampled image data, average chrominance values for the backing are determined. Based on the averages, a channel having a low chrominance contribution is selected as the registration channel. A registration parameter is calculated for automatic registration of documents based on the average chrominance and chrominance deviation for the registration channel.
US07805017B1
A method of improving the lighting conditions of a real scene or video sequence. Digitally generated light is added to a scene for video conferencing over telecommunication networks. A virtual illumination equation takes into account light attenuation, lambertian and specular reflection. An image of an object is captured, a virtual light source illuminates the object within the image. In addition, the object can be the head of the user. The position of the head of the user is dynamically tracked so that an three-dimensional model is generated which is representative of the head of the user. Synthetic light is applied to a position on the model to form an illuminated model.
US07805015B2
A computer implemented method, apparatus, data processing system, and computer usable program code are provided for identifying interest points. A set of digital images and a set of threshold values are received, where the set of digital images includes a set of digital frames. A set of directional values are calculated for each of a set of pixels within each digital frame in the set of digital frames. A set of interest points are identified within each digital frame in the set of digital frames using the set of threshold values and the set of directional values. Finally, a set of characteristics is identified for the set of interest points.
US07805001B2
A method for determining asymmetry in an image such as an MR image of a brain comprises determining a symmetry plane to divide the image into a first part and a second part representative of, for example, the hemispheres of the brain. The probability distributions of voxels against intensities are determined for the first and second parts and histograms of intensities representative of the parts are generated. Compensation is made for any relative shift along a predetermined axis between the histograms. A divergence value based on a distance between the first and second histograms is then calculated and it is determined if the calculated divergence value is greater than a predetermined threshold. A divergence of greater than the predetermined threshold is indicative of asymmetry in the image that may be considered as suspicious for abnormality. There is also disclosed an apparatus for determining asymmetry in an image.
US07804999B2
A method for performing image based regression using boosting to infer an entity that is associated with an image of an object is disclosed. A regression function for a plurality of images is learned in which for each image the associated entity is known. The learned regression function is used to predict an entity associated with an image in which the entity is not known.
US07804998B2
A markerless motion capture system is provided for measurements accurate enough for biomechanical, clinical, sport, entertainment, animation, game and movie, design, ergonomics, surveillance applications. The system has multiple cameras distributed around a viewing volume. The cameras allow for the creation of three-dimensional mesh representations of an object dynamically moving within the viewing volume. A model of the object that incorporates specific morphological and kinematic model information (including soft joint constraints) is then matched to the captured three-dimensional mesh representations. The matching routine aims to embed the model into each of the three-dimensional representations using (i) iterative closest point or simulated annealing algorithms and (ii) using soft joint constraints. This unique combination of routines offers a simple, time-efficient, accurate and thus more meaningful assessment of movements. The system further offers feasibility of accurately and precisely measuring three-dimensional kinematics of the dynamically moving object or human.
US07804994B2
An overlay method for determining the overlay error of a device structure formed during semiconductor processing is disclosed. The overlay method includes producing calibration data that contains overlay information relating the overlay error of a first target at a first location to the overlay error of a second target at a second location for a given set of process conditions. The overlay method also includes producing production data that contains overlay information associated with a production target formed with the device structure. The overlay method further includes correcting the overlay error of the production target based on the calibration data.
US07804988B2
A filter method for tomographic 3D displays is disclosed, in which a volume model is used for display, which reproduces the volume of the examination object in the form of a large number of three-dimensional image voxels, and the image value of each voxel reproduces one object-specific characteristic of the examination object in this volume. According to the method, the original image voxels are processed using a 2D filter which is the same over the entire image area, and two different linear filters with selected directions which are obtained from the extremes of the previously calculated variances thus resulting in three data records with differently filtered image voxels, and in which, furthermore, the original image voxels and the filtered image voxels are mixed using local weights to form a result image. In addition, original image data can be processed using a steepening linear filter with a filter direction in the direction of the maximum local variance, resulting in a data record which is mixed into the final image with locally different weighting.
US07804985B2
Impact resistant circuit modules are disclosed for enclosing a die having a sensor area. Preferred modules include a flexible circuit and a die coupled thereto. The flexible circuit is preferably folded over compressible material to help absorb applied forces. A gap may be provided between sides of the die and the compressible material to help prevent peeling. A metal reinforcing layer may be bonded to the back of the die. A low modulus material including a patterned gap underneath the die may be used to absorb forces. A dry film adhesive may be placed between at least part of the upper surface of the die and the flexible circuit, preferably to provide further point impact resistance and protection. High and low modulus material may be combined in ruggedizing structures. Consumer devices employing such circuit modules are also taught, as well as module construction methods.
US07804984B2
Methods and apparatus are provided of deriving a discrimination feature set for use in identifying biometric spoofs. True skin sites are illuminated under distinct optical conditions and light reflected from each of the true skin sites is received. True-skin feature values are derived to characterize the true skin sites. Biometric spoofs is similarly illuminated under the distinct optical conditions and light reflected from the spoofs is received. Spoof feature values are derived to characterize the biometric spoofs. The derived true-skin feature values are compared with the derived spoof feature values to select a subset of the features to define the discrimination feature set.
US07804969B2
Improved impact proof capability of a silicon microphone sensing element is achieved with a stopper element that limits the maximum vibration of moveable parts. The stopper has a lower anchor portion and upper finger portion that is elevated a certain distance above the diaphragm and overhangs the outer edges of the perforated plates. The stopper is formed on a stack consisting of a lower substrate, a middle dielectric layer, and an upper membrane layer. There is a back hole in the substrate and an air gap in the dielectric layer to allow sound to impinge on the diaphragm. The number of fingers and composition of the stopper is variable. Optionally, the stopper has a center support design and is formed on a center anchor within an opening in the diaphragm. An upper finger region overhangs the diaphragm near the center opening and thereby prevents breakage due to large vibrations.
US07804962B2
A wireless sensor network may be designed by modeling the network as a function of at least one design parameter and/or at least one threat parameter ∈, by assessing the model by varying the at least one design parameter to determine an effect on the at least one threat parameter ∈, and by choosing a value for the at least one design parameter based on the assessment that produces an acceptably low value for the at least one threat parameter ∈.
US07804961B2
A method and apparatus for fast generation of a cryptographic key. A processor within a wireless communication device generates a public key upon termination of wireless communication. When a user of the wireless communication device desires to initiate a secure communication subsequent to the previous communication, the public key that was generated upon termination of the previous communication is used to engage in secure communications with a second communication device.
US07804959B2
A global platform card manager of the IC card chip includes a conditional access software decoding part. A decoding key specific to each conditional access software vendor and a key identification number corresponding to the decoding key are preset in the conditional access software decoding part. The conditional access software encrypted by the conditional access software vendor is decoded using the decoding key designated by the key identification number in the conditional access decoding part, when received.
US07804958B2
A method and apparatus for storing and retrieving program material for subsequent replay is disclosed. In summary, the present invention describes a system and method for storing and retrieving program material for subsequent replay. The method comprises the steps of accepting encrypted access control information and the program material encrypted according to a first encryption key, the access control information including a first encryption key and control data; decrypting the received access control information to produce the first encryption key; decrypting the program material using the first encryption key; re-encrypting the program material using according to a second encryption key; encrypting the second encryption key according to a third encryption key to produce a fourth encryption key; and providing the re-encrypted program material and a fourth encryption key for storage. The apparatus comprises a conditional access module, for accepting encrypted access control information and the program material encrypted according to a first encryption key, the encrypted access control information including the first encryption key and temporally-variant control data, the control access module comprising a first decryption module, for decrypting the access control information to produce the first encryption key; a first encryption module, for encrypting a second encryption key with a third encryption key to produce a fourth encryption key; and a second decryption module for decrypting the fourth encryption key to produce the second encryption key.
US07804953B1
Outbound calls are processed in a telecommunications network. Schedule service data associated with network terminating addresses is stored in a memory of a content platform. During a connectivity session between the content platform and a first media platform configured for interactive voice response for outbound calling, available outbound port capacity of the first media platform is determined at the content platform. If the outbound port capacity of the first media platform is not available, a request for redirecting outbound calling capacity from a first outbound call production platform to a second outbound call production platform is transmitted to an outbound calling scheduler.
US07804952B2
This invention provides the ability to load balance calls in a communications network using a certain criterion, such as a user-specified call priority, or the call class of service. The method is applied when selecting a route for a new call or for re-balancing the calls across a network. When the user-specified call priority is used, the aggregated number of calls with the same priority or class of service is calculated for all possible routes the new call may use. The aggregated number of calls is then divided by the number of hops in the respective routes; the route with the smallest ratio is selected for the new call. Re-balancing is performed by re-routing the calls in such a way as to obtain a similar number of calls of the same priority, or class of service, along all possible routes.
US07804945B2
A telecommunications messaging architecture efficiently routes messages to the appropriate support systems which process the messages. The messaging architecture is a partially merged architecture in which selected previously independent processing systems (e.g., customer relationship management systems) have been merged. Despite the partially merged architecture, a routing system flexibly routes messages between the merged systems and the appropriate supporting systems. The supporting systems may multiple independent billing systems which have not been merged, for example.
US07804943B2
An exemplary method implements load management for large granularity processes on application processors, APs. First data associated with the primary processes running on each AP is periodically collected, where the first data is proportional to processor occupancy, PO, for the primary processes running on each AP. Second data associated with auxiliary processes running on each AP is periodically collected where the auxiliary processes directly support the primary processes running on the respective AP. The second data is proportional to PO for the auxiliary processes running on each AP. A processor scaling factor and an overhead scaling factor are calculated for each AP based on the first and second data, respectively. The total amount of additional PO a second AP would incur to run a first large granularity process is determined by two aspects. The amount of additional PO due to the primary process is determined by applying at least the second processor scaling factor to a value related to an amount of primary process PO of the first process running on the first AP. The amount of additional PO due to overhead processes is determined by applying the overhead scaling factor of the second AP to the previously determined amount of additional PO due to the primary processes determined for the second AP.
US07804930B2
The nuclear fuel assembly having nuclear fuel rods and a support skeleton having two nozzles, guide tubes interconnecting the nozzles, and spacer grids for holding the rods, the grids being secured to the guide tubes. The assembly further has at least one lattice reinforcing device for reinforcing the support skeleton. The reinforcing device is placed between two spacer grids and is secured to the guide tubes. The invention is applicable to fuel assemblies for pressurized water reactors.
US07804927B2
A digital waveform synthesiser (1) is implemented as a single chip integrated circuit on a single chip (2) and comprises a direct digital synthesiser (10) which produces a synthesised output signal waveform on an output terminal (4) which is substantially phase and frequency locked to the phase and frequency of an externally generated input signal applied to an input terminal (5). A comparing circuit (20) compares the period of the synthesised output signal waveform on the output terminal (4) with the period of the input signal, and a control circuit (28) produces progressively altered values of a frequency control digital word which are sequentially applied to an accumulator (11) of the direct digital synthesiser (10) in response to the comparing circuit (20), until the value of the frequency control digital word applied to the accumulator (11) is such as to produce the synthesised output signal waveform to be substantially phase and frequency locked to the phase and frequency input signal applied to the input terminal (5).
US07804925B2
A detection arrangement includes a counter unit which receives a first clock signal and a reference clock signal. The counter unit derives a first data word as a function of a time deviation between clock edges of the first clock signal and the reference clock signal. The detection arrangement further includes a signal processing unit to determine a phase deviation word as a function of the first data word and a second data word, the second data word based on the duration of a clock period of the reference clock signal.
US07804924B2
A timing recovery for recovering a symbol clock using received data is provided. The timing recovery estimates a timing offset in such a way that dispersion constants of received symbols are minimized. Since the dispersion constants do not totally depend on a specific portion of a received signal spectrum, deterioration of the timing recovery performance by fading of a specific frequency component can be prevented. Particularly, the timing offset can be stably captured in a frequency selective fading channel such as a multi-path channel.
US07804906B2
A multicarrier transceiver is disclosed that includes a digital signal processor with a plurality of memory locations, a direct memory, an encoder module coupled to receive data from the FIFO buffers, a decoder module coupled to receive data from the FIFO buffers, a Fourier transform module configured to perform an inverse Fast Fourier transform for transmit operations and to perform Fast Fourier transform (FFT) operations for receive operations, a plurality of distributed modules including the encoder module, the decoder module and the Fourier transform module, each module configured with a memory port, each memory port coupled to a peripheral bus and the DMA bus, a plurality of memory ports coupled to each of the distributed modules, the plurality of memory ports coupled to a peripheral bus, and a plurality of point-to-point buses coupled to each of the distributed modules, the point-to-point bus configured to enable data flow and testing and provide a bypass capability for each of the distributed modules.
US07804895B2
In a device and a method for detecting a letter box for an MPEG decoder, the method includes performing processing area filtering for selecting a processing area of an image used to detect the letter box; performing intra-macroblock filtering for determining the letter box area based on a change level of pixels in macroblocks in one line of the image from the processing area; performing impulse data filtering for excluding the line being detected a high frequency component from the determined letter box area; performing inter-macroblock filtering for determining the letter box area based on a change level of lines between macroblocks of the image; performing inter-line filtering for determining a boundary of the letter box based on an average of the pixel values of the lines; and performing inter-picture filtering for outputting a boundary value of the letter box that has the highest frequency number as the boundary of the letter box in successive images.
US07804890B2
A discussion of improving integrated device deterministic response to test vectors. For example, limiting the transmission delay for an integrated device's response within known bounds by synchronizing an initialization training sequence to a reset deassertion. Specifically, the proposal facilitates response determinism from the DUT by synchronizing training sequences and subsequently synchronizing flit transmission to reset assertion as sampled by reference clock.
US07804889B2
Disclosed are a channel estimation method and a channel estimation apparatus, and a receiver using the same. The channel estimation apparatus provided in the receiver detects pilot signals from radio signals and estimates channels of the detected pilot signals. The channel estimation apparatus estimates channels corresponding to data by conducting linear interpolation, which allows for simultaneous interpolation in time and frequency axes, by use of information on the estimated pilot channels. Thus, the memory capacity required for the receiver can be reduced using channel estimation in which the simultaneous interpolation is conducted. Also, the performance of the receiver can be further improved in a wireless environment where the receiver moves at high speed.
US07804883B2
A transmitter shown in FIG. 3 inputs to a mixer 36 an IF band modulation signal generated from transmission data and a frequency hopping signal obtained by a hopping synthesizer 38 controlled by a hopping pattern generator 37, thereby obtaining a frequency hopping radio signal to be transmitted. In a receiver shown in FIG. 4, a received signal is amplified and an unnecessary wave is removed from the signal, and the resultant signal is input to a mixer 44. The mixer 44 receives an output signal of a hopping synthesizer 47 controlled by a signal obtained by adding a fixed frequency offset signal to the hopping pattern generator 45. A signal downconverted to a first IF band without frequency hopping corresponding to the offset signal with a radio frequency band signal maintaining the relative spectrum relationship appears in the output of the mixer 44. An unnecessary wave of the signal is removed, a square unit 49 performs square detection, and a modulation signal in the intermediate frequency band used by the source is regenerated. The obtained IF band signal is modulated, thereby receiving desired data.
US07804882B2
A nitride semiconductor laser element, comprises a substrate and a nitride semiconductor layer in which a first semiconductor layer, an active layer, and a second semiconductor layer are laminated in this order on the substrate, wherein recessed and raised portions are formed in the first semiconductor layer and/or the second semiconductor layer, a semiconductor layer that embeds the recessed and raised portions are formed on the semiconductor layer in which said recessed and raised portions are formed, the semiconductor layer in which the recessed and raised portions are formed is equipped with a side face having a first region extending downward and a second region extending farther downward continuously from the first region, and the second region has a greater slope with respect to the normal direction of the substrate than the first region.
US07804875B2
Provided are a vertical cavity surface emitting laser (VCSEL) module providing accurate alignment between a VCSEL and a monitoring photodiode (MPD) for efficiently detecting light emitted by the VCSEL and a method of fabricating the VCSEL module. The VCSEL module includes: a first mirror layer, a first semiconductor conducting layer, an active layer, a tunnel junction layer, and a second semiconductor conducting layer sequentially formed on a first region in a substrate having first and second regions; a MPD disposed on a portion of the second semiconductor conducting layer in the first region; and a VCSEL including layers having the same shapes as the first mirror layer, the first semiconductor conducting layer, the active layer, the tunnel junction layer and the second semiconductor conducting layer in the first region, and a second mirror layer formed on a portion of the second semiconductor conducting layer, and sequentially formed on the second region in the substrate. The predetermined distance is set so that light emitted by the VCSEL can be detected by the MPD.
US07804873B2
Electrically pumped surface emitting organic laser device having a multi-layer of organic materials disposed between a highly reflective microcavity mirror and a highly reflective mirror to thereby form a coupled microcavity. More specifically, the organic laser device includes a substrate; a bottom mirror over the substrate; a layer of spacer over the bottom mirror; a coupling mirror over the spacer layer; an anode over the coupling mirror; an active layer over the anode; a cathode over the active layer; and a top mirror over the cathode. The combination of the electrode and the mirror leads to low optical absorption and highly reflective electrical contacts at organic-electrode interfaces. Electroluminescent emission efficiency is improved due to the realization of efficient electron-injection and hole-injection. A low loss organic laser device with a coupled microcavity structure is realized that can produce surface emitting laser output under electrical pumping.
US07804860B2
A digital broadcast transmitting/receiving system and a method for processing data are disclosed. The method for processing data may enhance the receiving performance of the receiving system by performing additional coding and multiplexing processes on the traffic information data and transmitting the processed data. Thus, robustness is provided to the traffic information data, thereby enabling the data to respond strongly against the channel environment which is always under constant and vast change.
US07804855B2
A system for encoding data in a multilane communication channel may include at least one processor operable to generate, from existing control characters in a character set, expanded control characters utilized for controlling the data in each lane of the multilane communication channel. Each lane of the multilane communication channel may transport the data in a similar direction. The at least one processor is also operable to control at least one of the lanes of the multilane communication channel using at least one of the generated control characters. If a first control character of the existing control characters is a start-of-packet control character, the at least one processor is then operable to select a second control character from any other of the generated expanded control characters, and to indicate a start of a packet using the selected second control character for at least one of the lanes.
US07804848B2
In one embodiment, a method includes receiving a neighbor discovery message and a border routing message through an interface at a particular router. The interface communicates with a border network segment between first nodes routing with IPv6 using a first routing protocol and different second nodes routing using a different routing protocol. The messages are received from an alien router. The border routing message includes foreign routing data that indicates a route among the second nodes. If the alien router's interface on the border segment does not have a global IPv6 address, then a fictive IPv6 address is generated, which includes a global prefix of an IPv6 address for the particular router and an interface identifier associated with the alien router. The fictive IPv6 address and the foreign routing data are inserted into a domain scope external advertisement message that is sent to the first nodes.
US07804847B2
An interface and related methods for rate pacing in an Ethernet architecture are described herein. In an embodiment, an effective data rate of communication channel with a remote network device is reduced based, at least in part, on an identified processing capability of the remote network device. In one embodiment, to reduce the effective data rate, one or more idle control elements are inserted between at least two frames of substantive content based, at least in part, on the processing capability of the remote network device. Other embodiments are also disclosed.
US07804844B1
A processor is specified for implementing actions for manipulating the fields of the packets of a communication protocol. A cluster specification is input specifying clusters of independent actions. A constraint specification is input of dependencies constraining performance of the actions, including a dependency between a first action from a first cluster and a second action from a second cluster. Each cluster is assigned to a stage of a dataflow pipeline of the processor, and the dependencies are satisfied by performing each stage in an order of the dataflow pipeline. The first action is transferred between the stages of the first and second clusters. A timeframe is scheduled for performing each action in each stage of the dataflow pipeline. The timeframe is scheduled for performing of the first and second actions in the stage of the second cluster in accordance with the dependencies. A specification of the dataflow pipeline is output.
US07804837B2
In a telecommunications system, in which a connection comprises a part with an interworking function at both ends, a channel is allocated to the connection between the interworking functions. The required channel capabilities may vary during the connection, whereby the channel capabilities should be changed. When the first interworking function detects that a channel capability must be changed, a first message, which indicates the desired capability change, is transmitted (2-1) to the second interworking function; and the channel capability is changed (2-3,2-5) into the desired one at both ends of the part.
US07804833B2
A method and apparatus for in-line processing a data packet while routing the packet through a router in a system transmitting data packets between a source and a destination over a network including the router. The method includes receiving the data packet and pre-processing layer header data for the data packet as the data packet is received and prior to transferring any portion of the data packet to packet memory. The data packet is thereafter stored in the packet memory. A routing through the router is determined including a next hop index describing the next connection in the network. The data packet is retrieved from the packet memory and a new layer header for the data packet is constructed from the next hop index while the data packet is being retrieved from memory. The new layer header is coupled to the data packet prior to transfer from the router.
US07804831B2
A method is provided for enabling rapid media stream channel changes in conjunction with increasing network resource utilization efficiency. A media stream is multicast for reception by a plurality of requesting decoders. The media stream includes packets containing groups of pictures (GOPs), which are stored in a buffer of an access node. At least a portion of the packets are unicast from the access node for reception by a new requesting decoder in response to receiving from the new requesting decoder a request for reception designating a media stream identifier corresponding to the media stream. Thereafter, the media stream is multicast to the new decoder after bringing packet transmission of the unicast media stream into alignment with packet transmission of the multicast media stream.
US07804830B2
Method and apparatus for establishing direct IP bi-directional or unidirectional connectivity between communication devices (6,24), accommodating the circumstance of either or both communication devices residing behind a Network Address Translator (NAT). When a communication device requests IP connectivity to another communication device, either the local or remote communication device's associated service node (26,28) or their agents (41,42) (or another node 29, using information collected by the devices' associated service nodes), formulates an appropriate direct IP pathway (40) to traverse any pertinent NATs and instructs the applicable communication devices (30,32,34,44,45,46,47) to self-configure to establish the pathway (40).
US07804815B1
A system for IP telephony that utilizes distributed gateways instead of centralized gateways for communication between IP Telephones on a Packet Based Digital Network (PBDN) and Telephones on a Public Switched Telephone Network (PSTN). The system is based on the use of IP Telephone apparatuses (“Gateway Telephones”) wherein each is connected both to the PBDN and a PSTN and includes a built-in gateway between the two network connections. The gateway capacity of the system thus increases automatically with the number of Gateway Telephones. Gateway Location Servers facilitate the selection of a Gateway Telephone to serve as a gateway for a specific telephone call.
US07804805B2
A method and apparatus for scheduling the data packets transmitted to a plurality of mobile terminals supporting multiple quality of service (QoS) grades in a multichannel wireless communication system includes a storage device for storing queues and data packets of the mobile stations, the queue and data packets of each of the mobile stations being arranged in an order of the quality of service grades; and a scheduler for allocating resources of multiple channels to the mobile stations based on different scheduling metrics separately applied to the multiple channels according to the quality of service grades, each of the scheduling metrics applied to a particular one of channels being used to select one of the mobile stations whose data packets are transmitted through the particular channel; wherein entire data packets of the mobile stations are transmitted through the multiple channels when the allocation of the channel resources has been completed sequentially for each of the multiple channels.
US07804804B2
In network groups adjacent to each other constructed by communication apparatuses notifying beacons, the communication apparatuses can exchange necessary data between themselves, avoiding interference. Communication stations in a group set one beacon period to operate the network group. A communication station in the group acquires a beacon period and a reservation period of an adjacent group, sets its own reservation period avoiding the acquired beacon period and reservation period, and as necessary, enters the adjacent group to exchange necessary data. A device shared by a plurality of users does not belong to any group, and a communication apparatus in a different group temporarily enters the beacon period as necessary to exchange data.
US07804801B2
Provided are a QR decomposition apparatus and method for a MIMO system. The QR decomposition apparatus includes: a norm calculator for calculating a vector size norm for a channel input; a Q column calculator for calculating a column value of a unitary matrix Q by multiplying a delayed channel input with √{square root over (norm)}; an R row calculator for receiving the delayed channel input, the output of the Q column calculator, and 1/√{square root over (norm)}, and calculating a row value of an upper triangular matrix R; a Q update calculator for receiving the delayed channel input, the output of the R row calculator, and a delayed output of the Q column calculator, and calculating a Q update matrix value; and a norm update calculator for receiving a delayed output of the norm calculator and an output of the R row calculator, and outputting a norm update matrix value.
US07804796B2
A method and system for communicating satellite digital radio program information for multiple satellite channels is provided. The method includes the steps of providing multiple satellite signals, and providing multiple data frames in each of the satellite signals. The method also includes the steps of providing frame synchronization symbols in each of the data frames, such that the frame synchronization symbols occurring in the satellite signals do not overlap in time with each other. The method also includes the steps of providing multiple data slots within each of the data frames, and providing satellite program information in at least one of the data slots in each data frame. The multiple data slots are positioned within each data frame relative to the frame synchronization symbol of that data frame, such that the data slots containing satellite program information in the multiple satellite signals do not overlap in time with each other.
US07804778B1
A method and apparatus for monitoring link diversity between two communication networks are disclosed. Physical diversity of communication links are important to guarantee service availability and reliability. Diversity monitoring can be achieved by using routing information of the communication links.
US07804777B2
In one embodiment, a device includes: a transceiver operable to transmit packets to and receive packets from a modem; and a logic engine configured to transmit first packets at a rate through an upstream path for a modem to an Internet node such that no throttling is triggered in the modem, the logic engine being further configured to transmit second packets through the upstream path for the modem to the Internet node at a rate sufficient to trigger throttling in the modem if the modem implements throttling, the logic engine being further configured to compare an average transmission time for first packets to an average transmission time for the second packets to determine whether the modem implements throttling.
US07804771B2
Protection switching of a virtual private network is provided whereby working VPN paths and protection VPN paths are defined. The working VPN path is monitored for increased data traffic and failures, and in response, data is switched from the working VPN path to the protection VPN path. The working VPN path is monitored for a return to proper functioning and normal data conditions, and data is then switched back from the protection VPN path to the working VPN path. Additionally, data capacity is managed through virtual bandwidth classes, and different classes of qualities of service are provided.
US07804770B2
A graceful restart is provided in a NSF capable router. When a switchover to a standby controller is required, the standby controller receives replicated link state message headers from an active controller. The standby controller generates a link state request (LSR) message from the link state message headers and transmits the LSRs to neighboring routers. The standby controller receives a link state update that includes the link state messages. By using the LSRs, the standby controller can be quickly synchronized with its neighbors well within the grace period, thereby maintaining adjacency.
US07804750B2
In a test disc, data (test data) is recorded in such a manner as to fill an entirety of a data region and, next to this test data, border-out data is recorded which contains information indicating that recording is prohibited. By determining whether the data can be played back appropriately from a position in the vicinity of an outer periphery of the disc where playback characteristics are apt to be unstable, whether the data can be played back appropriately from all of the regions is verified. Also, by determining whether it is possible to recognize that test disc is capable of recording, it is verified whether the border-out data can be smoothly acquired from the position in the vicinity of the outer periphery of the disc where playback characteristics are apt to be unstable.
US07804741B1
The present disclosure relates to a method and system for finding and physically altering underground targets. Multiple nodes are dispersed into the ground and determine their spatial orientation using seismic waves, and then operate as an array to locate and properly time kinetic pulses to focus seismic waves on the target.
US07804735B2
Apparatuses and methods for dual channel memory architecture with reduced interface pin requirements are presented. One memory architecture includes a memory controller, a first memory device coupled to the memory controller by a shared address bus and a first clock signal, and a second memory device coupled to the memory controller by the shared address bus and a second clock signal, where the polarity of the second clock signal is opposite of the first clock signal. A method for performing data transactions is presented. The method includes providing addressing signals over a shared address bus to a first memory device and a second memory device, providing clock signals to the memory devices which are reversed in polarity, where the clock signals are derived from a common clock signal, and transferring data to the memory devices over separate narrow data buses in an alternating manner based upon the clock signals.
US07804732B2
The present invention relates to a memory circuit and a method of controlling data retention in the memory circuit, wherein a supply signal is selectively switched to a respective one of at least two virtual supply lines (24) each shared by a respective one of a plurality of groups (30-1 to 30-n) of memory cells (C0,0 to Cy,z). The selective switching is controlled based on a global activity control signal (A), used for setting the memory circuit either into a standby state or into an active state, and a local data retention indication signal (DR1 to DRn) allocated to a dedicated group of memory cells. Thereby, the data retention part of the memory circuit can be adapted to the application and its state, and standby mode leakaged power is only dissipated in those memory cells for which data retentions actually required.
US07804731B2
This disclosure concerns a semiconductor memory device comprising memory cells including floating bodies and storing therein logic data; bit lines and word lines connected to the memory cells; sense amplifiers connected to the bit lines; a refresh controller instructing a refresh operation for restoring deteriorated storage states of the memory cells; and a refresh interval timer setting a refresh interval between one refresh operation and a next refresh operation to a first interval in a data read mode or a data write mode, and setting the refresh interval to a second interval longer than the first interval in a data retention mode, the data read mode being a mode in which the data stored in the selected memory cell is read to an outside of the device, the data write mode being a mode in which data from the outside is written to the selected memory cell.
US07804730B2
The invention relates to accessing contents of memory cells. Some embodiments include a memory structure that has a first cell, a second cell, and a sense amplifier. The first cell stores a first value. The first and second cells are connected to the sense amplifier by one or more bit lines. The sense amplifier receives the first value stored by the first cell by using the one or more bit lines and drives the received first value to the second cell through the one or more bit lines. The receiving and driving occur in a single clock cycle. In some embodiments, the second cell outputs the first value. The memory structure of some embodiments also includes a third cell connected to the sense amplifier by the one or more bit lines. The sense amplifier drives a second value to the third cell while the second cell outputs the first value. Other embodiments include a method for accessing data in a memory structure. The method receives a value stored by a first cell; and drives the received value to a second cell. The receiving and driving occur in a single time period. In some embodiments, the method also includes driving a first value to the second cell in a first time period and driving a second value to a third cell in a second time period. In these embodiments, the second cell outputs the first value during the second time period and the third cell outputs the second value during a third time period.
US07804695B2
The present invention relates to an interconnection system of a first substrate (1) comprising at least one first transmission line (3) with a second substrate (10) comprising at least one second transmission line (11), the orientation of the first substrate with respect to the second substrate being arbitrary. The first substrate (1) comprises at least one metallized hole at one extremity of said first line and the second substrate (10) comprises a projecting element extending said second line and a ground saving, said projecting element being inserted into the metallized hole. The invention notably applies in the domain of microwaves and can interconnect a substrate comprising a printed antenna with a substrate receiving the processing circuits of the signal.
US07804686B2
A thermal control system of a 3U height includes various modules for providing temperature control in a rack environment. The modules may be, for example, a power module, user interface module, various different pump assemblies, various different models of fan assemblies, HTAs, and/or a serial communication interfaces.
US07804683B2
Disclosed herein is a portable electronic device component eject mechanism. The portable electronic device component eject mechanism includes a first member and a second member. The first member is configured to contact a first portable electronic device component. The second member is movably connected to the first member. The second member is configured to release a second portable electronic device component when the second member is moved in a first direction. The first member is configured to eject the first component when the second member is moved in a second direction. The first component and the second component comprise a removable electronic module and a battery.
US07804677B2
An electronic component is provided which includes external electrodes having a multilayer structure of first and second sintered electrode layers that are densely sintered and have less possibility of causing poor appearance and decreased reliability in electrical connection. The external electrodes include a first sintered electrode layer and a second sintered electrode layer containing different metals. The first and second sintered electrode layers contain a borosilicate glass containing an alkali metal.
US07804667B2
An MR element incorporates a nonmagnetic conductive layer, and a pinned layer and a free layer that are disposed to sandwich the nonmagnetic conductive layer. Each of the pinned layer and the free layer includes a Heusler alloy layer. The Heusler alloy layer contains a Heusler alloy in which atoms of a magnetic metallic element are placed at body-centered positions of unit cells, and an additive element that is a nonmagnetic metallic element that does not constitute the Heusler alloy. At least one of the pinned layer and the free layer includes a region in which the concentration of the additive element increases as the distance from the nonmagnetic conductive layer decreases, the region being adjacent to the nonmagnetic conductive layer.
US07804663B2
A micro-electromechanical signal transmission line is made from an electrically conductive material. It has a first distal end and a second distal end. The second distal end is free to move with respect to said first distal end. There exists an unsupported region between the first distal end and the second distal end. The unsupported region is juxtaposed at a controlled distance from at least one grounded conductive surface.
US07804656B2
An apparatus includes a load beam, a slider coupled to the load beam by a gimbal assembly and including an optical transducer, an optical fiber for transmitting light directly toward the transducer, and a mounting structure for adjusting the position of an end of the optical fiber. Data storage devices that include the apparatus are also included.
US07804655B2
A thermally assisted magnetic head has a slider having a medium-facing surface, and a light source unit having a light source support substrate, and a light source disposed on the light source support substrate. The slider has a slider substrate and a magnetic head portion disposed on a side of the medium-facing surface in the slider substrate; the magnetic head portion includes a magnetic recording element for generating a magnetic field, and a waveguide for receiving light through an end face opposite to the medium-facing surface, and guiding the light to the medium-facing surface; the light source support substrate is fixed to a surface opposite to the medium-facing surface in the slider substrate so that light emitted from the light source can enter the end face of the waveguide.
US07804649B2
A microreplicated achromatic lens is disclosed. The article includes a web including first and second opposed surfaces. The first surface includes a first microreplicated structure having a plurality of first features. The second surface includes a second microreplicated structure having a plurality of second features. Opposing first and second features are registered to within 10 micrometers. Corresponding opposed first and second features cooperate to form an achromatic microlens element.
US07804644B2
The optical level control device independently controls the intensities of two beams having different wavelengths that are emitted from a laser oscillator, and the optical level control device includes a wavelength-dependent wavelength plate and a polarization beam splitter. The wavelength-dependent wavelength plate functions as a half-wave plate with respect to the first light wave and as a full-wave plate with respect to the second light wave. Only the rotation angle of the polarization beam splitter about the optical axis is adjusted to set the intensity of the second light wave transmitted rectilinearly through the polarization beam splitter. The polarization beam splitter is then fixed at the adjusted angle, and the rotation angle of the wavelength plate about the optical axis is adjusted to set the intensity of the first light wave.
US07804610B2
An embodiment may comprise an image forming apparatus comprising: a receiving section which receives a print data; storage which stores the received print data; a print data judging section which judges whether the received print data is a structured document data or not; a controlling section which operates the receiving part preferentially when it is judged that the print data is a structured document data, compared to a case that the print data is a non-structured document data; an image converting section which converts the stored print data to image data; and a printing section which prints the image data to a predetermined recording medium.
US07804606B2
A method for measuring a distance D2 between two points includes following steps. A first surface of a portable electronic device is parallel to a line defined by the two points. A distance D2 between the first surface and the line is obtained. A visible light beam B1 is rotated from an initial direction substantially perpendicular with the first surface and the line to direct at the point E1. A first angle defined by the visible light beam B1 striking the point E1 and the initial direction is computed. A visible light beam B2 is rotated from an initial direction to strike the point E2. A second angle defined by the visible light beam B2 striking the point E2 and the initial direction is computed. A distance D1 is computed based on the distance D2, the first angle and the second angle. The distance D1 is outputted.
US07804600B1
A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.
US07804597B2
A method for matching colour properties and texture properties of a repair paint to colour properties and texture properties of a paint film on a substrate to be repaired is provided. In the method, the texture of the paint film is imaged with a digital imaging device, the imaged texture is analyzed using image analysis software, texture data is calculated, and the repair paint is formulated on the basis of the concentrations of paint modules, wherein each paint module is associated to specified texture data and colour data.
US07804596B2
In an overlay key used for measuring overlay accuracy between first and second layers on a substrate, a first mark may be formed in the first layer, and a second mark may be formed on the second layer. The first mark may include first patterns having a first pitch and extending in a first direction. The second mark may include second patterns extending in substantially the same direction as the first direction and having a second pitch substantially equal to the first pitch. First and second images may be acquired from the first and second marks. The overlay accuracy may be produced from position information of first and second interference fringes formed by overlaying a test image having a third pitch onto the first and second images.
US07804587B2
A system and method for distinguishing a first light source from other light sources utilizes an image receiver that can selectively engage and disengage a filter. The filter can be configured to either block bands of light corresponding to the light being emitted by either the first source or the other sources. By sequentially engaging and disengaging the filter from the image receiver, the first light source may be distinguished from other light sources.
US07804581B2
An exposure apparatus for exposing a substrate to light during an exposure period. A projection optical system projects light from a pattern of a reticle onto the substrate. The projection optical system includes at least one optical element driven to adjust aberration of the projection optical system. A first calculator calculates compensation data based on a temporal characteristic of heat influence, which represents a change in aberration due to heat influence of the exposure in the projection optical system in accordance with (i) an elapsed time of a non-exposure period from a time when the exposure period shifts to a non-exposure period, and (ii) exposure period data which represents the time when the exposure period shifts to the non-exposure period. A second calculator calculates each of a plurality of driving amounts of the at least one optical element, based on the compensation data calculated by the first calculator, and each of a plurality of timing signals generated at a gradually decreasing interval upon a shift from the exposure period to the non-exposure period, on the basis of the exposure period data. A driver drives the at least one optical element during the non-exposure period based on each of the plurality of driving amounts calculated by the second calculator.
US07804578B2
An exposure apparatus that exposes a substrate to a pattern of an original. An illumination optical system illuminates the original. A projection optical system projects the pattern that is illuminated by the illumination optical system onto the substrate. A vacuum chamber houses at least one of the illumination optical system and the projection optical system. A heat absorber, arranged in the vacuum chamber, absorbs heat in the vacuum chamber. A heat conductor includes a metal member and connects the heat absorber and a wall of the vacuum chamber. The metal member is softer than the heat absorber and the wall, and fills a space between the heat absorber and the wall, and a cooler, arranged outside the vacuum chamber, cools the wall.
US07804572B2
A method for fabricating a liquid crystal display (LCD) device includes providing a first substrate including a pixel portion and a circuit portion, the circuit portion having first and second regions; forming an active pattern and a first gate insulation film at the pixel portion and the circuit portion and forming a storage electrode on a portion of the active pattern of the pixel portion; forming a second gate insulation film on the first substrate; forming a gate electrode at the first region and forming p+ source and drain regions at portions of the active pattern of the first region; forming a gate electrode at the pixel portion and the second region, and forming a common line at the pixel portion; forming n+ source and drain regions at the pixel portion and at a portion of the active pattern of the second region; and joining the first and second substrates.
US07804570B2
A liquid crystal display device includes an array substrate and an opposing substrate that are disposed face to face at a prescribed interval. The array substrate includes a scan line, signal lines, switching devices disposed at intersections between the scan line and the signal lines, pixel electrodes disposed in a matrix manner and driven by the switching devices and auxiliary capacitance lines for retaining applied voltage for the pixel electrodes. The pixel electrodes have side edges superposed on the signal lines or black matrices formed on the opposing substrate to achieve shielding of light, and the side edges have parts superposed on shield electrodes disposed on the auxiliary capacitance lines to make an amount of superposition between the pixel electrodes and the signal lines or the black matrices in a region corresponding to positions where the shield electrodes are disposed smaller than that in other regions.
US07804558B2
Manufacture of a liquid crystal display is disclosed. The liquid crystal display includes a backlight unit, a backlight unit-side polarizing plate, and a liquid crystal cell held by two glass plates, the liquid crystal cell having an electrode, a liquid crystal layer, an alignment layer, and a color filter arranged between the glass plates. The liquid crystal display also includes a transparent front plate arranged at a side of the liquid crystal cell opposite to the backlight unit, a polarizing plate attached to the liquid crystal cell, and a transparent organic medium layer arranged between the front plate and the liquid crystal cell. Since the front plate is provided at the outermost surface of an image display portion, and the transparent organic medium is filled between the front plate and the liquid crystal module, it is possible to achieve an improvement in wear resistance and a reduction in reflectance.
US07804553B2
A liquid crystal display including a LC panel including a first display panel having first to n-th gate lines (n>2) and data lines crossing the gate lines and forming a pixel, and a second display panel which faces the first display panel, the aperture ratio of a first pixel line electrically connected to the first gate line is smaller than that of a second to a n-th pixel line electrically connected to the second to the n-th gate line, respectively, and a gate driver having first and the second pull-down transistors which decrease the voltage of each gate line to a low level, the first and second pull-down transistors are connected to start and end terminals of the each gate line, a width-to-length ratio of a channel of the second pull-down transistor is 0.8 to 3 times as large as that of a channel of the first pull-down transistor.
US07804546B2
An antenna system including an antenna capable of responding to a horizontally-polarized-wave and a vertically-polarized-wave and receives digital television broadcasting signals. The system further includes: a memory section to store an outdoor reception program and an indoor reception program; an acquisition section to configure in the antenna a horizontally-polarized-wave reception mode or a vertically-polarized-wave reception mode, and to acquire reception information of the television broadcasting signals; a determination section to determine whether the antenna is installed outdoors or indoors; a configuration section to control the outdoor reception program stored in the memory section when the determination section determines that the antenna is installed outdoors, and the indoor reception program stored in the memory section when the determination section determines that the antenna is installed indoors; and a control section to control the reception of the television broadcasting signals by the antenna system through the program configured.
US07804543B2
A method for receiving OSD data over from a computer for display on a monitor over a transmission link that includes, launching an OSD application on the computer; receiving an OSD control command at the computer; encoding the OSD control command by the OSD application; converting the encoded OSD control command into an OSD data packet; converting the OSD data packet into at least two OSD pixel patterns, sending the two OSD pixel patterns over the transmission link to the monitor, and displaying the OSD.
US07804542B2
A method including, in some embodiments, comparing a preceding field and a succeeding field of a video signal for motion at a locus of a current pixel in a current field to be interpolated, in an instance of no motion determining which of a current pixel location in the preceding field and the succeeding field is closer to an estimate of a neighbor pixel and using the result of the determination to decide which of the preceding and succeeding fields to use to interpolate the current pixel based on symmetric spatial neighbors of the current pixel, and in an instance of motion interpolating the current pixel based on symmetric spatial neighbors of the current pixel at a line above and a line below the current pixel in the current frame.
US07804533B2
An image sensing apparatus includes an image sensing device having a plurality of pixels, a smoothing unit that smoothes a dark image signal acquired with the image sensing device shielded from light; a subtraction unit that subtracts a second dark image signal from the dark image signal; an extraction unit that extracts, as a defective pixel of the image sensing device, a pixel of which an obtained difference is outside a preset range; and a correction unit that corrects, out of subject image signals output from the image sensing device, an image signal of the defective pixel extracted by the extracting unit, using an image signal of a pixel peripheral to the defective pixel.
US07804532B2
A noise reducing device captures image data obtained by capturing a field with an image capturing part and a plurality of blackout image data obtained by capturing the field with the image capturing part under a light shielded state. This device reduces non-correlative random noise in the plural blackout image data. With random noise reduced, fixed pattern noise appears more accurately in resultant as blackout image data B. This device reduces the fixed pattern noise in the image data by using this blackout image data B.
US07804526B2
An auto white balance (AWB) method and an image photographing apparatus using the same. The AWB method includes selecting parts of a plurality of windows that form an image, and performing an AWB of the image, based on color difference signals of the selected windows, thereby reducing a time to transmit AWB data to calculate color difference integration, i.e., AWB data to be used to perform the AWB, to reduce the extent of calculation to calculate the color difference integration, and efficiently to perform the AWB of the image.
US07804520B2
A printer having a digital camera connected thereto checks whether or not a transfer button of the camera is pressed, and checks the communication mode of the camera in the case where it is pressed. In the case where the communication mode of the camera is a mass storage mode, a conversion command for ordering change to a PTP mode is sent to the camera from the printer. The camera performs a bus reset so as to redo configuration and convert the protocol to the PTP mode. In the case where the communication mode of the camera is the PTP mode or is automatically changed to the PTP mode, the image is transferred to the printer in conjunction with operation of the transfer button. Thus, a desired image is transferred to a host such as the printer according to a transfer instruction of an image by the transfer button, etc. on a device side while a user is not conscious of the state of a communication mode and mode switching of the device such as the digital camera.
US07804517B2
A three-dimensional image-capturing apparatus includes an image-capturing device having a plurality of image-capturing regions and a plurality of optical systems for forming images of a subject in the image-capturing regions. The optical systems includes a plurality of reflectors for reflecting rays from the subject a number of times and at least a lens provided to be closer to the image-capturing device than the reflection means closest to the subject. The reflectors and the lens are used to form, in the image-capturing regions, separate images of the subject which are captured from different viewpoints.
US07804516B2
A network camera, a program and a network system, which can perform voice communications by comfortable operations. The network camera can transmit an image to at least one terminal capable of performing a voice communication in a half duplex manner, and can perform a voice communication with the terminal. The network camera creates and transmits page information to the terminal. This page information displays: a button indicating the possibility of outputting the voice when it receives a demand from the terminal, in case the voice output is not inhibited and in case another terminal is not outputting the voice; a button indicating the voice outputting, in case the voice output is done; and a button indicating a temporary voice output inhibit while another terminal is transmitting the voice, so that the page information can be altered, when depressed, to another button display in accordance with the change in the communication state.
US07804513B2
An optical writing unit includes a light-emitting-element array in which a plurality of light emitting elements is arranged and an optical system that guides light flux emitted from the light emitting elements as a light spot. A result of comparison of a property value of the light emitting elements at a predetermined threshold in an exposure intensity distribution of the light emitting elements is within a preset range over an entire effective image area. An emission condition of the light emitting elements is set such that a fluctuation of amounts of exposure of the light emitting elements or a result of comparison of the amounts of exposure does not exceed a preset range over the entire effective image area.
US07804507B2
A display apparatus for a mixed reality environment includes an image processor for mixing an actual image of an object around a user and a artificial stereo images to produce multiple external image signals, a user information extractor for extracting the user's sight line information including the user's position his/her eye position, direction of a sight line and focal distance; an image creator for creating a stereo image signal based on the extracted user's sight line information; an image mixer for synchronously mixing the multiple external image signals and the stereo image signal; and an image output unit for outputting the mixed image signal to the user.
US07804505B2
A cache control unit of a video data playback control apparatus sets priority video data in order to efficiently use a storage area of a cache memory. The priority video data includes video data which includes a greater number of portions of video data than that of data displayed in a display unit, which includes a smaller number of portions of video data than a maximum number that can be held in the cache memory, and which has a high possibility of being output from the cache memory to the display unit. Also, the cache control unit preferentially reads the priority video data from a recording medium and stores it in the cache memory.
US07804499B1
The current invention involves new systems and methods for providing variable rasterization performance suited to the size and shape of the primitives being rendered. Portions of pixel tiles that are fully covered by a graphics primitive are encoded and processed by the system as rectangles, rather than expanding to explicit samples. This accelerates the rendering of large primitives without increasing the computation resources used for rasterization. In some embodiments, these fully-covered regions can be rendered compressed without ever expanding into samples.
US07804497B2
A display driving circuit includes a first interface unit, a signal discriminating circuit, a signal distributing circuit, a driver logic circuit and a synchronization processing unit. The first interface unit receives a first signal through a first interface from a host. The signal discriminating circuit discriminates whether the first signal corresponds to a first video signal or a second video signal. The signal distributing circuit divides the first signal into the first and second video signals based on a discrimination result of the signal discriminating circuit. The driver logic circuit drives a first display panel based on the first video signal. The second interface unit converts the second video signal into a second signal and provides the second signal through a second interface to an external display device. The synchronization processing unit receives a synchronization signal from the external display device and provides the synchronization signal to the host.
US07804487B1
Improved housing for a computing device is disclosed. The improved housing is provided with one of an illuminable connector, a touch pad arrangement, and a palm rest stiffening plate. Normally, the illuminable connector and the touch pad arrangement are provided on external portions of a housing of the computing device such that they are available for user interaction. The palm rest stiffening plate is provided internal to a housing to provide stiffness or rigidity to a palm rest region of the housing.
US07804479B2
A display device with a touch screen having display pixels and optical sensors each arranged in a matrix. In the display device, a backlight controller controls a backlight unit to be turned ON in a data display duration and controls the backlight unit to be turned OFF in a sensor detection duration other than the data display duration. Consequently, the influence of backlight on a touch part when the shade of the touch part is to be detected, can be reduced and an accuracy in the detection of an optical sensor can be increased.
US07804467B2
In an active matrix EL display device, pixels which are suitable for a constant current drive are structured. The pixel includes a first switch which has one end connected to a source signal line and the other end connected to a current-voltage conversion element, a second switch which has one end connected to the current-voltage conversion element and the other end connected to a voltage holding capacitor and to a voltage-current conversion element, and a pixel electrode connected to the current-voltage conversion element and to the voltage-current conversion element.
US07804464B2
A phasing structure includes a support matrix for a reflective surface which reflects microwaves within an operation frequency band. The reflective surface includes a plurality of adjustable sub-panels. In one embodiment, the phasing structure may include a phasing arrangement of electromagnetically-loading structures supported by the support matrix. The sub-panels may be secured to the support matrix and individually adjustable using a securing means which, in one embodiment, includes one or more differential bolts.
US07804461B2
After a receiving antenna (A1) is inserted from a slot (B16) into a housing portion (B14) formed between cover members (B11, B12), the slot (B16) is pasted so as to secure the receiving antenna (A1). The receiving antenna (A1) is thus housed. Further, a tab (B17) which extends from one side of a pasted edge portion, holes (B20, B21) that penetrate opposing surfaces of the cover members (B11, B12), and perforated lines (B22, B23) running from the slot (B16) to the holes (B20, B21), respectively, are provided. Therefore, the receiving antenna (A1) can be easily attached to the antenna cover (B1) and to an outer surface of a subject (1), and the receiving antenna (A1) can be easily removed from the antenna cover (B1) and from the outer surface of the subject (1).
US07804459B2
Disclosed is a transmission line loaded dual-band monopole antenna, which realizes operation in dual bands with a single antenna. The dual-band monopole antenna includes a monopole antenna and a transmission line load. The monopole antenna has a signal feeding terminal and a load connection terminal. The load connection terminal is connected to the transmission line load. The transmission line load includes a core transmission line, an outer circumferential conductor, and a short-circuit section. The core transmission line has an antenna connection terminal and a short-circuit terminal. The antenna connection terminal is connected to the load connection terminal of the monopole antenna. The outer circumferential conductor circumferentially surrounds and is spaced from the core transmission line and the outer circumferential conductor has an open terminal and a short-circuit terminal. The opening of the open terminal of the outer circumferential conductor faces the antenna connection terminal of the core transmission line so that the outer circumferential conductor forms an open structure facing the monopole antenna.
US07804458B2
A communications device for sending and receiving an information signal. The communications device comprising an element having an opening defined therein for receiving an antenna, the element comprising first conductive material disposed proximate the opening and comprising transmitting and receiving circuits. The antenna comprises: a dielectric tubular member, second conductive material forming an exterior surface of the tubular member with the second conductive material defining a slot therein, a slot length approximately equal to one-half of a guided wavelength and a feed connected to the transmitting and receiving circuits and disposed proximate the slot for establishing currents in the second conductive material.
US07804457B2
A multi-band antenna is adapted to operate in a first frequency band and a second frequency band which is lower than the first frequency band. In the multi-band antenna, an antenna element has an electrical length of ¾ wavelength of the first frequency band. The antenna element has a first end adapted to be electrically connected to a power feeding point, and a second end. An inductor is electrically connected between the second end of the antenna element and a ground in a serial manner. The inductor has such an inductance that an electrical length of the antenna element and the inductor corresponds to ½ wavelength of the second frequency band.
US07804456B2
The wideband L-loop antenna is presented in this invention. It has excellent performance for lower band of UWB system and has the attractive features of small size, inexpensive, and easy to design. The antenna composed of a single metallic layer is printed on the top of a substrate and a coupled tapered transmission line is printed on the top of the same substrate. A L shape portion is formed by widening partially or wholly the width of a part of antenna elements in comparison with the other part.
US07804454B1
A combined antenna transmitter joined for transmitting a message signal includes a switching signal source modulated by the message signal. The switching signal is provided to a transistor at an operating frequency. The transistor switches a high voltage input through the transistor, a choke inductor and a boost inductor. A bypass capacitor is provided between the inductors for shielding the high voltage input. An antenna is connected between the boost inductor and the transistor for transmitting a radio frequency signal at the operating frequency. There is thus provided a compact, efficient transmitter and antenna assembly for transmitting modulated message signals.
US07804447B2
A method for determining the positions of contacts through a global positioning system (GPS) is disclosed. The method includes sending position requests to the contacts, feeding back the current position information of the contacts to a GPS receiver of a user after receiving position requests, searching the contacts located within a same geographical region as the user according to the feedback information and displaying a list of the contacts to the user in the same geographical region.
US07804432B2
An integrated circuit device includes an amplifier circuit that includes first to Nth amplifiers, an A/D converter, first to Nth offset adjustment registers that are provided corresponding to the first to Nth amplifiers and store first to Nth offset adjustment data, first to Nth D/A converters provided corresponding to the first to Nth amplifiers, first to Nth offset value storage sections that store first to Nth offset value data, and a control circuit that calculates the first to Nth offset adjustment data based on the first to Nth offset value data, and sets the first to Nth offset adjustment data in the first to Nth offset adjustment registers.
US07804425B2
A vehicle parking assist system for assisting a driver of the vehicle in parking such vehicle in a garage located at a preselected global position. The system includes: a global positioning system mounted to the vehicle having stored therein the global position of the garage, for determining actual global position of the vehicle and providing a signal indicating when the vehicle is proximate the location of the garage; a range sensor for detecting a wall of the garage in front of a direction of motion of the vehicle into the garage; and a processor, responsive to the global positioning system provided by the global positioning system indicating when the vehicle is proximate the garage; the range sensor, for indicating when the vehicle has parked in the garage such that front of the vehicle is forward of the wall while enabling a door of the garage to be closed without striking the vehicle.
US07804419B2
Methods and systems for administering consumable compositions according to a programmed dosing schedule are provided. A method for administering a consumable composition may comprise one or more of the following steps: (a) dispensing a first dose of a consumable composition according to a programmed dosing schedule; and (b) detecting at least one ingestion of the consumable composition. A method for administering a consumable composition may comprise one or more of the following steps: (a) dispensing a first dose of a consumable composition according to a programmed dosing schedule; (b) detecting at least one aspect of the consumable composition; and (c) providing a user notification according to the aspect of the consumable composition. A system for administering a consumable composition may comprise: (a) means for dispensing a first dose of a consumable composition according to a programmed dosing schedule; and (b) means for detecting at least one ingestion of the consumable composition. A system for administering a consumable composition may carry out one or more of the following steps: (a) means for dispensing a first dose of a consumable composition according to a programmed dosing schedule; (b) means for detecting at least one aspect of the consumable composition; and (c) means for providing a user notification according to the aspect of the consumable composition.
US07804417B2
A lighting system and method for providing a particular lighting pattern from a predetermined set of lighting patterns are disclosed. The system comprises a presence detector for detecting a presence of a person in an area, a timer for measuring a duration of the presence, a pattern selector for selecting the particular lighting pattern from the predetermined set of lighting patterns based on the presence and the duration, and a plurality of adjustable light sources for applying the particular lighting pattern.
US07804416B2
Methods and systems for tracking users and providing services are provided. The system comprises a plurality of pressure sensors, a storage unit, at least one service providing unit having a service, and a signal processing unit. The pressure sensors detect pressure applied thereon at a specific time point, and correspondingly generate sensed signals. The signal processing unit receives the sensed signals from the pressure sensors, and stores the sensed signals to the storage unit. The signal processing unit calculates a current state of an object according to the sensed signals and historical sensed signals and historical states of the object in the storage unit, and determines one of the at least one service providing unit according to the current state to activate service thereof.
US07804408B2
The present invention provides for an electronic tag housing used to support electronic tags to an article with a shrink wrap tube. The present invention provides an electronic tag assembly, including a housing, having a base and a cover attachable to the base. The housing includes a cavity for supporting an electronic tag. A heat shrinkable tube is supported by the housing between the cover and attachable base.
US07804400B2
An apparatus has a communications device associated therewith. In another aspect of the present invention, a pallet is made from thermoformed polymeric sheets with an attached communications device. A further aspect of the present invention provides a radio frequency identification device attached to an apparatus. In still another aspect of the present invention, a communications device is incorporated into one or more sheets of a pallet or other container prior to forming. Methods of making and using a thermoformed pallet and container, having a communications device, are also provided.
US07804392B2
A switching resistor for an electric switching device having an electrically conductive resistive material. The resistive material is a resistive material on a synthetic material basis.
US07804388B2
A transformer is provided. The transformer comprises a coil frame, an input coil and an output coil. The input coil and the output coil are both disposed on the coil frame and interlaced with each other. A second voltage outputted by the output coil is induced by a first voltage inputted into the input coil. The output coil comprises at least one metal strip to enhance the output power. The coil frame is formed with a plurality of coil openings with chamfered angles or rounded angles, so that the bended angle formed by the input coil at the location where the input coil passes each of the coil openings is substantially less than 15 degrees.
US07804383B2
A coupled Lamb wave resonator filter includes first and second Lamb wave resonators. The first Lamb wave resonator includes a first resonant layer, and first and second electrodes on opposite sides of the first resonant layer. The second Lamb wave resonator includes a second resonant layer, and third and fourth electrodes on opposite sides of the second resonant layer. One of the sides of the first resonant layer belongs to a plane parallel to a plane corresponding to one of the sides of the second resonant layer. Both planes pass through the third and fourth electrodes of the second Lamb wave resonator. A periodic lattice acoustically couples the first and second resonant layers.
US07804364B2
A method and apparatus is provided for detecting the output power of a power amplifier. The output power is detected by detecting the absolute values of the voltage and current at the output of the amplifier and mixing the detected voltage and current to generate a signal related to the output power.
US07804345B2
A driver circuit provides fast settling times, slew rate control, and power efficiency, while reducing the need for large external capacitors. A voltage reference circuit generates a voltage reference signal. A comparator compares the voltage reference signal and a driver output signal and generates an output high voltage control signal. An output driver includes a first and a second switch that are coupled together. The first and second switches are further coupled to generate the driver output signal in response to coupling the output high voltage control signal to the control terminal of the first switch and coupling an input signal to the control terminal of the second switch.
US07804343B2
One embodiment described is a charge pump arrangement that includes a regulator to regulate signals associated with two output nodes. A switching mechanism may be coupled to the regulator. The switching mechanism is to interrupt the regulator.
US07804337B2
A track-and-hold or sample-and-hold (S/H) circuit for an analog-to-digital converter (ADC) is provided. A difference between the disclosed S/H circuit and conventional S/H circuits is the use of a peaking circuit. This peaking circuit generally provides increased current to switching transistor when transitioning between track and hold which can increase the Spurious-Free Dynamic Range (SFDR) as low frequencies, by as much as 15dB.
US07804336B2
A track-and-hold circuit is provided. This track-and-hold circuit is adapted to track an analog input signal and hold a sampled voltage of the analog input signal at a sampling instant for processing by other circuitry, in response to a track signal that alternates with a hold signal. Preferably, the track-and-hold circuit includes a bi-directional current source that sources and sinks current through a first output node and a second output node, a unity gain amplifier that is coupled to first and second output nodes of the bi-directional current source and that receives the analog input signal, a resistor coupled to an output of the unity gain amplifier, and a capacitor coupled between the resistor and ground. Of interest, however, is the bi-directional current source, which includes a differential input circuit that is adapted to receive the track signal and the hold signal and that is coupled to the first and second output nodes and an RC network that is coupled to the differential input circuit. The RC network receives the analog input signal and is scaled to change the location of a zero to reduce the signal-dependence of the sampling instant.
US07804333B2
An input buffer circuit is disclosed. The input buffer circuit includes a buffer configured to receive an input signal and differentially amplify and buffer the received input signal, and a current regulator for regulating the amount of current in the buffer at a turn-on level which depends on a level of a voltage inputted thereto.
US07804331B2
A semiconductor device according to an embodiment of the present invention includes an output stage circuit including a first conductive type first transistor and a second conductive type second transistor, the first conductive type first transistor being connected between a first power supply terminal and an output terminal, the second conductive type second transistor being connected between a second power supply terminal and the output terminal and having a leak current larger than that of the first transistor, and an input stage circuit outputting a logic value setting the first transistor to a non-conductive state and setting the second transistor to a conductive state in accordance with a logic circuit disable signal input when the output stage circuit is in a disable state.
US07804329B2
The present invention enables fast transition between sleep and normal modes for circuits such as digital circuits. This invention utilizes chip internal charge transfer operations to put the circuit into fast sleep. The invention reduces external power involvement, and it expedites the sleep mode transition time by limiting charge transfers within the circuit. The fast sleep and fast wake-up enable more efficient power management of the system. This functionality also maximizes performance per power, and provides a more energy efficient computing architecture.
US07804325B1
To improve interfacing between a block of dedicated function circuitry and blocks of more general purpose circuitry on an integrated circuit (“IC”), signals that are to be output by the dedicated function block are routed internally in that block so that they go into interconnection circuitry on the IC for more efficient application by that interconnection circuitry to the general purpose circuitry. Some of this routing internal to the dedicated function block may be controllably variable. The routing internal to the dedicated function block may also be arranged to take advantage of “sneak” connections that may exist between the dedicated function block and the general purpose blocks.
US07804316B2
A pusher 200 that pushes a semiconductor device under test 300 against a test socket 500 in a semiconductor test apparatus 20 is provided that includes a main body section 210 that is thermally coupled with the thermal source 400 and a plurality of device pushing sections 220, each of which is physically and thermally coupled to the thermal source 400, is displaced toward the test socket 500 by the pushing force of the main body section 210 to contact a surface to be pushed of a semiconductor device under test 300, pushes the semiconductor device under test 300, and transmits heat from the thermal source 400 to the semiconductor device under test 300. Thermal conductivity between the pusher and the semiconductor device under test is enhanced to provide a pusher that can quickly and accurately test a semiconductor device.
US07804314B2
An electrical probe assembly includes a first probe housing pivotally connected to a base structure and receiving a first probe therein. The first probe is configured to interface with a first contact of an electrical component. A second probe housing is pivotally connected to the base structure and receives a second probe therein. The second probe is configured to interface with a second contact of the electrical component wherein the first and second contacts have a spatial relationship therebetween. An adjustment mechanism is connected to the first and second housing and configured to independently adjust an amount of rotation of the each of the housings to accommodate the spatial relationship.
US07804310B2
A multi-source MOS transistor includes a sense MOS transistor and a load MOS transistor, and is connected to a load. A current detection portion has a negative input offset voltage characteristic, and detects a first sense current in a state where it is connected to the power supply and the sense MOS transistor and a second sense current in a state where it is connected to the sense MOS transistor and the load MOS transistor. A calculation control portion calculates a load current based on the first sense current and the second sense current such that the effect of the input offset voltage in the current detection portion is cancelled.
US07804307B1
A first capacitor and a second capacitor are charged until voltage at the second capacitor settles to a settling voltage. While charging, the first capacitor is alternately switched between a current source and ground. When the settling voltage is reached, charging of the first capacitor is halted. The second capacitor continues to be charged until voltage at the second capacitor reaches a reference voltage. The amount of time it takes for the settling voltage to reach the reference voltage corresponds to a measure of capacitance on the first capacitor.
US07804306B2
A wireless sensor includes at least one capacitive plate for sensing a distance relative to an object of interest within a semiconductor-processing environment. The sensor includes an internal power source and wireless communication such that distance and/or parallelism measurements effected using the capacitive plate(s) can be provided wirelessly to an external device.
US07804305B2
Techniques are disclosed to select functional parameters and/or operating modes of a circuit based on a time measurement are disclosed. One example integrated circuit includes a threshold detection and timing circuit that is coupled to measure a signal during an initialization period of the integrated circuit from a multifunction capacitor that is to be coupled to a first terminal of the integrated circuit. A selection circuit is coupled to the threshold detection and timing circuit to select a parameter/mode of the integrated circuit in response to the measured signal from the multifunction capacitor during the initialization period of the integrated circuit. The multifunction capacitor is coupled to provide an additional function for the integrated circuit after the initialization period of the integrated circuit is complete.
US07804300B2
A radio frequency coils array includes a plurality of conductive RF loops (62a, 62b, 62c, 62d, 162a, 162b, 262a, 262b, 362a, 362b, 362c, 462a, 462b, 462c, 562a, 562b) configured to excite or receive magnetic resonance signals, and a plurality of electronics modules (64a, 64b, 64c, 64d, 164a, 164b, 264a, 264b, 364a, 364b, 364c, 464a, 464b, 64c, 564a, 564b) corresponding to the plurality of conductive RF loops. The electronics modules are grouped together in a compact electronics region (66, 166, 266, 366, 466, 66). Each RF coil is operatively connected with a corresponding electronics module. Each electronics module includes at least a pre-amplifier.
US07804293B2
Provided is a power supply apparatus including a low pass filter that receives an output voltage of a current output section and allows a low frequency component with a frequency lower than a preset cutoff frequency to pass through; an excess voltage restricting load section that consumes an excess voltage restricting current, which is at least a portion of the output current from the current output section, when a load is turned on; and an excess voltage restricting control section that keeps the excess voltage restricting load section turned off when the output voltage of the current output section is less than an upper reference voltage, which is obtained by adding together a voltage output by the low pass filter and a preset upper offset voltage.
US07804286B2
An amplifier/comparator includes a multitude of output stages all sharing the same input stage. One or more of the output stages are amplification stages and have compensated output signals. A number of other output stages are not compensated and provide comparison signals. Each uncompensated output stage is adapted to switch to a first state if it detects a first input signal as being greater than a second signal, and further to switch to a second state if it detects the first input signal as being smaller than the second signal. By varying the channel-width (W) to channel-length (L) ratio (W/L) of the transistors disposed in the output stages, the trip points of the comparators and/or the electrical characteristics of the amplifiers are selectively varied.
US07804279B2
This invention discloses a power control system comprising a prime mover and a generator driven by the prime mover. A control device is coupled with the generator to ascertain a change in speed of the generator and vary an output power of the generator according to the change. The control device applies a signal to reduce the generator output power and another signal to restore the generator output power. The power control system may include a transmission, a speed converter, and/or an accessory.
US07804278B2
In one embodiment, a battery management system includes a charger controller for controlling a charging current of a battery according to a status of a load which is powered by the battery, and a counter coupled to the charger controller for determining a charging time according to such status. Advantageously, a first charging current is selected when the load is off. A second charging current that is less than the first charging current is selected when the load is on. Furthermore, a frequency of the counter is set to a first frequency when the load is off. The frequency is set to a second frequency that is less than the first frequency when the load is on.
US07804272B2
A noncontact type power feeder system for feeding a power to a mobile object, in which a power feeding portion and a power receiving portion can be easily manufactured at low costs and which can transmit a high power. The noncontact type power feeder system for a mobile object, comprises a power feeding portion provided in a surface on which the mobile object runs, and a power receiving portion provided in the lower part of the mobile object at a position facing to the power supply portion, the each of the power feeding portion and the power receiving portion is composed of windings formed in an oval shape, and a magnetic planar core formed therein with a recess in which the windings are accommodated so that the longitudinal direction of the oval shape of the windings is extended along the travel direction of the mobile object, the planer core is composed of several planar blocks each having a rectangular surface, several blocks being laid so that long sides of the rectangular surfaces are extended in the travel direction of the mobile object, in which several blocks are also laid in the direction orthogonal to the travel direction, and several blocks being superposed one upon another, the recess of the planar core is defined by thick wall parts in which the planar cores are superposed on the surface of the planar core, outside and inside of the oval shape part of the windings.
US07804271B2
A multiphase current supplying circuit includes a converter, an intervening circuit, an inverter, a control circuit and a lightning arrester. A power supply system is connected to the converter with the lightning arrester interposed therebetween, and the ac voltage is rectified. The intervening circuit includes a capacitor and a bypass connected in parallel thereto. In the bypass, a diode, a resistor and a capacitor are connected in series, and the direction from an anode to a cathode of the diode corresponds to the direction from a high potential side to a low potential side of the smoothing capacitor.
US07804267B2
In a correction method for a microprocessor-controlled digital regulation of a drive motor, wherein the measurement arrangement used for the regulation of the motor is simplified. recognizing that the real value surveying cannot always be implemented periodically by the microprocessor at the requested point in time, making sporadic measurement errors of a simplified measurement arrangement ineffectual, in accordance with the method individual measurement values with a sudden change are read out and correction values are used instead of these for the regulation.
US07804260B2
The present invention relates to a light emitting diode (LED) luminary system (10) comprising a plurality of LED light sources (14) of multiple colors for producing a mixed color light, and means (28) for controlling the LED light sources in accordance with differences between set point values representing a mixed color light having a desired color and first control data representing the color of the mixed color light produced by the LED light sources, the first control data being provided by at least one color sensor (22). The system is characterized by means (30, 32) for deriving the temperature of each LED light source, and means (26) for compensating the set point values in accordance with second control data including the LED light source temperatures. This offers increased color stability for the system. The invention also relates to a method and system for controlling a LED luminary.
US07804256B2
A light emitting diode (LED) lighting system includes a PFC and output voltage controller and a LED lighting power system. The controller advantageously operates from an auxiliary voltage less than a link voltage generated by the LED lighting power system. The common reference voltage allows all the components of lighting system to work together. A power factor correction switch and an LED drive current switch are coupled to the common reference node and have control node-to-common node, absolute voltage that allows the controller to control the conductivity of the switches. The LED lighting system can utilize feed forward control to concurrently modify power demand by the LED lighting power system and power demand of one or more LEDs. The LED lighting system can utilize a common current sense device to provide a common feedback signal to the controller representing current in at least two of the LEDs.
US07804254B2
The method and circuit of the present invention provides short-circuit detection and protection in a discharge lamp system. The transformer's primary current is sensed and used to provide short-circuit protection of the secondary winding side or high voltage side. The system and method with the present invention provides short-circuit detection and protection even when the transformer's secondary winding is shorted.
US07804252B2
A two way lighting control system with dual illumination sources, including a lighting unit, a photocell, a motion sensor, and at least one light source base. The lighting unit includes two light source loads. The high wattage light source load is the first light source, and the low wattage source load is the second light source. The illumination of the first light source load is greater than the illumination of the second light source load. The first light source load is electrically connected with the motion sensor via the base, and then is further electrically connected with the photocell to form the first circuit loop. The second light source load is electrically connected with the photocell via the base to form the second circuit loop. Thereby, the present invention can satisfy consumers' requirements of providing both high illumination light and low illumination light with energy saving benefit as needed.
US07804250B2
An apparatus and method to generate plasma which can be applied to semiconductor processing. The apparatus includes a chamber having a plasma generating space defined therein, a lower electrode positioned within the chamber, an upper electrode facing the lower electrode and disposed within the chamber to constitute a first plasma generating source, a second plasma generating source positioned at a higher location than that of a lower surface of the upper electrode and disposed at an outer circumference of the upper electrode, and a power supply to supply power to the first and second plasma generating sources.
US07804247B2
A plasma display panel has a front panel (10) and a back panel (20) that is arranged with a discharge space (30) therebetween. On the surface of the front panel facing toward the discharge space, a scan electrode (102) and a sustain electrode (103) are arranged. A dielectric layer (104) and a protective layer (105) are provided to cover the electrodes thereof and the surface. Between the scan electrode and the sustain electrode, a recessed portion (10a) is arranged in the first panel surface. The bottom surface (10b) of the recessed portion is arranged more inward in a thickness direction of the first substrate than the surfaces of the first electrode and the second electrode facing the discharge space whereby low power consumption, improved luminous efficiency, and a suppressed increase of firing voltage is achieved.
US07804245B2
An electroluminescent device having an opposing EL-segment pair, including a first EL-segment that produces light in response to a first through-device current having a first transparent electrode connection and a first reflective electrode connection; a second EL-segment that produces light in response to a second through-device current, and having a second transparent electrode connection and a second reflective electrode connection and being disposed adjacent to and spaced from the first EL-segment such that the first transparent electrode connection is on the opposite edge as the second transparent electrode connection and the direction of the first transparent electrode current is parallel but opposite to the direction of the second transparent electrode current; and the first and second EL-segments are connected to a common power source such that the two EL-segments can be simultaneously forward biased.
US07804230B2
A piezoelectric actuator for use in a fuel injector, the actuator comprising a stack of one or more piezoelectric elements for receipt within an accumulator chamber of the injector, distribution electrode means for generating an electric field within the stack and an electrical connector arrangement including a body member defining an external boundary and including a base portion and a stem portion projecting from the base portion. The base portion defines a base end face for abutment with an adjacent end face associated with the stack. Terminal means are provided for connection with an external power supply. The terminal means includes first and second terminal members disposed internal to the external boundary of the body member. The first and second terminal members are arranged side by side and disposed internal to the external boundary of the body member. The actuator further comprises first and second contact plates, each of which is connected electrically to a first end of a respective one of the first and second terminal members. The first and second terminal members are further connectable with an external power supply, in use, so as enable voltage supply to the distribution electrode means. The base portion of the body member defines a sealing surface for abutment with an internal surface defined by the accumulator chamber.
US07804225B2
A droplet discharging head, includes a diaphragm, a fixing plate, and a piezoelectric element. The piezoelectric element includes a first electrode, a second electrode, a piezoelectric body layer interposed between the first and second electrodes, a first internal electrode extending from the first electrode between the first, and second electrodes, and a second internal electrode extending from the second electrode between the first and second electrodes. At least a part of a first end face of the piezoelectric element is in contact with the diaphragm. The first end face includes a first end of the first electrode, a first end of the second electrode, and a first end of the piezoelectric Body. The piezoelectric body layer includes an active layer that overlaps both the first and second internal electrodes, a first inactive layer that overlaps only the first internal electrode, and a second inactive layer that overlaps only the second internal electrode. A thickness of the second inactive layer between the second electrode and the active layer is larger than a thickness of the first inactive layer between the first electrode and the active layer.
US07804223B1
An efficient piezoelectric-triggered time delay module may be provided with separate firing and logic capacitors, and may also have corresponding separate piezoelectric transducers. Further, separate firing and logic capacitors may be impedance-matched to corresponding separate piezoelectric transducers. Optionally, the capacitors may be made of the same materials as the corresponding piezoelectric transducers. Further alternately or additionally, low-value, high-voltage rated capacitor(s) may be employed. Further alternately or additionally, the piezoelectric transducer(s) may be selected to offer high charge output within the intended operating temperature range. Further alternately or additionally, the piezoelectric transducer(s) may be constructed with multiple wafers.
US07804218B2
When a rotating electrical machine winding is inserted into a slot with a protective insulation intervening between them, a semiconductive insulating layer is lap-wound between an interlayer insulating layer of the rotating electrical machine winding and the protective insulation, the semiconductive insulating layer being formed by center-folding a continuous semiconductive sheet in the longitudinal direction. A thermal stress relaxation layer is provided inside the center-folded continuous semiconductive sheet so that thermal stress exerted in thickness direction of the insulating layers is absorbed.
US07804213B2
An impeller and at least a portion of a cooperating peripheral volute may be integrated into, and preferably are integrally injection molded with, concentric outer rotor and inner stator assemblies, respectively, to achieve a low profile precision impeller mechanism based on an improved brushless d.c. motor with low length (L) to diameter (D) ratio and suitable for use in a variety of other applications. In one practical embodiment of such a motor, a rotating cap has an inner circumference which is molded about an outer ferromagnetic back ring that in turn supports a permanently magnetized ring shaped rotor magnet having a number of poles of alternating polarity defined about its inner circumference and separated by a relatively small cylindrical air gap from the outwardly projecting radially oriented selectively magnetized poles of a fixed stator assembly. In one exemplary embodiment, the rotor may have 8 poles and the stator may have 9 poles. The fixed stator assembly is preferably integrally molded into a base housing that also includes a precision fixed bearing support that extends upwardly through the center of the stator assembly and that is rotatably coupled to a rotating shaft that extends downwardly from (and preferably is integral with) the center of the rotating cap. A coaxial pair of preloaded ball bearings is preferably supported between an inner cylindrical surface of the fixed bearing support and an outer cylindrical surface of the rotating shaft, to thereby permit the rotor to rotate precisely about the stator with minimal variation in the cylindrical air gap therebetween.
US07804212B2
A sealant containment gasket is provided for use on an electric motor to be used in a moist environment. The inventive gasket includes a first upright wall that covers a power-supply opening in the motor with a wiring passageway and further includes a second upright wall, at least a portion of which is spaced away from the first upright wall. The walls of the gasket cooperate to form a pocket to receive wiring extending through the opening in the motor. The pocket also defines a cavity between the walls with a filling hole disposed along a top margin thereof. Liquid sealant is inserted into the cavity through the filling hole when the motor is disposed right-side-up and on its feet in the assembly position. The liquid sealant is contained within the pocket and forms a barrier around the wiring passageway to prevent moisture from entering the motor.
US07804211B2
A vibration generator has at least two groups of shafts, on which at least two groups of imbalances are disposed, and which are connected with at least one drive that rotates the shafts relative to one another, at different speeds of rotation, thereby achieving a directed advance. The operating direction of the vibration generator can be adjusted.
US07804207B2
This invention provides a positioning apparatus which improves the throughput by accelerating a stage in a shorter period of time while ensuring a fine positioning characteristic. A movable element is arranged on the side of a stage while a stator is arranged on the side of a base guide such that a pair of magnets of the same polarity face each other at each edge of the stroke region of the stage. This generates a repulsion force which acts against the thrust of the stage and corresponds to the facing area of the pair of magnets of the same polarity. The positioning apparatus further includes a large-thrust linear motor. The large-thrust linear motor assists the repulsion force by applying a thrust exceeding the repulsion force to the stage to increase the facing area of the pair of magnets of the same polarity.
US07804205B2
An electret device includes an electret film capable of storing charges and a charge outflow inhibition film formed on an upper surface of a region having a high charge density in the electret film and inhibiting the charges stored in the electret film from flowing out.
US07804204B1
A capacitive sensing system for use with a power cutting tool of the type which has an exposed, moveable blade adjacent a work surface is disclosed. The sensing system drives an excitation voltage onto the exposed blade and monitors the current drawn from the blade, detects changes in the amplitude and phase and analyzes the characteristics of the changes to selectively trigger a reaction system.
US07804203B2
The size of a wireless chip is often determined according to an antenna circuit thereof. Power source voltage or power supplied to the wireless chip can be more easily received with a larger antenna. On the other hand, there has been an increasing demand for a compact wireless chip, and it is thus necessary to downsize an antenna. In view of this, the invention provides a wireless chip capable of data communication with a small antenna, namely a compact wireless chip having an improved communicable distance. A power source circuit of an ID chip of the invention generates a higher power source voltage than a power source voltage generated in a conventional ID chip, by using a boosting power source circuit having a boosting circuit and a rectifier circuit.
US07804201B1
A portable remote switch operator system for temporarily connecting an actuator near a switch for operating the switch. The system further contemplates using a portable remote switch operator for temporarily connecting an operator or a human, to engage a switch that does not place a human in danger when turning on a high voltage switch.
US07804198B2
In an electrical distribution system for supplying power from an AC source to an adjustable-speed drive connected in a single-phase manner, a device for substantially eliminating harmonic currents in the supply lines of said system. The device includes a completely-passive parallel resonant circuit having three passive electrical branches connected in parallel and also having an almost infinite impendence at a third harmonic frequency of a fundamental frequency of said AC source to prevent the formation of only said third harmonic frequency so that there is no third harmonic current to remove or dissipate as heat. The three passive electrical branches comprise a first branch consisting of a capacitor, a second branch consisting of a reactor, and a third branch consisting of a resistor. The parallel resonant circuit is electrically connected to at least one supply line.
US07804185B1
The invention discloses a non-fuel combusting air turbine assembly suitable as a stand alone system for generating electricity. The systems include an air turbine engine powered by a compressor mechanism to increase the potential energy that can be harnessed by the turbines, having a noise reducing air intake section for delivering air to the compressor. Additionally, the systems include a turbine mechanism composed of plural sets of stationary vanes and rotating vanes, preferably arranged alternatively, and a battery rechargeable by a generator operable by the rotating turbine vanes. To initiate starting the turbine assembly, a secondary power source is included.
US07804176B2
This invention is to provide a nonvolatile memory device that enhances a size reduction and mass productivity while ensuring reliability and signal transmission performance. A nonvolatile memory chip having a first side formed with no pads and a second side formed with pads is mounted on a mounting substrate. A control chip for controlling the nonvolatile memory chip is mounted on the nonvolatile memory chip. The control chip has a first pad row corresponding to the pads of the nonvolatile memory chip. The first pad row is mounted adjacent to the first side of the nonvolatile memory chip. The first pad row of the control chip and a first electrode row formed on the mounting substrate are connected via a first wire group. The pads of the nonvolatile memory chip and a second electrode row formed on the mounting substrate are connected via a second wire group. The first electrode row and the second electrode row are connected through wirings formed in the mounting substrate.
US07804170B2
A semiconductor device contains an interposer having a square planar geometry, with length X for a first edge and length Y for a second edge orthogonal to the first edge, and a semiconductor chip and a dummy component disposed over the interposer, wherein the center of a first outer circumferential region, which surrounds the semiconductor chip over the interposer, and has length “a” for a third edge, and length “b” for a fourth edge, does not coincide with the center of the interposer, or equation X:Y=a:b is not satisfied, and the center of a second outer circumferential region, which surrounds the first outer circumferential region and the dummy components disposed over the interposer, and has length “x” for a fifth edge, and length “y” for a sixth edge, coincides with the center of the interposer, and equation X:Y=x:y is satisfied.
US07804168B2
Semiconductor device packages formed in accordance with methods of packaging semiconductor dice in grid array-type semiconductor device packages using conventional lead frame or lead lock tape assembly equipment are disclosed. Circuitry-bearing structure having an electrically insulating layer that carries redistribution electrical connections having redistributed bond pads and conductive traces and which is supported from beneath by a support layer are configured for securing to the active surface of a semiconductor die. The support layer may comprise an electrically conductive material, which may act as a heat sink or as a ground plane for the packaged semiconductor device. A semiconductor device and a semiconductor assembly are also provided.
US07804167B2
An integrated circuit package includes a package substrate, a die attach pad formed on the package substrate for securing a die to the package substrate, a ground bonding ring formed on the package substrate for attaching core and I/O ground bond wires between the die and the package substrate, and a first plurality of bond fingers formed immediately adjacent to the ground bonding ring for attaching a first set of I/O signal bond wires between the package substrate and the die.
US07804155B2
A vertical resistor. A substrate includes a trench filled by an isolation layer. A first doped-type region and a second doped-type region are formed on both sides of the trench. The first doped-type region receives a control bias, the second doped-type region receives a reference bias, and a resistance between the second doped-type region and the substrate is adjusted in response to a voltage difference between the control bias and the reference bias.
US07804152B2
In some embodiments, a memory integrated circuit has different shallow trench isolation structures in the memory circuitry of the memory integrated circuit and the control circuitry of the memory integrated circuit. The isolation dielectric fills the trenches of the shallow trench isolation structures to different degrees.In some embodiments, a memory integrated circuit has memory circuitry with shallow trench isolation structures and intermediate regions. The memory circuitry supports a channel between neighboring nonvolatile memory devices supporting multiple current components with different orientations.In some embodiments, recessed shallow trench isolation structures are formed.
US07804150B2
A field effect transistor includes a trench gate extending into a semiconductor region. The trench gate has a front wall facing a drain region and a side wall perpendicular to the front wall. A channel region extends along the side wall of the trench gate, and a drift region extends at least between the drain region and the trench gate. The drift region includes a stack of alternating conductivity type silicon layers.
US07804148B2
An opto-thermal annealing mask stack layer includes a thermal dissipative layer located over a substrate. A reflective layer is located upon the thermal dissipative layer. A transparent capping layer, that may have a thickness from about 10 to about 100 angstroms, is located upon the reflective layer. The opto-thermal annealing mask layer may be used as a gate electrode within a field effect device.
US07804144B2
A gate oxide and method of fabricating a gate oxide that produces a more reliable and thinner equivalent oxide thickness than conventional SiO2 gate oxides are provided. Gate oxides formed from alloys such as cobalt-titanium are thermodynamically stable such that the gate oxides formed will have minimal reactions with a silicon substrate or other structures during any later high temperature processing stages. The process shown is performed at lower temperatures than the prior art, which inhibits unwanted species migration and unwanted reactions with the silicon substrate or other structures. Using a thermal evaporation technique to deposit the layer to be oxidized, the underlying substrate surface smoothness is preserved, thus providing improved and more consistent electrical properties in the resulting gate oxide.
US07804143B2
A “tabbed” MOS device provides radiation hardness while supporting reduced gate width requirements. The “tabbed” MOS device also utilizes a body tie ring, which reduces field threshold leakage. In one implementation the “tabbed” MOS device is designed such that a width of the tab is based on at least a channel length of the MOS device such that a radiation-induced parasitic conduction path between the source and drain region of the device has a resistance that is higher than the device channel resistance.
US07804141B2
A semiconductor element structure includes a first MOS having a first high-K material and a first metal for use in a first gate, a second MOS having a second high-K material and a second metal for use in a second gate and a bridge channel disposed in a recess connecting the first gate and the second gate for electrically connecting the first gate and the second gate, wherein the bridge channel is embedded in at least one of the first gate and the second gate.
US07804131B2
A multi-chip module that includes a conductive element connecting at least two semiconductor devices, the conductive element including enhancements for improving the mechanical coupling between the conductive element and the molded housing of the MCM.
US07804129B2
Disclosed are a transistor and a method for fabricating the same capable of increasing a threshold voltage and a driving current of the transistor. The method includes the steps of forming a first etch mask on a silicon substrate, forming a trench by etching the exposed isolation area, forming a first insulation layer in the trench and the first etch mask, forming a second insulation layer on the first insulation layer, removing the second insulation layer and the first insulation layer until the first etch mask is exposed, forming a trench type isolation layer on the isolation area, forming a second etch mask on an entire surface of the silicon substrate, etching the exposed channel area, performing an etching process with respect to a resultant substrate structure, and forming a gate in the recess.
US07804127B2
A semiconductor non-volatile memory cell includes an Si (silicon) layer containing substrate including an activation region having a ridge portion; an element separation region embedded in both sides of the activation region; a gate electrode with a gate insulation film inbetween formed over the ridge portion for covering a part of both side surfaces of the ridge portion and an upper surface of the element separation region; a channel forming region formed in a surface layer region of the ridge portion; an extension region formed on both sides of the channel forming region in the longitudinal direction; and an electric charge accumulation layer capable of accumulating electric charges and a sidewall formed on the extension region and one or both of side surfaces of the gate electrode facing with each other in the longitudinal direction.
US07804125B2
A semiconductor device includes a substrate, a memory cell formed on the substrate, and a contact to the substrate. The contact is formed in an area away from the memory cell and functions to raise the potential of the substrate.
US07804124B2
Device and design structures for memory cells in a non-volatile random access memory (NVRAM). The device structure includes a semiconductor body in direct contact with the insulating layer, a control gate electrode, and a floating gate electrode in direct contact with the insulating layer. The semiconductor body includes a source, a drain, and a channel between the source and the drain. The floating gate electrode is juxtaposed with the channel of the semiconductor body and is disposed between the control gate electrode and the insulating layer. A first dielectric layer is disposed between the channel of the semiconductor body and the floating gate electrode. A second dielectric layer is disposed between the control gate electrode and the floating gate electrode.
US07804123B2
A nonvolatile semiconductor memory according to an example of the present invention includes first and second diffusion layers, a channel formed between the first and second diffusion layers, a gate insulating film formed on the channel, a floating gate electrode formed on the gate insulating film, an inter-gate insulating film formed on the floating gate electrode, and a control gate electrode formed on the inter-gate insulating film. An end portion of the inter-gate insulating film in a direction of channel length is on an inward side of a side surface of the floating gate electrode or a side surface of the control gate electrode.
US07804119B2
Device structures with hyper-abrupt p-n junctions, methods of forming hyper-abrupt p-n junctions, and design structures for an integrated circuit containing devices structures with hyper-abrupt p-n junctions. The hyper-abrupt p-n junction is defined in a SOI substrate by implanting a portion of a device layer to have one conductivity type and then implanting a portion of this doped region to have an opposite conductivity type. The counterdoping defines the hyper-abrupt p-n junction. A gate structure carried on a top surface of the device layer operates as a hard mask during the ion implantations to assist in defining a lateral boundary for the hyper-abrupt-n junction.
US07804117B2
A red pixel having a capacitor formed over the photo-conversion region of the pixel. The capacitor can be used by other pixels as a common capacitor. The capacitor is coupled to floating diffusion region shared by a plurality of pixels. The plurality of pixels also share readout circuitry.
US07804103B1
A high color rendering index (CRI) white light emitting device from a short wavelength semiconductor die is encapsulated with nanoparticle-loaded resin. Trichromatic wavelength conversion micro-particles are dispersed layer by layer in a converting sequence from a long emission spectrum to a short emission spectrum. The refractive index of wavelength conversion micro-particles matches that of the nanoparticle-loaded encapsulants.
US07804065B2
A method for calibrating an ion trap mass spectrometer is disclosed. The method includes steps of identifying a phase (defined by the RF trapping and resonant ejection voltages) that optimizes peak characteristics, and then determining, for each of a plurality of calibrant ions, an optimal resonant ejection voltage amplitude when the ion trap is operated at the identified phase. The resonant ejection voltage applied to the electrodes of the ion trap may then be controlled during analytical scans in accordance with the established relationship between m/z and resonant ejection voltage amplitude.
US07804064B2
A laser scattering based imaging technique is utilized in order to visualize the aerosol droplets in an inductively coupled plasma (ICP) torch from an aerosol source to the site of analytical measurements. The resulting snapshots provide key information about the spatial distribution of the aerosol introduced by direct and indirect injection devices: 1) a direct injection high efficiency nebulizer (DIHEN); 2) a large-bore DIHEN (LB-DIHEN); and 3) a PFA microflow nebulizer with a PFA Scott-type spray chamber. Moreover, particle image velocimetry (PIV) is used to study the in-situ behavior of the aerosol before interaction with, for example, plasma, while the individual surviving droplets are explored by particle tracking velocimetry (PTV). Further, the velocity distribution of the surviving droplets demonstrates the importance of the initial droplet velocities in complete desolvation of the aerosol for optimum analytical performance in ICP spectrometries. These new observations are important in the design of the next-generation direct injection devices for lower sample consumption, higher sensitivity, lower noise levels, suppressed matrix effects, and for developing smart spectrometers. For example, a controller can be provided to control the output of the aerosol source by controlling the configuration of the source or the gas flow rate via feedback information concerning the aerosol.
US07804053B2
A method and apparatus for determining the position of a target are disclosed. The method includes collecting onboard the platform a first set optical radiation in a first bandwidth and a second set of optical radiation in a second bandwidth reflected from a field of view; and determining the position of the target from the difference between the detected first and second sets of optical radiation. The apparatus includes a pair of detection channels a pair of detection channels, each of which further includes at least three optical channels, each detection channel capable of collecting onboard the platform a first set optical radiation in a first bandwidth and a second set of optical radiation in a second bandwidth, respectively, reflected from a field of view. The apparatus further includes a plurality of electronics capable of determining the position of the target from the difference between the detected first and second sets of optical radiation.
US07804052B2
Methods and apparatuses for non-optical testing of imaging devices having an array of pixels are provided. One or more pixels are tested by setting the photoconversion device and/or a floating diffusion region to a known voltage level that is different from that used to operate the pixel during non-test operation. The pixel is then sampled and compared to an expected value.
US07804047B2
A method and apparatus for determining a health status of a water heating device is disclosed. The water heating device may have a controller that incorporates logic to regulate the heater responsive to water temperatures detected at different areas within the water heating device by first and second sensors. Unfortunately, the first and second sensors may fail. To detect fault conditions or otherwise determine the heath status of the water heating device, a logic unit in the controller may perform a test on the first and/or second sensors so as to provide a test output. The logic unit may also determine whether the test output satisfies one or more predetermined thresholds. These predetermined thresholds may be indicative of a properly-functioning sensor. When the test output does not satisfy the at least one predetermined threshold, the logic unit may then set a fault condition indicative of improperly functioning sensors.
US07804043B2
The present invention relates to the apparatus, system and method for dicing of semiconductor wafers using an ultrafast laser pulse of femtosecond and picosecond pulse widths directly from the ultrafast laser oscillator without an amplifier. Thin and ultrathin semiconductor wafers below 250 micrometer thickness, are diced using diode pumped, solid state mode locked ultrafast laser pulses from oscillator without amplification. The invention disclosed has means to avoid/reduce the cumulative heating effect and to avoid machine quality degrading in multi shot ablation. Also the disclosed invention provides means to change the polarization state of the laser beam to reduce the focused spot size, and improve the machining efficiency and quality. The disclosed invention provides a cost effective and stable system for high volume manufacturing applications. An ultrafast laser oscillator can be a called as femtosecond laser oscillator or a picosecond laser oscillator depending on the pulse width of the laser beam generated.
US07804042B2
In a laser annealing system for workpieces such as semiconductor wafers, a pyrometer wavelength response band is established within a narrow window lying between the laser emission band and a fluorescence emission band from the optical components of the laser system, the pyrometer response band lying in a wavelength region at which the optical absorber layer on the workpiece has an optical absorption coefficient as great as or greater than the underlying workpiece. A multi-layer razor-edge interference filter having a 5-8 nm wavelength cut-off edge transition provides the cut-off of the laser emission at the bottom end of the pyrometer response band.
US07804039B2
A liquid phase diffusion bonding method for a metal machine part superior in the quality of the joint and the productivity enabling the bonding time to be shortened, achieving homogenization of the bonding structure and improving the tensile strength, fatigue strength, and joint quality and reliability. This liquid phase diffusion bonding method of a metal machine part is characterized interposing an amorphous alloy foil for liquid phase diffusion bonding at bevel faces of metal materials, performing primary bonding by melt bonding said amorphous alloy foil and said metal material by resistance welding to form a joint, then performing secondary bonding by liquid phase diffusion bonding by reheating said joint to at least the melting point of said amorphous alloy foil, then holding it there to complete the solidification process of said joint.
US07804034B2
An electrical appliance housing including a hard plastic housing body defining a switch-actuating aperture. The aperture is sealed with a soft plastic membrane. An actuating button is fastened to a hard plastic base that is bonded to the membrane.
US07804032B2
A frame section for a window or a door or a façade. The frame section includes an external shell and an internal shell. Each shell has hollow chambers. At least one of the shells includes a first groove and a second groove. The first groove is configured to accommodate hardware fittings. The second groove is configured to accommodate a cable.
US07804029B1
A device and method for altering the line reactance of a transmission line having a transmission line, a first floating conductor and a grounding (shielding) conductor. The first floating conductor is positioned between and electrically insulated from the transmission line and the grounding conductor. A source and a load are connected at opposite ends of the transmission line.
US07804024B2
A photovoltaic device capable of improving an output characteristic is obtained. This photovoltaic device includes a first conductivity type crystalline silicon region, a second conductivity type first noncrystalline silicon layer and a substantially intrinsic second noncrystalline silicon layer arranged between the crystalline silicon region and the first noncrystalline silicon layer, and the crystalline silicon region has an aperiodic corrugated shape having a height of not more than 2 nm on the interface between the same and the second noncrystalline silicon layer.
US07804019B2
A substrate is provided including a growth surface that is offcut relative to a plane defined by a crystallographic orientation of the substrate at an offcut angle of about 5 degrees to about 45 degrees. A thermoelectric film is epitaxially grown on the growth surface. A crystallographic orientation of the thermoelectric film may be tilted about 5 degrees to about 30 degrees relative to the growth surface. The growth surface of the substrate may also be patterned to define a plurality of mesas protruding therefrom prior to epitaxial growth of the thermoelectric film. Related methods and thermoelectric devices are also discussed.
US07804014B2
A tone plate which makes it easy to reduce the entire length and width thereof, thus increasing the degree of freedom in design. The tone plate includes an antinode portion, front and rear ends, and first and second supporting holes which are located closer to the front and rear ends than to the antinode portion and at which a vibration node can be formed. There are provided first and second mass concentrating portions extending toward the front and rear ends from locations on a side close to the first and rear ends with respect to the supporting holes. First and second thinner portions are respectively provided between the antinode portion and the supporting holes. The tone plate vibrates to generate a musical tone of a specific tone pitch when struck with being supported at the supporting holes.
US07804008B2
According to the invention, there is provided seed and plants of the corn variety designated CV609128. The invention thus relates to the plants, seeds and tissue cultures of the variety CV609128, and to methods for producing a corn plant produced by crossing a corn plant of variety CV609128 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV609128 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV609128.
US07804007B2
According to the invention, there is provided seed and plants of the corn variety designated CV494896. The invention thus relates to the plants, seeds and tissue cultures of the variety CV494896, and to methods for producing a corn plant produced by crossing a corn plant of variety CV494896 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV494896 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV494896.
US07804006B2
According to the invention, there is provided seed and plants of the corn variety designated CV951318. The invention thus relates to the plants, seeds and tissue cultures of the variety CV951318, and to methods for producing a corn plant produced by crossing a corn plant of variety CV951318 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV951318 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV951318.
US07804003B2
According to the invention, there is provided seed and plants of the corn variety designated CV603860. The invention thus relates to the plants, seeds and tissue cultures of the variety CV603860, and to methods for producing a corn plant produced by crossing a corn plant of variety CV603860 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV603860 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV603860.
US07803991B2
The invention provides universal chloroplast integration and expression vectors which are competent to stably transform and integrate genes of interest into chloroplast genome of multiple species of plants. Transformed plants and their progeny are provided. Monocotyledonous and dicotyledonous plants are transformed which have never been transformed heretofore. Plants transformed with a synthetic gene express valuable biodegradable protein-based polymers (PBPs). Transformed plants produce high value molecules. Resistance is provided to agricultural crops against the major classes of chemical herbicides. Herbicide resistance is used as a lethal selectable marker for chloroplast transformation. The transformed plants are capable of expressing in addition to the targeted trait, a desirable, secondary non-targeted trait. Insect resistance is provided to transformed plants, both against insects that are susceptible to Bt toxins and against insects that have developed resistance to Bt toxins.
US07803986B2
This invention relates to isolated nucleic acid fragments encoding fructosyltransferases. More specifically, this invention relates to polynucleotides encoding 1-FFTs, 6-SFTs, or 1-SSTs. The invention also relates to the construction of a recombinant DNA constructs encoding all or a portion of the fructosyltransferases, in sense or antisense orientation, wherein expression of the recombinant DNA construct results in production of altered levels of the fructosyltransferases in a transformed host cell.
US07803985B2
According to this invention, a gene cluster involved in the non-mevalonate pathway of Hevea brasiliensis was obtained and nucleotide sequences of these genes were determined. The gene cluster according to this invention involved in the IPP biosynthesis in the non-mevalonate pathway is involved in the biosynthesis of vitamin E and carotenoids. Therefore, the Hevea brasiliensis obtained by introducing the gene cluster of the present invention can be expected to produce high-quality rubber with improved permanence.
US07803974B2
Disclosed are heterogeneous processes (i) for the hydrogenation of a compound containing at least one unsaturated carbon-carbon bond, and (ii) for the hydro-dehalogenation of a compound containing at least one C—Cl, C—Br or C—I bond. The processes comprise reacting said compound with a hydrogenating agent and a heterogeneous hydrogenation catalyst in the presence of an ionic liquid.
US07803967B2
The invention relates to novel 4-alkoxy-cyclohexane-1-amino-carboxylic esters of the formula (IV) in which R1 and R2 are as defined in the description, to intermediates and processes for their preparation and to their use as intermediates in the synthesis of insecticidal, acaricidal and herbicidal compounds or pharmaceutically active compounds.
US07803966B2
This invention relates to novel compounds that display retinoid like activities, including HB-EGF (Heparin Binding Epidermal Growth Factor) release from keratinocytes, cell proliferation, and epidermal thickening without the irritation potentials, such as release of interleukin 8 and inhibition of terminal differentiation of keratinocytes. This invention also relates to the use of such a compound for both external and non-external applications.
US07803956B2
The invention relates to novel benzofuran derivatives, processes for their preparation and their use for preparing medicaments for the treatment or prophylaxis of disorders, especially of hyperproliferative disorders.
US07803955B2
The contemplated invention relates to the field of synthesis of biologically active substances, namely to the synthesis of an acetate derivative of the main water-soluble α-tocopherol metabolite known under the name of α-CEHC, which is prepared by the acid-catalyzed reaction of condensation of trimethyl hydroquinone with linalool in boiling octane, using n-toluenesulfonic acid or (+)-camphor-10-sulfonic acid as the catalyst. The reaction is carried out for 3 hours at the trimethyl hydroquinone:linalool:catalyst mole ratio of 1:1:0.1. The forming product is acetylated with acetic anhydride in pyridine at room temperature for 0.5 hour, and then ozonized in acetone in the presence of Ba(OH)2, oxidized with Jones' reagent in acetone, and isolated on silica gel column chromatography.Said compound is an acetate derivative of the main α-tocopherol metabolite—α-CEHC, for which high efficiency has been noted in treating disorders of the central nervous system.
US07803946B2
Disclosed herein is a class of tunable phenylacetylene compounds as well as compositions and methods for their use as host compounds for ligand binding. In certain examples the hosts report binding events by exhibiting altered spectroscopic properties, such as different fluorescent emission spectra.
US07803941B2
The present invention relates to an improved process for preparing ring-fluorinated aromatics of the general formula (I) by a halogen exchange reaction (halex reaction) of a plurality of halogen substituents in one stage in the presence of a catalyst.
US07803938B2
This application relates to a substituted hydroxyphenyl ketone compound of formula I, or a pharmaceutically acceptable salt thereof, a pharmaceutical composition thereof and its use in treating migraine. This application also relates to processes for preparing a compound of formula I, and intermediate compounds useful therein.
US07803929B2
The present invention relates to a method for diagnosing and/or monitoring a bacterial or parasitic infection by detection and quantification of the transrenal nucleic acids, derived from bacterial pathogenic agents or from parasites, in urine. The detection method optionally includes the isolation and the purification of the nucleic acids from urine by methods known in the art including pairing with molecular probes that are specific for the pathogenic agents, PCR hybridization, PCR, nested PCR, SSCP, LCR, and SDA. Diagnostic kits based on these detection methods are also claimed.
US07803927B2
Methods and compositions for the expression of transgenes in monocot plants including maize are disclosed. In the invention, gene silencing is avoided by use of monocot-homeologous sequences from plants of the genus Coix for transformation. Included in these transgene sequences are Coix promoters, enhancers, coding sequences and terminators. Suitable alternatives to maize-derived transgenes are desirable for expression in maize in that homology-based gene silencing can limit or effectively eliminate transgene expression.
US07803926B2
The cloning of a novel PCVII viral genome is described as is expression of proteins derived from the PCVII genome. These proteins can be used in vaccine compositions for the prevention and treatment of PCVII infections, as well as in diagnostic methods for determining the presence of PCVII infections in a vertebrate subject. Polynucleotides derived from the viral genome can be used as diagnostic primers and probes.
US07803925B2
Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a delta-endotoxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated delta-endotoxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:2, 4, 15, 17, or 19, or the nucleotide sequence set forth in SEQ ID NO:1, 3, 14, 16, or 18, as well as variants and fragments thereof.
US07803921B2
Isolated sulfotransferase nucleic acid molecules that include a nucleotide sequence variant and nucleotides flanking the sequence variant are described, as well as sulfotransferase allozymes. Methods for determining if a mammal is predisposed to cancer also are described.
US07803907B2
Polypeptides comprising monomer domains that bind to c-MET, or portions thereof, are provided.
US07803904B2
The present invention relates to fusion proteins comprising a naturally occurring primate MAdCAM, wherein said naturally occurring primate MAdCAM binds α4β7 integrin and has at least about 75% amino acid similarity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6.
US07803903B2
The invention relates to low-molecular doxorubicin peptide derivatives containing MMP-2 or MMP-9 divisible peptide sequences and a protein-binding group.
US07803901B2
This document provides methods and material related to natriuretic polypeptides. For example, substantially pure polypeptides having a natriuretic peptide activity, nucleic acids encoding polypeptides having a natriuretic peptide activity, host cells containing such nucleic acids, and methods for inducing a natriuretic or diuretic activity within a mammal are provided.
US07803891B2
The invention relates to polymeric resin blends containing polyelectrolyte resins blended into a polymer or copolymer matrix. Specifically, the polyelectrolyte resins are (co)polymers without hydrolyzable groups. The matrix polymer is a tough, and highly chemical-resistant (co)polymer, preferably a fluoropolymer. The polymeric resin blend is useful for forming films, and especially films useful for MEAs for use in fuel cells.
US07803887B2
A bridged metallocene compound of formula (I) wherein: M is a transition metal; X, is a hydrogen atom, a halogen atom, or a hydrocarbon group optionally containing hetematoms; L is a divalent bridging group; R1 is a linear C1C40 hydrocarbon radical optionally containing hetexoatonis; T1, T2, T3 and T4 are an oxygen or sulfur atom or a C(R18)2 group with the proviso that at least one group between T1 and T2 is an oxygen or a sulfur atom; wherein R18, are hydrogen atoms or a C1-C4O hydrocarbon radical; n is 1, 2 or 3; R4 is a hydrogen atom or a C1-C40 hydro carbon radical; W is an aromatic 5 or 6 membered ring.
US07803874B2
The invention provides a golf ball material comprising components (A), (B) and (C): (A) a mixture of different masterbatches prepared by separately masterbatching two or more different metal ions (A1) or a masterbatch prepared by simultaneously masterbatching two or more different metal ions in itself (A2), (B) one or more polymer selected from the group consisting of diene polymers, thermoplastic polymers and thermoset polymers, and (C) one or more polymer having an acid content of from about 0.5 to about 30 wt % and selected from the group consisting of olefin-unsaturated carboxylic acid copolymers, olefin-unsaturated carboxylic acid-unsaturated carboxylic acid ester terpolymers, unsaturated carboxylic anhydride-containing polymers, unsaturated dicarboxylic acid-containing polymers and unsaturated dicarboxylic acid half ester-containing polymers. The invention also provides a method for preparing such a golf ball material, and a golf ball made of the material. The golf ball material has a good thermal stability, flow and processability, making it suitable for injection-molding. Moreover, this material is ideal for producing, without any loss of the rebound resilience of golf ball parts molded from the material, high-performance golf balls having excellent durability, scuff resistance and flexibility.
US07803867B2
The invention relates to an aqueous-based fluoropolymer coating that is especially useful for use over flat or low-slope flexible surfaces, and more specifically for flat or low-slope roofing. The coating can be factory or field applied. The coating offers the advantages of improved durability, lower dirt pick-up, stain resistance, water repellency, increased solar reflectivity duration, and mildew resistance.
US07803864B2
A method for improving the viscosity stability of an aqueous composition having a latex polymer and associative thickeners with at least one hydrophilic segment and at least two hydrophobic segments is provided. The associative thickeners are chosen such that one associative thickener has a lower molecular weight than the other associative thickener.
US07803862B2
A composition for polyolefin resin foam, which comprises a polymer component comprising a polyolefin resin and a rubber and/or thermoplastic elastomer, and a powder particle, wherein the composition has an extensional viscosity as measured with a capillary rheometer (temperature, 200° C.; shear rate, 5,000 [1/s]) of from 20 to 100 kPa·s.
US07803860B2
The present invention relates to a crosslinkable polymer composition, comprising (i) a polyolefin, (ii) a polar copolymer, and (iii) a glycerol ester compound.
US07803851B2
An inkjet ink is provided, which includes a pigment dispersion containing an organic dispersant, a black pigment having an average particle diameter of not more than 200 nm, and a resinous dispersing agent, the organic dispersant being formed of at least one polymerizable compound, and the black pigment being included therein at an amount ranging from 2 to 30% by weight based on the organic dispersant, and an ionic compound. A ζ-potential of the black pigment to the at least one polymerizable compound of the organic dispersant is confined within the range of −10 mV to +100 mV.
US07803842B2
The present invention provides compounds of formula I described herein. The present invention also provides a method of treating a cognitive dysfunction in a mammal. The method includes administering to the mammal an effective amount of a compound of formula I described herein (e.g., stearyl choline chloride).
US07803838B2
Nebivolol has been shown to be beneficial in the treatment of cardiovascular diseases such hypertension, congestive heart failure, arterial stiffness and endothelial dysfunction. The present invention features a pharmaceutical composition comprising nebivolol and at least one other active agent, wherein the at least one other active agent is a cardiovascular agent.
US07803837B2
System for selecting a color shade comprising a very small number of color display cards with mixed shades of two or more colors. The system comprises means for selecting one shade among mixed shades, means for presenting the selected mixed shade as well as means for specifying the selected mixed shade for making paint in the desired color tone.
US07803835B2
The present invention relates generally to substituted acetic acid derivatives and methods of using them.
US07803833B2
The invention relates to quaternary α-aminocarboxyamide derivatives of formula (I), wherein R1, R2, R3, R4, R5, R6, X, q and n are as defined in claim 1, for treating diseases and conditions mediated by modulation of voltage-gated sodium channels.
US07803832B2
The invention relates to a sulfonamide compound of formula (I) or a pharmaceutically, veterinarily or agriculturally acceptable salt or solvate thereof, where the groups R1-R5 are described in the description, to compositions comprising such compounds, processes for their synthesis and their use as parasiticides.
US07803824B2
Compositions and methods for lowering IOP and/or providing neuroprotection are disclosed. The compositions and methods are particularly directed to the use inhibitors of Jun N-terminal kinases (JNK) to lower IOP and/or provide neuroprotection.
US07803813B2
The present invention relates to compounds of formula I: or a pharmaceutically acceptable acid addition salt thereof, wherein X is C(R3c)═ or N═; R1 is C2-C6 alkyl, substituted C2-C6 alkyl, C3-C7 cycloalkyl, substituted C3-C7 cycloalkyl, phenyl, substituted phenyl, heterocycle, or substituted heterocycle; R2 is hydrogen, C1-C3 n-alkyl, C3-C6 cycloalkyl-C1-C3 alkyl, or a group of formula II provided that when R1 is C2-C6 alkyl or substituted C2-C6 alkyl, R2 is hydrogen or methyl; R3a, R3b and, when X is —C(R3c)═, R3c, are each independently hydrogen, fluoro, or methyl, provided that no more than one of R3a, R3b, and R3c may be other than hydrogen; R4 is hydrogen or C1-C3 alkyl; R5 is hydrogen, C1-C3 alkyl, or C3-C6 cycloalkylcarbonyl, provided that when R3a is other than hydrogen, R5 is hydrogen; R6 is hydrogen or C1-C6 alkyl; and n is an integer from 1 to 6 inclusively. The compounds of the present invention are useful for activating 5HT1F receptors, inhibiting neuronal protein extravasation, and for the treatment or prevention of migraine in a mammal.
US07803799B2
This invention relates to selenophene compounds of formula (I) shown below. Each variable in formula (I) is defined in the specification. These compounds can be used to treat cannabinoid-receptor mediated disorders.
US07803797B2
Compounds comprising or a pharmaceutically acceptable salt or a prodrug thereof, are disclosed, wherein G, B, Y, and A are as described. Methods, compositions, and medicaments related thereto are also disclosed.
US07803793B2
This invention provides novel heterocyclic derived matrix metalloprotease inhibitors of the formula: and pharmaceutical compositions comprising same, useful for treating disorders ameliorated by antagonizing matrix metalloproteases. This invention also provides therapeutic and prophylactic methods using the instant pharmaceutical compositions.
US07803790B2
The present application relates to compounds and methods for treating pain and other conditions related to TRPV3.
US07803781B2
Compounds, compositions and methods are provided for modulating the expression of growth hormone receptor and/or insulin like growth factor-I (IGF-I). The compositions comprise oligonucleotides, targeted to nucleic acid encoding growth hormone receptor. Methods of using these compounds for modulation of growth hormone receptor expression and for diagnosis and treatment of disease associated with expression of growth hormone receptor and/or insulin-like growth factor-I are provided. Diagnostic methods and kits are also provided.
US07803772B2
The invention relates to fragments of an amino acid sequence of mature, full length 24 kDa fibroblast growth factor-2 or an analog thereof. The fragments have an activity that inhibits the migration of cultured cells as well as inhibiting angiogenesis, tumor growth, or any other processes that involve the migration of cells in vivo. This fragment does not stimulate the proliferation of cells which is in contrast to activity shown by the mature, full-length 24 kDa fibroblast growth factor-2. The present invention also relates to a DNA molecule encoding the fragment, an expression vector and a transformed host containing the DNA molecule, and a method of producing the protein by culturing the transformed host. Moreover, the present invention relates to a therapeutic composition the 24 kDa fibroblast growth factor fragment and a pharmaceutically acceptable carrier.
US07803757B2
The invention relates to new peptides formed of at least seven subsequent amino acids of the amino acids in position 12-40, counted from the N-terminal end, in the sequence constituting human lactoferrin, and preferably modifications thereof. The invention also relates to medicinal products comprising such peptides, especially intended for treatment and prevention of infections, inflammations and tumours. Furthermore, the invention relates to food stuff, e.g. infant formula food, comprising the above mentioned peptides.
US07803754B2
The present invention concerns combination of an amount of a GPR119 agonist with an amount of a dipeptidyl peptidase IV (DPP-IV) inhibitor such that the combination provides an effect in lowering a blood glucose level or in increasing a blood GLP-1 level in a subject over that provided by the amount of the GPR119 agonist or the amount of the DPP-IV inhibitor alone and the use of such a combination for treating or preventing diabetes and conditions related thereto or conditions ameliorated by increasing a blood GLP-1 level. The present invention also relates to the use of a G protein-coupled receptor to screen for GLP-1 secretagogues.
US07803751B2
The invention provides a method of modifying a phosphomonoester moiety of a target compound. The method can include the steps of (a) providing a target compound having an electrophilic moiety and a phosphomonoester moiety; (b) contacting the target compound with a first carbodiimide compound under conditions for preferential addition of the first carbodiimide compound to the electrophilic moiety over the phosphomonoester moiety, thereby forming an electrophile-protected target compound; and (c) contacting the electrophile-protected target compound with a second carbodiimide compound and a nucleophilic compound under conditions for addition of the nucleophilic compound to the phosphomonoester.
US07803750B2
The present invention relates, in general, to melanin production and, in particular, to a method of modulating melanin production and to compounds and compositions suitable for use in such a method.
US07803748B2
The invention discloses the nanoparticles composed of chitosan, poly-γ-glutamic acid, and at least one bioactive agent characterized with a positive surface charge and their enhanced permeability for paracellular drug delivery.
US07803738B2
Concentrated herbicide formulation, non-volatile, stable at low temperatures and soluble in water of 2,4-D acid ((2,4-dichlorophenoxy) acetic acid), characterized in that it includes: 45 to 75%, w/v of 2,4-D acid, in the form of a water soluble salt of a primary, secondary, or tertiary amine, or a primary, secondary, or tertiary alkanolamine, or a mixture of both; 1 to 40%, w/v of a humectant selected from a group made up of amine oxides, amide amine oxides, ethoxylated fatty amines, glycerin and its derivatives, sorbitol and its derivatives and polyethyleneglycol, and their mixtures; 0.1 to 20%, w/v of an antifreeze selected from a group made up of glycols; 0.01 to 0.5%, w/v of an antifoaming agent chosen from amongst silicon oil emulsions at 10-30%, surfactant agents based on hydrocarbons such as fatty acids and their salts in hydrocarbon, and alcohols with 8 or more carbon atoms, such as 2-ethylhexanol and isooctanol; optionally, 0.5-10%, w/v of a non-polar solvent; and the rest being water.
US07803737B2
Solid materials have been developed to remove arsenic compounds from aqueous media. The arsenic is removed by passing the aqueous phase through the solid materials which can be in molded, granular, or powder form. The solid materials adsorb the arsenic leaving a purified aqueous stream. The materials are aerogels or xerogels and aerogels or xerogels and solid support structure, e.g., granulated activated carbon (GAC), mixtures. The species-specific adsorption occurs through specific chemical modifications of the solids tailored towards arsenic.
US07803734B2
The present invention relates to a metal catalyst containing fine metal particles, characterized in that the fine metal particles have a particle diameter of 3 nm or less and also have a proportion of metallic bond state of 40% or more, which is ascribed by subjecting to waveform separation of a binding energy peak peculiar to the metal as measured by using an X-ray photoelectron spectrometer. The fine metal particles are preferably fine platinum particles. The fine metal particles are preferably supported on the surface of carrier particles by reducing ions of metal to be deposited through the action of a reducing agent in a reaction system of a liquid phase containing the carrier particles dispersed therein, thereby to deposit the metal on the surface of carrier particles in the form of fine particles. The proportion of metallic bond state of the fine metal particles is adjusted within the above range by reducing after deposition thereby to decrease the oxidation state.
US07803732B1
The present invention contemplates the addition of zirconium compounds to well known ceramic ballistic materials to increase resistance to penetration by projectiles. In the preferred embodiments of the present invention, the zirconium compound that is employed consists of ZrO2 and is provided in the range of about 0.1% to about 11%, by weight, of starting material before densification. Preferred ranges of proportion of ZrO2 in the finished ceramic material are in the ranges of about 0.30% to about 0.75%, by weight, or about 8-9%, by weight. The ballistic material using the combination of SiC with low volume of sintering aid and ZrO2 raises the theoretical density of the ceramic material to between 3.225 and 3.40 g/cc, which is slightly higher than the typical 3.22 g/cc theoretical density for hot pressed fully dense SiC. The unexpected result that accrues through combining silicon carbide and zirconia consists of the creation of controlled defects in the finished ceramic that increase the surface area that is fractured during a ballistic event, enhancing spreading of the forces imposed on the ceramic material by a projectile and, as a result, the ability of the ballistic material to withstand higher forces while resisting penetration.
US07803731B2
A glass fiber composition comprises about 52-65 weight % SiO2; less than or equal to 4 weight % Al2O3; about 7-16 weight % Fe2O3; greater than 6 weight % and less than or equal to about 14 weight % R2O; about 6-25 weight % CaO; less than or equal to 10 weight % MgO; and about 10-25 weight % RO; wherein R2O represents alkali metal oxides and RO represents alkaline earth metal oxides. Preferably, the glass fiber composition has a liquidus temperature of less than 2350° F.; and a viscosity at a liquidus temperature of the glass fiber composition of greater than 500 poise; and fire resistant glass fiber formed from the glass fiber composition has a biodissolution rate of greater than 50 ng/cm2/hr.
US07803728B2
A fiber is obtainable from or comprises an ethylene/α-olefin interpolymer characterized by an elastic recovery, Re, in percent at 300 percent strain and 1 cycle and a density, d, in grams/cubic centimeter, wherein the elastic recovery and the density satisfy the following relationship: Re>1481−1629(d). Such interpolymer can also be characterized by other properties. The fibers made therefrom have a relatively high elastic recovery and a relatively low coefficient of friction. The fibers can be cross-linked, if desired. Woven or non-woven fabrics can be made from such fibers.
US07803714B2
A through-silicon via structure is formed by providing a substrate having a first conductive catch pad and a second conductive catch pad formed thereon. The substrate is secured to a wafer carrier. A first etch of a first type is performed on the substrate underlying each of the first and second conductive catch pads to form a first partial through-substrate via of a first diameter underlying the first conductive catch pad and a second partial through-substrate via underlying the second conductive catch pad of a second diameter that differs from the first diameter. A second etch of a second type that differs from the first type is performed to continue etching the first partial through-substrate to form equal depth first and second through-substrate vias respectively to the first and second conductive catch pads.
US07803712B2
A mold with a protruding pattern is provided that is pressed into a thin polymer film via an imprinting process. Controlled connections between nanowires and microwires and other lithographically-made elements of electronic circuitry are provided. An imprint stamp is configured to form arrays of approximately parallel nanowires which have (1) micro dimensions in the X direction, (2) nano dimensions and nano spacing in the Y direction, and three or more distinct heights in the Z direction. The stamp thus formed can be used to connect specific individual nanowires to specific microscopic regions of microscopic wires or pads. The protruding pattern in the mold creates recesses in the thin polymer film, so the polymer layer acquires the reverse of the pattern on the mold. After the mold is removed, the film is processed such that the polymer pattern can be transferred on a metal/semiconductor pattern on the substrate.
US07803710B2
A method for fabricating a semiconductor device where a critical dimension in a peripheral region is decreased. The method includes the steps of: forming a silicon nitride layer on a substrate including a cell region and a peripheral region; forming a silicon oxynitride layer on the silicon nitride layer; forming a line-type photoresist pattern on the silicon oxynitride layer such that the photoresist pattern in the cell region has a width larger than that of a final pattern structure and the photoresist pattern in the peripheral region has a width that reduces an incidence of pattern collapse; etching the silicon oxynitride layer and the silicon nitride layer until widths of a remaining silicon oxynitride layer and a remaining silicon nitride layer are smaller than the width of the photoresist pattern used as an etch mask through suppressing generation of polymers; and over-etching the remaining silicon nitride layer.
US07803707B2
The present invention provides metal silicide nanowires, including metallic, semiconducting, and ferromagnetic semiconducting transition metal silicide nanowires. The nanowires are grown using either chemical vapor deposition (CVD) or chemical vapor transport (CVT) on silicon substrates covered with a thin silicon oxide film, the oxide film desirably having a thickness of no greater than about 5 nm and, desirably, no more than about 2 nm (e.g., about 1-2 nm). The metal silicide nanowires and heterostructures made from the nanowires are well-suited for use in CMOS compatible wire-like electronic, photonic, and spintronic devices.
US07803694B2
Semiconductor wafers having a thin layer of strained semiconductor material. These structures include a substrate; an oxide layer upon the substrate; a silicon carbide (SiC) layer upon the oxide layer, and a strained layer of a semiconductor material in a strained state upon the silicon carbide layer, or a matching layer upon the donor substrate that is made from a material that induces strain in subsequent epitaxially grown layers thereon; a strained layer of a semiconductor material of defined thickness in a strained state; and an insulating or semi-insulating layer upon the strained layer in a thickness that retains the strained state of the strained layer. The insulating or semi-insulating layers are made of silicon carbide or oxides and act to retain strain in the strained layer.
US07803684B2
In a semiconductor device, and a method of fabricating the same, the semiconductor device includes a protrusion extending from a substrate and a selective epitaxial growth (SEG) layer surrounding an upper portion of the protrusion, the SEG layer exposing sidewalls of a channel region of the protrusion.
US07803679B2
A method of forming a vertical diode and a method of manufacturing a semiconductor device (e.g., a semiconductor memory device such as a phase-change memory device) includes forming an insulating structure having an opening on a substrate and filling the opening with an amorphous silicon layer. A metal silicide layer is formed to contact at least a portion of the amorphous silicon layer and a polysilicon layer is then formed in the opening by crystallizing the amorphous silicon layer using the metal silicide layer. A doped polysilicon layer is formed by implanting impurities into the polysilicon layer. Thus, the polysilicon layer is formed in the opening without performing a selective epitaxial growth (SEG) process, so that electrical characteristics of the diode may be improved.
US07803676B2
Provided are a semiconductor device and a method of fabricating the semiconductor device. The semiconductor device using a DMOS device includes: a semiconductor substrate, in which a first conductive type well is formed; a first conductive type gate electrode formed on the semiconductor substrate with a gate insulating layer intervening between the gate electrode and the semiconductor substrate; a second conductive type body electrode formed on the semiconductor substrate and separated from the gate electrode; a first conductive type drain electrode formed on the semiconductor substrate and separated from the gate electrode and the body electrode; a second conductive type first body region formed in the well under the body electrode; a second conductive type second body region extending from the first body region to the gate insulating layer and formed in the well; a first conductive type source region formed in the second body region and extending from the first body region to the gate insulating layer; and a first conductive type source electrode extending from the source region to surround the gate electrode on the semiconductor substrate with an insulating layer intervening between the source electrode and gate electrode.
US07803675B2
The gate-all-around (GAA) type semiconductor device may include source/drain layers, a nanowire channel, a gate electrode and an insulation layer pattern. The source/drain layers may be disposed at a distance in a first direction on a semiconductor substrate. The nanowire channel may connect the source/drain layers. The gate electrode may extend in a second direction substantially perpendicular to the first direction. The gate electrode may have a height in a third direction substantially perpendicular to the first and second directions and may partially surround the nanowire channel. The insulation layer pattern may be formed between and around the source/drain layers on the semiconductor substrate and may cover the nanowire channel and a portion of the gate electrode. Thus, a size of the gate electrode may be reduced, and/or a gate induced drain leakage (GIDL) and/or a gate leakage current may be reduced.
US07803662B2
A method for curing an encapsulant that surrounds a plurality of integrated circuits on a strip that forms a strip assembly is provided. The strip assembly is composed of units for packaging and the units each have edges defining a perimeter of the unit. The strip assembly is placed on a shelf. Pressure from deformable material or springs is applied to the strip assembly in regions of the strip. The regions are located at one of a group of locations consisting of along unit edges and centered between unit edges. Heat of sufficient temperature is applied for a sufficient duration to cure the encapsulant. The step of applying pressure continues during the application of heat for curing.
US07803656B2
Provided is a method of depositing a chalcogenide film for phase-change memory. When the chalcogenide film for phase-change memory is deposited through a method using plasma such as plasma enhanced chemical vapor deposition (PECVD) or plasma enhanced atomic layer deposition (PEALD), a plasma reaction gas including He is used such that the crystallinity of the chalcogenide film is adjusted and the grain size and morphology of the deposited film are adjusted.
US07803652B2
Embodiments relate to a semiconductor device for an image sensor method of fabricating a semiconductor device for an image sensor having a micro lens. According to embodiments, the method may include forming a lower insulating film having cavities on a substrate, forming an upper insulating film having cavities on the lower insulating film, forming a protective insulating film having metal films on the upper insulating film, forming a number of color filters having a specified pattern on the protective insulating film, forming a planarization layer having a specified curvature on the color filters to bury the color filters in the planarization layer, and forming a number of micro lenses on the planarization layer at respective positions corresponding to the color filters.
US07803651B2
A method of manufacturing the solar cell module 100 according to the embodiment of the present invention includes: a step of forming the plurality of thin line-shaped electrodes and the connecting electrode connected to one end portion of each of the plurality of thin line-shaped electrodes; a step of disposing the first resin layer on the blanket; and a step of transferring the first resin layer onto the blanket by pressing the blanket against the photoelectric conversion part. In the disposing step, the plurality of concave portions is formed in the first resin layer along the outer edge of the connecting electrode. In the transferring step, each concave portion is disposed at one end portion of each thin line-shaped electrode.
US07803649B2
An angular rate sensor 100 comprises a first structure 110 which includes a fixed portion 111 having an opening 114, a displacing portion 112 placed in the opening 114, and a connecting portion 113 adapted to connect the fixed portion 111 and the displacing portions 112; a second structure 130 which includes a weighting portion 132 joined to the displacing portion 112, and a pedestal portion 131 arranged to surround the weighting portions 132 and joined to the fixed portion 111, and is laminated in place on the first structure 110. A first body 140 formed by laminating a first metal layer 142 and a first insulating layer 141 thereon is joined to the fixed portion 111 such that the first insulating layer 141 faces the fixed portion 111. A second substrate 150 formed by laminating a second metal layer 152 and a second insulating layer 151 thereon is joined to the pedestal portion 131 such that the second insulating layer 151 faces the pedestal portion 131.
US07803645B2
The present invention is to provide a light-emitting device, a laser diode, formed without using the mechanical cleavage, and a process for manufacturing the device. The process comprises, after stacking semiconductor layers of the first cladding layer, the active layer, and the second cladding layer, a forming of a groove to define the laser resonator, the depth of which reaches the substrate, and the mass-transportation, within the groove, from the side surface of the groove in a portion of the substrate and the first cladding layer to the facet of the active layer and the second cladding layer. Since the facet layer thus transported reflects the crystal orientation of the side of the groove, the crystal quality of the facet layer can be maintained.
US07803642B2
A technology for analyzing and evaluating of a change of impurity content distribution at the heat treatment of electrodeposited copper film. There is provided a method of evaluating a semiconductor device, comprising providing an electrodeposited copper film formed while causing the deposition current to transit between the first state of current density and the second state of current density so as to attain a desired impurity content distribution and carrying out analysis and evaluation of any impurity diffusion from a change of impurity content distribution in the electrodeposited copper film between before and after heat treatment.
US07803638B2
The present invention relates to a fluorescent label characterized by containing a hydrophilic polymer having an anionic group, a polyether derivative, and a phosphor, in which the phosphor is bound to the hydrophilic polymer via the polyether derivative, and also relates to a fluorescently labeled recognition substance labeled with the fluorescent label, and an immunoassay method using the recognition substance.
US07803635B1
A purge and trap concentrator system that includes a sparge vessel, and includes a variable gas flow valve for controlling the gas pressure in an analytic trap or the sparge vessel; a sensor that detects both a foaming sample state and a high liquid level in the sparge vessel, using one optical sensor; a control scheme that re-directs the purge gases to a second inlet of the sparge vessel during a foaming condition; a control scheme that uses a split flow to enhance the quantity of sample gases passed from an analytic trap; an electrically powered thermal energy source with a fan raising the sparge vessel temperature via thermal convection.
US07803634B2
An analysis of an object dyed with fluorescent coloring agents carried out with the aid of a fluorescent microscope which is modified for improved resolving power and called a nanoscope. The method is carried out with a microscope having an optical system for visualizing and projecting a sample image to a video camera which records and digitizes images of individual fluorescence molecules and nanoparticles at a low noise, a computer for recording and processing images, a sample holder arranged in front of an object lens, a fluorescent radiation exciting source and a set of replaceable suppression filters for separating the sample fluorescent light. Separately fluorescing visible molecules and nanoparticles are periodically formed in different object parts, the laser produces the oscillation thereof which is sufficient for recording the non-overlapping images of the molecules and nanoparticles and for decoloring already recorded fluorescent molecules, wherein tens of thousands of pictures of recorded individual molecule and nanoparticle images, in the form of stains having a diameter on the order of a fluorescent light wavelength multiplied by a microscope amplification, are processed by a computer for searching the coordinates of the stain centers and building the object image according to millions of calculated stain center co-ordinates corresponding to the co-ordinates of the individual fluorescent molecules and nanoparticles. With this invention it is possible to obtain a two-dimensional and a three-dimensional image with a resolving power better than 20 nm and to record a color image by dyeing proteins, nucleic acids and lipids with different coloring agents.
US07803630B2
The present invention provides compounds of Formula I: wherein: R1 is a label (e.g., a detectable groups; an anti-tumor agent)s; L is present or absent and when present is a linking group; and x represents an integer from 1 to 10; or a pharmaceutically acceptable salt thereof. the compounds are useful for, among other things, identifying cysteine sulfenic acids in proteins and monitoring oxidative damage in proteins and cells.
US07803618B2
The invention provides a family of antibodies that specifically bind the human epithelial cell adhesion molecule. The antibodies comprise modified variable regions, more specially, modified framework regions, which reduce their immunogenicity when administered to a human. The antibodies, when coupled to the appropriate moiety, may be used in the diagnosis, prognosis and treatment of cancer.
US07803616B2
An object of the present invention is to provide a medium supplement for animal cell culture and an animal cell culture medium. The present invention relates to a medium supplement for animal cell culture comprising sericin or a sericin derivative and an animal cell culture medium comprising at least said medium supplement and a basal medium composition.
US07803614B2
The present invention provides a nucleic acid sequence encoding a melanoma antigen recognized by T lymphocytes, designated MART-1. This invention further relates to bioassays using the nucleic acid sequence, protein or antibodies of this invention to diagnose, assess or prognoses a mammal afflicted with melanoma or metastata melanoma. This invention also provides immunogenic peptides derived from the MRT-1 melanoma antigen and a second melanoma antigen designated gp100. This invention further provides immunogenic peptides derived from the MART-1 melanoma antigen or gp100 antigen which have been modified to enhance their immunogenicity. The proteins and peptides provided can serve as an immunogen or vaccine to prevent or treat melanoma.
US07803598B2
An enzyme is described which enzyme is derived from family 13 of α-amylases. The enzyme variant is obtainable by modifying a CGTase or a maltogenic α-amylase. The enzyme is useful in preparing a food or a food product such as bakery products.
US07803596B2
A DNA Polymerase has been identified in a thermophile that functions as a chromosomal replicase. The specific enzyme is a holoenzyme III that has been identified in Thermus thermophilus, and corresponds to Polymerase III in E. coli. The genes and the polypeptides corresponding to T.th. γ, τ, ε, α and β subunits that they encode are disclosed, as are probes, vectors, methods of preparation and the methods of use. The enzymes of the present invention and their components are particularly well suited for use in procedures for the preparation of DNA, such as PCR, because of the speed and accuracy that they are able to achieve.
US07803590B2
The present invention relates to use of an anti-staling GH-61 polypeptide for preparing an edible product.
US07803588B2
The present invention disposes a membrane between two electrical conductive walls having a height at least as great as the thickness of the membrane. The conductive walls are fabricated on an electrically insulative chip base. The chip base has one or more through hole between the electrically conducting walls. The chip is placed inside a container having a well below the through hole of the electrically insulative base. At least one passageway extends from the well to the periphery of the container. This invention probes changes of the membrane as an in-plane electric field is applied between the conductive walls. The well may include various compounds while other compounds can be placed in contact with the top of the membrane. The passageways are used to introduce substances into and out of the well.
US07803585B2
A process for preparing a 2-hydroxy-4-substituted pyridine compound using a microbiological method, a novel microorganism, and a novel compound are provided.
US07803579B2
The present invention relates to a process for synthesizing or amplifying efficiently a nucleic acid comprising a target nucleic acid sequence. The process involves providing a primer comprising in its 3′-end portion a sequence (Ac′) which hybridizes a sequence (A) in the 3′-end portion of the target nucleic acid sequence, and in the 5′-side of the sequence (Ac′) a sequence (B′) which hybridizes the complementary sequence (Bc) of a sequence (B) positioned in the 5′-side of the sequence (A) on the target nucleic acid sequence, wherein {X−(Y−Y′)}/X is in the range of −1.00 to 1.00, in which X denotes the number of bases in the sequence (Ac′), Y denotes the number of bases in the region flanked by the sequences (A) and (B) in the target nucleic acid sequence, and Y′ denotes the number of bases in an intervening sequence between the sequences (Ac′) and (B′) (Y′ may be zero).
US07803578B2
The present invention provides: a protein having an improved nitrile hydratase activity, whereby heat resistance has been improved when compared with a wild-type nitrile hydratase activity, wherein the amino acid sequence of a nitrile hydratase is modified; a gene DNA encoding the above protein; a recombinant vector having the above gene DNA; a transformant or transductant having the above recombinant vector; a nitrile hydratase collected from a culture of the above transformant or transductant, and a production method thereof; and a method for producing an amide compound.
US07803576B2
The invention relates to VEGF-like nucleic acid sequences, their use, and vectors and transformants containing such sequences.
US07803575B2
The present invention relates to use of heat-stable carbonic anhydrase in CO2 extraction, e.g., from flue gas, natural gas or biogas. Furthermore, the invention relates to isolated polypeptides having carbonic anhydrase activity at elevated temperatures and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides.
US07803570B2
The invention relates to a method for determining the concentration of thrombin inhibitors in a non-turbid body liquid or a non-turbid extract from a body liquid. It comprises the following steps. The body liquid is taken from a living body, and the body liquid is subjected to a separation from the turbid matter, if necessary. To the non-turbid body liquid thus obtained are added a coagulation-inhibiting substance not interfering in the transformation prothrombin/active meizothrombin or Mtdesfg1, resp., a chromogenic or fluorogenic substrate not dissociable by active meizothrombin or Mtdesfg1, resp., and a substance dissociating prothrombin into meizothrombin or Mtdesfg1, resp., and as an option prothrombin. The thus obtained solution or mixture, resp., is subjected to a wavelength-selective light absorption or light emission measurement as a function of the time. From the reduction of the light absorption or light emission per time unit is determined the amount of the thrombin inhibitor included in the body liquid by comparison to previously determined standard curves.
US07803560B2
Novel human chemokine receptors, MCP-1RA and MCP-1RB, and processes for producing them are disclosed. The receptors, which are alternately spliced versions of MCP-1 receptor protein may be used in an assay to identify antagonists of MCP-1 which are therapeutically useful in the treatment of atherosclerosis and other diseases characterized by monocytic infiltrates.
US07803558B2
The present invention provides methods of inhibiting cadherins between Schlemm's canal cells, to a patient suffering from glaucoma as well as screening for substances that inhibit cadherins between the Schlemm's canal cells.
US07803557B2
The present invention is directed to methods for the identification and uses of a receptors that interact with anti-inflammatory compounds derived from eicosapentaenoic acid (EPA). The receptors are of the G-protein coupled receptor (GPCR) family, and are useful to screen candidate substances for anti-inflammatory activity, especially substances that are analogs of EPA. Such analogs are termed “resolvins”; and are typically di- and tri-hydroxy EPA analogs. One analog herein denoted Resolvin E1 was identified in humans and prepared by total synthesis. In nanomolar range Resolvin E1 reduces dermal inflammation, peritonitis, dendritic cells (DCs) migration and IL-12 production. Also described herein is a receptor denoted Reso ER1 that interacts with Resolvin E1 to attenuate cytokine induced activation of inflammatory pathways mediated by transcription factor (NF)-kB. Treatment of DCs with small-interfering RNA specific for ResoE1 eliminated the ligand's ability to regulate IL-12. Assays of anti-inflammatory activity based on these discoveries are also described.
US07803555B2
Methods and compositions are provided for at least slowing the progression of a filovirus mediated disease condition in a host. In the subject methods, an effective amount of an agent that at least reduces the amount of folate receptor mediated filovirus cell entry is administered to the host. The subject methods find use in both the prevention and treatment of filovirus associated disease conditions, including Marburg and Ebola-Zaire virus mediated disease conditions.
US07803548B1
The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided.
US07803544B2
A method of designing primers for use in a method of detecting an amplification product by hybridizing it with a probe, the amplification product is amplified from a target nucleic acid with the primers, including placing F3, F2 and F1 regions in this order from a 5′ terminal side and Bc, B2c and B1c regions in this order from a 3′ terminal side, and additionally an FP region in the region from the F2 to F1 regions and/or a BPc region in the region from the B2c to B1c regions in the target nucleic acid, determining the respective regions in such a manner that the FP and F2 regions and/or the BPc and B2c regions have an unoverlapping region of at least 10 bases or more and overlapping regions of 10 bases or less, and designing the primers according to the regions.
US07803538B2
The present invention relates to a method for diagnosing an individual for early onset Alzheimer's disease by measuring the presence or absence of the minor allele of the rs908832 polymorphism of the ABCA2 gene. The presence of the minor allele of the rs908832 polymorphism of the ABCA2 gene indicates that the individual may be suffering from Alzheimer's disease or exhibits an increased risk of developing Alzheimer's disease.
US07803529B1
This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.
US07803526B2
The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal antibodies against Chrysanthemum virus B coat protein in plants; conjugate labeled with alkaline phosphatase; coating buffer; extraction buffer; ECI buffer; PNP buffer.
US07803519B2
A method for manufacturing a semiconductor device using a photoresist polymer comprising a fluorine component, a photoresist composition containing the photoresist polymer and an organic solvent to reduce surface tension, by forming a photoresist film uniformly on the whole surface of an underlying layer pattern to allow a subsequent ion-implanting process to be stably performed.
US07803514B2
Disclosed herein may be a photosensitive composition, a microfabricated structure including the same, a device including the microfabricated structure, and methods of fabricating the microfabricated structure and the device. The photosensitive composition, including a multifunctional photosensitive resin, a two-photon photosensitizer, an organic solvent, and a silver compound, may be subjected to two- or three-dimensional microfabrication, thus realizing the microfabricated structure containing silver nanoparticles.
US07803513B2
A chemically amplified resist composition comprising:(A) a salt represented by the formula (I): wherein R21 represents a C1-C30 hydrocarbon group etc., Q1 and Q2 each independently represent a fluorine atom etc., and A+ represents at least one organic cation selected from a cation represented by the formula (Ia): wherein P1, P2 and P3 each independently represent a C1-C30 alkyl group etc., a cation represented by the formula (Ib): wherein P4 and P5 each independently represent a hydrogen atom etc., and a cation represented by the formula (Ic): wherein P10, P11, P12, P13, P14, P15, P16, P17, P18, P19, P20 and P21 each independently represent a hydrogen atom etc., B represents a sulfur or oxygen atom and m represents 0 or 1, (B) a salt represented by the formula (II): A′+−E (II) wherein A′+ represents at least one organic cation selected from cations represented by the above-mentioned formulae (Ia), (Ib) and (Ic), and E− represents at least one organic anion selected from an anion represented by the formula (II-1): −O3SQ3 (II-1) wherein Q3 represents a C1-C10 perfluoroalkyl group, and an anion represented by the formula (II-2): wherein Q4 represents a C1-C10 perfluoroalkyl group, and (C) a resin which contains a structural unit having an acid-labile group and which itself is insoluble or poorly soluble in an aqueous alkali solution but becomes soluble in an aqueous alkali solution by the action of an acid.
US07803511B2
A positive resist composition for immersion exposure comprises: (A) a resin capable of increasing its solubility in an alkali developer by an action of an acid, and (B) a compound capable of generating an acid upon irradiation with actinic ray or radiation, wherein the acid satisfies conditions of V≧230 and V/S≦0.93 taking van der Waals volume of the acid as V (Å3), and van der Waals surface area of the acid as S (Å2).
US07803497B2
A fuel cell stack that includes an actuating device or devices for selectively providing interdigitated reactant gas flow and straight reactant gas flow through reactant gas flow channels to reduce water accumulation in the diffusing media layers of the stack. In one embodiment, the fuel cell stack employs internal actuators that selectively close the inlet end of every other flow channel and the outlet end of every other opposite flow channel to provide the interdigitated flow. In another embodiment, the interdigitated flow is provided by external actuation where two inlet manifolds and two outlet manifolds are provided. One input manifold is closed to close the input ends of every other flow channel and one outlet manifold is closed to close the output ends of every other opposite flow channel.
US07803492B2
A fuel cell stack has fuel cell units. Each of the fuel cell units includes first and second membrane electrode assemblies and first to third separators sandwiching the first and second membrane electrode assemblies. A positioning mechanism is used for positioning the first to third separators in alignment with each other. The positioning mechanism includes a first protruded portion and a second protruded portion. The first protruded portion protrudes from one surface of the second separator for positioning the first separator. The second protruded portion protrudes from the other surface of the second separator for positioning the third separator.
US07803486B2
The invention provides a power storage device capable of preventing reduced energy efficiency of the power storage device and of avoiding variations in temperature distribution. The power storage device includes a positive electrode and a negative electrode, and a solid electrolyte layer placed between the positive electrode and the negative electrode and including a group of particles, wherein the density of particles in a first area of the solid electrolyte layer is lower than the density of particles in a second area which has higher heat radiation than the first area.
US07803482B2
A battery is provided with a battery stack body including a plurality of stacks of secondary batteries in each of which electrode plates, stacked via a separator, are accommodated and sealed in an outer sheath member, with electrode terminals correspondingly connected to the electrode plates and extracted from an outer peripheral edge of the outer sheath member, a pair of plate-like members, stacked as outermost layers of the battery stack body, respectively, so as to be opposed to each other, and a pressing mechanism pressing the plurality of secondary batteries via the pair of plate-like members. At least one of the pair of plate-like members having a characteristic exhibiting a maximum rigidity at a pressing center determined based on a plurality of pressing points of the at least one of the pair of plate-like members that are pressed by the pressing mechanism.